ID: 1147153312

View in Genome Browser
Species Human (GRCh38)
Location 17:38530978-38531000
Sequence TTTGGTTCCTGCACATTTAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 5, 1: 0, 2: 0, 3: 8, 4: 182}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147153312_1147153318 19 Left 1147153312 17:38530978-38531000 CCCATAAATGTGCAGGAACCAAA 0: 5
1: 0
2: 0
3: 8
4: 182
Right 1147153318 17:38531020-38531042 CCCACTGGGCTTCACCCGAGCGG 0: 1
1: 3
2: 0
3: 9
4: 96
1147153312_1147153323 25 Left 1147153312 17:38530978-38531000 CCCATAAATGTGCAGGAACCAAA 0: 5
1: 0
2: 0
3: 8
4: 182
Right 1147153323 17:38531026-38531048 GGGCTTCACCCGAGCGGGTGGGG 0: 1
1: 1
2: 9
3: 10
4: 87
1147153312_1147153322 24 Left 1147153312 17:38530978-38531000 CCCATAAATGTGCAGGAACCAAA 0: 5
1: 0
2: 0
3: 8
4: 182
Right 1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG 0: 1
1: 1
2: 3
3: 12
4: 56
1147153312_1147153315 4 Left 1147153312 17:38530978-38531000 CCCATAAATGTGCAGGAACCAAA 0: 5
1: 0
2: 0
3: 8
4: 182
Right 1147153315 17:38531005-38531027 AAGAAAGATGCAAATCCCACTGG 0: 5
1: 0
2: 0
3: 25
4: 267
1147153312_1147153325 29 Left 1147153312 17:38530978-38531000 CCCATAAATGTGCAGGAACCAAA 0: 5
1: 0
2: 0
3: 8
4: 182
Right 1147153325 17:38531030-38531052 TTCACCCGAGCGGGTGGGGCGGG 0: 1
1: 1
2: 4
3: 12
4: 89
1147153312_1147153326 30 Left 1147153312 17:38530978-38531000 CCCATAAATGTGCAGGAACCAAA 0: 5
1: 0
2: 0
3: 8
4: 182
Right 1147153326 17:38531031-38531053 TCACCCGAGCGGGTGGGGCGGGG 0: 1
1: 0
2: 1
3: 18
4: 119
1147153312_1147153320 20 Left 1147153312 17:38530978-38531000 CCCATAAATGTGCAGGAACCAAA 0: 5
1: 0
2: 0
3: 8
4: 182
Right 1147153320 17:38531021-38531043 CCACTGGGCTTCACCCGAGCGGG 0: 1
1: 2
2: 2
3: 8
4: 104
1147153312_1147153316 5 Left 1147153312 17:38530978-38531000 CCCATAAATGTGCAGGAACCAAA 0: 5
1: 0
2: 0
3: 8
4: 182
Right 1147153316 17:38531006-38531028 AGAAAGATGCAAATCCCACTGGG 0: 5
1: 0
2: 1
3: 14
4: 203
1147153312_1147153324 28 Left 1147153312 17:38530978-38531000 CCCATAAATGTGCAGGAACCAAA 0: 5
1: 0
2: 0
3: 8
4: 182
Right 1147153324 17:38531029-38531051 CTTCACCCGAGCGGGTGGGGCGG 0: 1
1: 0
2: 0
3: 4
4: 98
1147153312_1147153321 23 Left 1147153312 17:38530978-38531000 CCCATAAATGTGCAGGAACCAAA 0: 5
1: 0
2: 0
3: 8
4: 182
Right 1147153321 17:38531024-38531046 CTGGGCTTCACCCGAGCGGGTGG 0: 1
1: 1
2: 5
3: 5
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147153312 Original CRISPR TTTGGTTCCTGCACATTTAT GGG (reversed) Exonic
902812232 1:18894884-18894906 TTTGGTTCATGAACAATTTTGGG + Intronic
904958072 1:34305441-34305463 TTTGGTTTCTACATATTCATAGG + Intergenic
905517009 1:38569381-38569403 TTTGGGTGCTGGACAGTTATGGG + Intergenic
907817015 1:57928492-57928514 TTTTGGTGCTGCACATTTATGGG + Intronic
909440531 1:75691007-75691029 TTTGGGGCCTCCACCTTTATGGG - Intergenic
909742743 1:79052009-79052031 TCAGGTACCTGAACATTTATGGG + Intergenic
910125785 1:83840761-83840783 TTTGGTTCCTGCCTGTTTCTAGG - Intergenic
911003442 1:93192190-93192212 TTAGGTTACTGTAAATTTATTGG - Intronic
911900437 1:103496641-103496663 TTTGTGTCCTGCAGATTTAATGG - Intergenic
915795775 1:158732025-158732047 GGTGGTTCCTGAATATTTATGGG - Intergenic
916159937 1:161899709-161899731 TCTGGGTCTTGCATATTTATTGG + Intronic
917992229 1:180392980-180393002 TTTGAATGCTGAACATTTATTGG - Intronic
918985646 1:191622135-191622157 TTTGCTTCCAGTATATTTATAGG - Intergenic
921655073 1:217724870-217724892 TTTGTTTCCTTAACATATATAGG - Intronic
1064520414 10:16195091-16195113 TTTTGTTCCTTCACCTTTAAGGG - Intergenic
1066516150 10:36163008-36163030 TTTTTTTCCTGCAAATTTGTTGG - Intergenic
1066683583 10:37959464-37959486 TTTCATTCCTTCACTTTTATTGG + Intronic
1066999155 10:42590354-42590376 TTTGGTCCCGGCACTTTTTTTGG + Exonic
1068520791 10:58075073-58075095 TTTTATTCCTACACATTTTTTGG + Intergenic
1069322635 10:67191396-67191418 TTTGTATCCTGCAACTTTATTGG - Intronic
1070415632 10:76186667-76186689 TTTTGTCGGTGCACATTTATTGG + Intronic
1073070370 10:100789520-100789542 TTTGGTTTCTGGACTTTCATAGG - Intronic
1075355088 10:121764772-121764794 TATGCTACCTGCACATTTACTGG + Intronic
1079784110 11:24649232-24649254 TTAGGTTCTTCAACATTTATGGG - Intronic
1080563639 11:33487768-33487790 TTTGGACCCTACCCATTTATAGG - Intergenic
1086978163 11:93161567-93161589 TTTGAATCCTGGGCATTTATTGG - Intronic
1087092397 11:94286929-94286951 TTAGGTTCATGAACATTTAGAGG - Intergenic
1090118230 11:123997335-123997357 TTTGGTTAAAGCACAGTTATGGG - Intergenic
1093677474 12:21960632-21960654 TTTGTATCCTGCAGTTTTATGGG - Intergenic
1093975697 12:25419392-25419414 TTTGTATCCTGCAAATTTTTTGG + Intronic
1093987024 12:25546305-25546327 TTTGTTTTCTGCTGATTTATTGG + Intronic
1094512475 12:31104742-31104764 TTTGCATCCTGCACAGCTATAGG + Exonic
1096316241 12:50568835-50568857 CTTGGTTCCTGCAACTTTTTTGG - Intronic
1096932417 12:55227018-55227040 CTAGGTTCCTCCACATTTTTGGG - Intergenic
1097577564 12:61413752-61413774 TTGTATTCCTGCAAATTTATTGG - Intergenic
1097610112 12:61809137-61809159 TATGCTTTCTGCTCATTTATAGG - Intronic
1098333657 12:69380337-69380359 TGTGGTTCTTGCAGATTTGTAGG + Intronic
1099392326 12:82097229-82097251 TCTGGTTCCTTCTCATTTAGGGG + Intergenic
1099720276 12:86353454-86353476 TGTGTCTGCTGCACATTTATTGG - Intronic
1099792627 12:87356160-87356182 ATTGGTTCCTCCACATTTTACGG - Intergenic
1102317583 12:111902149-111902171 TTTGATGAATGCACATTTATAGG - Intergenic
1103774668 12:123358196-123358218 TTTGTTTCATGCACATTTTAAGG - Intronic
1103804926 12:123565026-123565048 TTTGGTTCCTGCCTATAAATTGG + Intergenic
1104005418 12:124888722-124888744 TTTGTATCCTCCACATTTCTTGG + Intergenic
1106003435 13:25746598-25746620 TATGTTTCCTGCTCATTTGTGGG + Intronic
1106610041 13:31270065-31270087 CCTGGTTCCTTCACATTTACTGG + Intronic
1107743559 13:43480438-43480460 TTTGGATTATGCAGATTTATAGG + Intronic
1108359684 13:49657820-49657842 TTTAATTTGTGCACATTTATGGG - Intergenic
1108833981 13:54517341-54517363 TTTTGTTTATCCACATTTATTGG - Intergenic
1109259480 13:60126344-60126366 TTTAGTTCTTGGAAATTTATTGG - Intronic
1110045739 13:70828347-70828369 TATATATCCTGCACATTTATGGG + Intergenic
1110714163 13:78683051-78683073 TTTGGTTGGTGCAAATTTAAGGG + Intergenic
1112578224 13:100656080-100656102 TTTATTTCCTGCAAAATTATAGG - Intronic
1113484683 13:110645456-110645478 TTTGGTTCCTGCACGTCTGAGGG - Intronic
1117062551 14:51978079-51978101 TTTGGTTCCTTCATCTTTCTTGG + Intronic
1119191515 14:72685789-72685811 TTTCAATCCTGCACATTTCTAGG + Intronic
1120106445 14:80501082-80501104 TTTGTTTCCTGCAAATTTTCTGG + Intronic
1120233693 14:81867053-81867075 TTTAGTTCCTTCACATTTTGTGG + Intergenic
1121088431 14:91164403-91164425 TTTGGTGTCTGCACATTCAAGGG + Intronic
1121871857 14:97415442-97415464 TTAGCTACCTTCACATTTATTGG - Intergenic
1124198454 15:27655893-27655915 TTTGGTTGCTGCTCATTGTTTGG - Intergenic
1125261660 15:37832843-37832865 TTAGGTACATGCATATTTATTGG - Intergenic
1126207799 15:46065593-46065615 TTTGTATCCTGCAACTTTATTGG - Intergenic
1128631993 15:69277554-69277576 CTTGGTGCCTTCACATCTATGGG + Intergenic
1131235816 15:90696231-90696253 TTTGGGTTGTTCACATTTATGGG - Intergenic
1136518371 16:30781466-30781488 TTTTTTTCCTACATATTTATAGG + Exonic
1136690451 16:32024843-32024865 TTTGGTTCCTGCACATTTATGGG - Intergenic
1136791039 16:32968403-32968425 TTTGGTTCCTGCACATTTATGGG - Intergenic
1136878774 16:33885529-33885551 TTTGGTTCCTGCACATTTATGGG + Intergenic
1140759447 16:78098065-78098087 TTTGGATACAGAACATTTATAGG + Intergenic
1203093247 16_KI270728v1_random:1229864-1229886 TTTGGTTCCTGCACATTTATGGG - Intergenic
1143056844 17:4169087-4169109 CCTGGGTCCTGCACATTGATGGG - Intronic
1143532402 17:7512952-7512974 TTTGTTTCCTCCACAGTTCTGGG + Intronic
1146643877 17:34563479-34563501 TTTGGGAGCTGCACACTTATGGG - Intergenic
1147153312 17:38530978-38531000 TTTGGTTCCTGCACATTTATGGG - Exonic
1149282442 17:55122993-55123015 TTTGTTTTATTCACATTTATGGG + Intronic
1153235201 18:2979541-2979563 TTTGTTTCCTCTACATTAATAGG + Intronic
1155459237 18:26058101-26058123 TTTTGTTACTGTACATTTTTAGG - Intronic
1158557992 18:58490916-58490938 TGTGCTTCCTGCATATTCATGGG - Intronic
1158682029 18:59576969-59576991 TTTTGGTCCTGAGCATTTATAGG - Intronic
1164140674 19:22459220-22459242 GGTGGTACCTGCACATTTGTGGG - Intronic
1168558440 19:57363338-57363360 GTTCCTTCCTGCACATTCATTGG - Intergenic
928285932 2:29989988-29990010 ATTGGTTCATTCATATTTATAGG + Intergenic
928807904 2:35183578-35183600 TTTTGTTCTTACAGATTTATAGG - Intergenic
930211321 2:48640821-48640843 TTTGTTTGATGCACATTTAAAGG + Intronic
931463640 2:62468709-62468731 TTGGTTTCTTGCACATATATGGG - Intergenic
932750153 2:74366367-74366389 CTTGGCTCCTGCAGATCTATGGG - Exonic
933378081 2:81506859-81506881 TTTGGTTTCTGAGCATTTAAAGG - Intergenic
939685731 2:145197686-145197708 TTTGGCTACTGAACATTTATGGG - Intergenic
940000741 2:148964406-148964428 TTTGCTTCCCATACATTTATTGG - Intronic
940753167 2:157650688-157650710 TTTGATTCTTGGACATTTCTTGG - Intergenic
942641438 2:178065071-178065093 TTCAGTTCCTGGTCATTTATAGG - Intronic
943165783 2:184323929-184323951 TTTTGTCCCTTCAAATTTATAGG - Intergenic
943736202 2:191357810-191357832 GTTGGTGCATGCACATTTAGGGG + Intronic
945515295 2:210756626-210756648 TTTGATTCCCACATATTTATTGG + Intergenic
945635955 2:212351206-212351228 CTTGGTGCCTGCACATTCCTAGG - Intronic
946652685 2:221910768-221910790 CTTGGGTCCTGCACATTAATGGG + Intergenic
946889566 2:224261156-224261178 CTGGGTTCCTGCCCAGTTATAGG + Intergenic
1169825070 20:9758719-9758741 TTTAGTTCCCACACATTTAGTGG - Intronic
1171390840 20:24800661-24800683 TTTGCTTCCTTCACACATATGGG - Intergenic
1173504169 20:43574046-43574068 TTTGGTATCTTCACATTTTTAGG + Intronic
1175132066 20:56796787-56796809 TTGGCTTTCTGCATATTTATTGG + Intergenic
1176837682 21:13808996-13809018 TTTGGTTCCTGAACACTGACCGG - Intergenic
1179833738 21:44014310-44014332 TTTCTTTCCTACAGATTTATTGG + Intronic
1180121943 21:45758209-45758231 TTTGGATCCTGGAGATTTATAGG + Intronic
1181782601 22:25203901-25203923 TGTGGTTCCTGCTCACTTCTGGG + Intronic
1183962367 22:41419093-41419115 TTTGGTTTCTCCACATTGGTTGG - Intergenic
1184027588 22:41869425-41869447 TGTGGATCCTGAACATATATTGG + Intronic
950969360 3:17170694-17170716 TTGTGTTCCTGTACATTTCTGGG - Intronic
957460931 3:80519523-80519545 TTTCCTTCTTGAACATTTATTGG + Intergenic
961973769 3:130999839-130999861 TTTGGTTTTTGCTCTTTTATAGG + Intronic
963986874 3:151606502-151606524 TTTGCTCCCTGCTCATTTTTGGG + Intergenic
965519118 3:169655315-169655337 TATGGTACCTGCAAATTTACAGG + Intronic
971417022 4:26441078-26441100 TTTGGGACCTCCACATTTCTGGG - Intergenic
974283993 4:59839746-59839768 TTTGGTTCCTTCAAAGTTTTTGG + Intergenic
975125895 4:70781655-70781677 TTGGTTTCGTGCACATTTTTAGG + Intronic
975185334 4:71395447-71395469 TCTGGTTCCTGCATTTTTCTTGG + Intronic
976704828 4:88008522-88008544 TTTTGTTGGTGCATATTTATTGG + Intronic
979301024 4:119087567-119087589 TTTGGTGCCAGGACAGTTATTGG + Intergenic
980403317 4:132322151-132322173 TTTTTTTCTTGCAAATTTATTGG - Intergenic
982508531 4:156251099-156251121 TTTGTTGCCTGCACAGTTCTTGG + Intergenic
983526416 4:168764810-168764832 TTTGGTTCCCGCACCTCTCTTGG + Intronic
983992338 4:174135933-174135955 TTTGGTAACTGGACAATTATAGG - Intergenic
983993234 4:174148269-174148291 TTTCTCTCTTGCACATTTATTGG + Intergenic
984003660 4:174283031-174283053 TTTGGTTCCTAGACAGTTTTTGG - Intronic
984023952 4:174521174-174521196 TTTGTTTCCTGTAAGTTTATTGG + Intronic
985382335 4:189407722-189407744 TTTGGTTCCAGTTCATTTCTGGG - Intergenic
986035221 5:3930659-3930681 TTTGATACTTGAACATTTATAGG + Intergenic
986620602 5:9669218-9669240 TGTGTTGGCTGCACATTTATAGG - Intronic
988124272 5:27008942-27008964 TTTGGTTCATGAAAATTTACTGG - Intronic
989346502 5:40436202-40436224 TTTGATGCCTACATATTTATAGG - Intergenic
989534273 5:42545998-42546020 TTTGGTTTCAGCACACTAATAGG + Intronic
991271512 5:64788258-64788280 TTTGTTTCCAGCAAATATATTGG + Intronic
992648680 5:78836138-78836160 TTGGGTGCCTGCTCATTTTTAGG - Intronic
993178631 5:84519986-84520008 CTTGGTTCCTGCACTTTTCAAGG - Intergenic
993440921 5:87955864-87955886 TATGGTTCCTGCTAATTAATAGG + Intergenic
993507308 5:88725681-88725703 TTTGATTTCTGAACAATTATGGG - Intronic
996822036 5:127640350-127640372 TTTGTATCCTGCAACTTTATTGG - Intergenic
997014647 5:129918679-129918701 TTTGGTTCCAGCATATGTACAGG + Intronic
999400903 5:151263588-151263610 TTTGGTTCCTGAGCTTTTACTGG + Intronic
999722791 5:154411390-154411412 CTTGATTCCTGCACCTTTACTGG - Intronic
1001923544 5:175619203-175619225 TTTCGTTGCTGCAAATCTATGGG + Intergenic
1004244605 6:13961588-13961610 TCTTATTCCTGAACATTTATTGG + Intronic
1004789936 6:19014179-19014201 TTTGGTGCATACACATTTAAGGG - Intergenic
1005430844 6:25755269-25755291 TTTGGTTCCAGCGAATTTATGGG + Intronic
1008592800 6:53010702-53010724 TTTGGTTCCTTCTCATTCTTTGG + Intronic
1010028559 6:71247508-71247530 TTTGATACCTGCACATTTGAGGG - Intergenic
1010218063 6:73422483-73422505 TTTAGTTCCTTTACATTTGTAGG - Intronic
1014326598 6:120004174-120004196 ATTTCTTCCTTCACATTTATTGG - Intergenic
1014698054 6:124648805-124648827 TTTGATTTCTTCACATTTTTTGG - Intronic
1014996976 6:128159037-128159059 TTTAGTTTCTGAACATATATGGG + Intronic
1017655421 6:156623455-156623477 TTTAATTCCTGAAAATTTATGGG - Intergenic
1019861159 7:3659336-3659358 TTTGGTTTTTGCCCATTTTTTGG - Intronic
1020992433 7:15216799-15216821 TTTGTTTCTTGCACTTATATAGG - Intronic
1021885168 7:25130706-25130728 TTTGGTTCCTGAACAAGTAGGGG + Intergenic
1022302227 7:29112517-29112539 TTTGTTTCCTGCCCATAAATAGG + Intronic
1023170985 7:37390232-37390254 TTGGGTTCCTGCTCAGTTAAGGG - Intronic
1026413016 7:70145850-70145872 TTTGGTTTCAGCACATCTATGGG + Intronic
1027707459 7:81552168-81552190 TTTGTTTCCTATGCATTTATAGG + Intergenic
1027929090 7:84508082-84508104 TTAGGTTCCTGCAAATTTTCTGG - Intergenic
1029129827 7:98321640-98321662 TTTGGTTCCTGCAGATAAGTTGG - Intronic
1030313496 7:108091378-108091400 TTTGATCCGTTCACATTTATGGG + Intronic
1030476433 7:110039325-110039347 TTTGTATCCTGCAAATTTACTGG + Intergenic
1033289114 7:140066729-140066751 TTTGGCTCCAGAACCTTTATTGG - Intergenic
1038694799 8:29797010-29797032 TTTGGTTCCTGGCCATTTCCAGG + Intergenic
1039080872 8:33732930-33732952 CTTGTTTCCTTCAGATTTATTGG + Intergenic
1042047523 8:64670600-64670622 TTTGGTTCCTGCAGAATGAGTGG - Intronic
1047290136 8:123522697-123522719 TTTTGTTCCTTCCCATTTCTAGG + Intronic
1047505538 8:125476781-125476803 TTTGGGTTCTGAACATTTTTTGG - Intergenic
1048157347 8:131970821-131970843 TTTGTGTCCTGCAGATTTAATGG - Intronic
1050583760 9:7088291-7088313 TTTTGTTCATTCACATTTAAGGG + Intergenic
1051982578 9:23041074-23041096 TTTGCTTCCTGCATATTTTCAGG - Intergenic
1055771896 9:79726051-79726073 TTTGGGAGCTGCACAGTTATGGG + Intronic
1058546447 9:106065307-106065329 TTGGGTTCTTTCACATATATAGG + Intergenic
1059944370 9:119393826-119393848 TTTGGTTCCTTCTCATTTTAGGG + Intergenic
1061442998 9:130619229-130619251 TTATTTTCCTGCAAATTTATGGG - Intronic
1185943411 X:4346698-4346720 TTTTTTTCCCCCACATTTATTGG - Intergenic
1186372680 X:8963640-8963662 TTTGGTTACTGCAGCCTTATAGG - Intergenic
1186908148 X:14133241-14133263 TTGTGTTCATGCACATTTTTGGG + Intergenic
1187025421 X:15430529-15430551 TTTGGTTCTGACATATTTATAGG - Intronic
1187478382 X:19632130-19632152 TTTGGCTCATGTATATTTATTGG + Intronic
1188057756 X:25561660-25561682 TTTGATTTCTGTACATTTCTGGG + Intergenic
1191833949 X:65444049-65444071 TTTGTTTTCTGCTCATTTAGTGG + Intronic
1192480653 X:71482344-71482366 TTTCTTCCCTGCACATATATGGG + Intronic
1193054221 X:77132836-77132858 TTTTTTTCTTGCAAATTTATTGG + Intergenic
1193714688 X:84924382-84924404 TTTGGTTCTTTTACATTTGTTGG + Intergenic
1194383023 X:93219019-93219041 TTTGGTTCCAGCATAATTCTTGG - Intergenic
1194780228 X:98015507-98015529 TTTGGTTACTGTAGACTTATAGG + Intergenic
1197010198 X:121551645-121551667 TTTGGTGCCTGGGCATTTAAGGG - Intergenic
1198925313 X:141785219-141785241 TTTGTATCCTGCAACTTTATTGG + Intergenic
1200967571 Y:9111162-9111184 TTTAGTACATGCACATTTCTGGG + Intergenic
1201505562 Y:14695720-14695742 TTTGATTACTGCAAATTTAGTGG + Intronic
1202143408 Y:21752528-21752550 TTTAGTACATGCACATTTCTGGG + Intergenic
1202362546 Y:24127142-24127164 TTTTGTTGCTGGACATTTATTGG + Intergenic
1202508251 Y:25544159-25544181 TTTTGTTGCTGGACATTTATTGG + Intergenic