ID: 1147153313

View in Genome Browser
Species Human (GRCh38)
Location 17:38530979-38531001
Sequence CTTTGGTTCCTGCACATTTA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 5, 1: 0, 2: 0, 3: 18, 4: 159}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147153313_1147153326 29 Left 1147153313 17:38530979-38531001 CCATAAATGTGCAGGAACCAAAG 0: 5
1: 0
2: 0
3: 18
4: 159
Right 1147153326 17:38531031-38531053 TCACCCGAGCGGGTGGGGCGGGG 0: 1
1: 0
2: 1
3: 18
4: 119
1147153313_1147153323 24 Left 1147153313 17:38530979-38531001 CCATAAATGTGCAGGAACCAAAG 0: 5
1: 0
2: 0
3: 18
4: 159
Right 1147153323 17:38531026-38531048 GGGCTTCACCCGAGCGGGTGGGG 0: 1
1: 1
2: 9
3: 10
4: 87
1147153313_1147153324 27 Left 1147153313 17:38530979-38531001 CCATAAATGTGCAGGAACCAAAG 0: 5
1: 0
2: 0
3: 18
4: 159
Right 1147153324 17:38531029-38531051 CTTCACCCGAGCGGGTGGGGCGG 0: 1
1: 0
2: 0
3: 4
4: 98
1147153313_1147153321 22 Left 1147153313 17:38530979-38531001 CCATAAATGTGCAGGAACCAAAG 0: 5
1: 0
2: 0
3: 18
4: 159
Right 1147153321 17:38531024-38531046 CTGGGCTTCACCCGAGCGGGTGG 0: 1
1: 1
2: 5
3: 5
4: 92
1147153313_1147153315 3 Left 1147153313 17:38530979-38531001 CCATAAATGTGCAGGAACCAAAG 0: 5
1: 0
2: 0
3: 18
4: 159
Right 1147153315 17:38531005-38531027 AAGAAAGATGCAAATCCCACTGG 0: 5
1: 0
2: 0
3: 25
4: 267
1147153313_1147153325 28 Left 1147153313 17:38530979-38531001 CCATAAATGTGCAGGAACCAAAG 0: 5
1: 0
2: 0
3: 18
4: 159
Right 1147153325 17:38531030-38531052 TTCACCCGAGCGGGTGGGGCGGG 0: 1
1: 1
2: 4
3: 12
4: 89
1147153313_1147153322 23 Left 1147153313 17:38530979-38531001 CCATAAATGTGCAGGAACCAAAG 0: 5
1: 0
2: 0
3: 18
4: 159
Right 1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG 0: 1
1: 1
2: 3
3: 12
4: 56
1147153313_1147153316 4 Left 1147153313 17:38530979-38531001 CCATAAATGTGCAGGAACCAAAG 0: 5
1: 0
2: 0
3: 18
4: 159
Right 1147153316 17:38531006-38531028 AGAAAGATGCAAATCCCACTGGG 0: 5
1: 0
2: 1
3: 14
4: 203
1147153313_1147153320 19 Left 1147153313 17:38530979-38531001 CCATAAATGTGCAGGAACCAAAG 0: 5
1: 0
2: 0
3: 18
4: 159
Right 1147153320 17:38531021-38531043 CCACTGGGCTTCACCCGAGCGGG 0: 1
1: 2
2: 2
3: 8
4: 104
1147153313_1147153318 18 Left 1147153313 17:38530979-38531001 CCATAAATGTGCAGGAACCAAAG 0: 5
1: 0
2: 0
3: 18
4: 159
Right 1147153318 17:38531020-38531042 CCCACTGGGCTTCACCCGAGCGG 0: 1
1: 3
2: 0
3: 9
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147153313 Original CRISPR CTTTGGTTCCTGCACATTTA TGG (reversed) Exonic
902277269 1:15348997-15349019 CTTGGTGGCCTGCACATTTAGGG - Intronic
905517008 1:38569380-38569402 CTTTGGGTGCTGGACAGTTATGG + Intergenic
906583016 1:46952138-46952160 CCATTGTTCCTGCACAGTTAAGG + Intergenic
907817014 1:57928491-57928513 TTTTTGGTGCTGCACATTTATGG + Intronic
908359698 1:63357049-63357071 ATTTGGTTCCTCCAAATATAAGG - Intergenic
911664903 1:100540519-100540541 CTTTGGTTCATGCACACTCAAGG - Exonic
912956881 1:114160487-114160509 ATTTGGTACCTGCAAATTGAAGG - Intergenic
913430400 1:118784971-118784993 CATTGATTCCTGCAGCTTTAAGG - Intergenic
915700287 1:157785606-157785628 CTTTGATGTCTGCACATTGATGG - Intergenic
917387126 1:174490150-174490172 CTTTGGTGTCTGGACATTGAAGG + Intronic
918054769 1:181010984-181011006 CTTTGCTTCTTGCATACTTAAGG - Intronic
918742270 1:188147890-188147912 CTTTTGTTCTTGCACATATTTGG - Intergenic
918892916 1:190298987-190299009 GTTTGGTGCATGCACATTTAAGG + Intronic
918905633 1:190489116-190489138 CCTTGGTTGCTGCCCATTTTGGG - Intergenic
1064520415 10:16195092-16195114 TTTTTGTTCCTTCACCTTTAAGG - Intergenic
1065451992 10:25869074-25869096 CTTTGGTTCTGGCAGATCTATGG + Intergenic
1069922210 10:71822776-71822798 CTTTTGTTCCTGCTGCTTTAGGG - Intronic
1070477652 10:76845962-76845984 CTGTGGTTCTTGCAGATTCATGG - Intergenic
1071529528 10:86378042-86378064 CTTTGGATCCTGGCCTTTTAAGG - Intergenic
1072169274 10:92844425-92844447 CTCTGGATCCTGCGCTTTTAAGG - Intronic
1078124880 11:8551555-8551577 TGTTGATGCCTGCACATTTAAGG + Intronic
1079981114 11:27152377-27152399 TTTTGGTTCCTGCAGGTTTGTGG - Intergenic
1080504033 11:32894103-32894125 CTTTGGTTCTTCAACCTTTACGG - Intronic
1081589451 11:44410977-44410999 CTTTGGAGCCCTCACATTTATGG - Intergenic
1081825238 11:46044289-46044311 TTTTTTTTCCTGCTCATTTAAGG - Intronic
1082941966 11:58715416-58715438 CTTGGGATCCTGCAGGTTTATGG - Exonic
1083585153 11:63851726-63851748 CTCTGATTTCTGTACATTTAAGG + Intronic
1088304029 11:108389274-108389296 CCTTCTTTCCAGCACATTTATGG - Intronic
1089952800 11:122546084-122546106 TTTTGGTTCCTTCTCATTTGGGG + Intergenic
1091620228 12:2082102-2082124 GTTTGGTTCATCCACATTCACGG - Intronic
1092962401 12:13608741-13608763 CTTTGGGTTCTGCACAGGTACGG + Exonic
1093304855 12:17502703-17502725 CCATGATTGCTGCACATTTATGG + Intergenic
1093677475 12:21960633-21960655 CTTTGTATCCTGCAGTTTTATGG - Intergenic
1095156102 12:38856889-38856911 CTTTAGATGCTTCACATTTAAGG + Intronic
1095302455 12:40600708-40600730 TTTTGTTTCCTGCACTTTTGAGG + Intergenic
1098215515 12:68212738-68212760 TTTTGTATCCTGCAAATTTACGG + Intronic
1099392325 12:82097228-82097250 TTCTGGTTCCTTCTCATTTAGGG + Intergenic
1103891332 12:124241299-124241321 CTTGGGGTCCAGCACATTTGAGG + Intronic
1105445743 13:20455230-20455252 CATGGTTTCCTGCATATTTAAGG - Intronic
1110714162 13:78683050-78683072 CTTTGGTTGGTGCAAATTTAAGG + Intergenic
1112953841 13:105035273-105035295 GCTGGGTTCCTGCACATTTTTGG + Intergenic
1113484684 13:110645457-110645479 CTTTGGTTCCTGCACGTCTGAGG - Intronic
1121088430 14:91164402-91164424 CTTTGGTGTCTGCACATTCAAGG + Intronic
1122900048 14:104778657-104778679 CCTTGGTGCCTGCACGTATAAGG - Intronic
1126745532 15:51822607-51822629 CTTTGTTTCCTGCAACTTTACGG - Intergenic
1127605676 15:60585408-60585430 CCTTGGTTTCTGAAGATTTATGG - Intronic
1129124498 15:73426906-73426928 CTCTGGTTCCTGAGCATTAAAGG + Intergenic
1132704129 16:1234988-1235010 CTTTGGTTCCTTCAACTTTTTGG + Intergenic
1132707390 16:1251436-1251458 CTTTGGTTCCTTCAACTTTTTGG - Intergenic
1132925402 16:2426748-2426770 CCCTGGCTCCTGCAAATTTAGGG + Intergenic
1134861469 16:17564248-17564270 CTCTAGTTCATTCACATTTATGG - Intergenic
1135055781 16:19231171-19231193 ATTTGGTTCTTTCAAATTTAGGG - Intronic
1135861781 16:26062817-26062839 CTTTGGTGCCTGCATATTCTGGG + Intronic
1136690452 16:32024844-32024866 CTTTGGTTCCTGCACATTTATGG - Intergenic
1136791040 16:32968404-32968426 CTTTGGTTCCTGCACATTTATGG - Intergenic
1136878773 16:33885528-33885550 CTTTGGTTCCTGCACATTTATGG + Intergenic
1137663633 16:50233820-50233842 CTTTGGTTATTACACATTTGTGG + Intronic
1137690459 16:50423298-50423320 CTTTGCTTTCTGCACTCTTAGGG - Intergenic
1203093248 16_KI270728v1_random:1229865-1229887 CTTTGGTTCCTGCACATTTATGG - Intergenic
1147153313 17:38530979-38531001 CTTTGGTTCCTGCACATTTATGG - Exonic
1149282441 17:55122992-55123014 CTTTGTTTTATTCACATTTATGG + Intronic
1149311782 17:55401531-55401553 TTTTTGTTCCTGCAGATATAAGG - Exonic
1150882935 17:69051852-69051874 CTTTAGTTCCTGAATATTTTTGG - Intronic
1151604237 17:75126145-75126167 CTTTGGTTCCTGCTCAGTGGAGG - Intronic
1156558583 18:38095420-38095442 CATTTGTTCCTGCAGAATTAGGG - Intergenic
1156874070 18:41984923-41984945 CTTTGGTTTCTTCACATGTTAGG + Intronic
1156920847 18:42521094-42521116 CTTTGGTTTCCCCACATATAAGG + Intergenic
1158231131 18:55256721-55256743 CATTGTTTCCTGCATATTTCTGG + Intronic
1165186479 19:34026762-34026784 TTTTGGTAACTGCACATTTAAGG + Intergenic
1167398311 19:49246382-49246404 CTTTGGTTCCTGTTAATTTGGGG + Intergenic
929450215 2:42031947-42031969 CCTTTGTTCCTGGACATTGAGGG + Intergenic
931463641 2:62468710-62468732 CTTGGTTTCTTGCACATATATGG - Intergenic
931539912 2:63318919-63318941 CTTTTTTTCTTGCACTTTTAGGG - Intronic
932507079 2:72245235-72245257 TTTTGATTGCTGCAGATTTATGG - Intronic
932750154 2:74366368-74366390 CCTTGGCTCCTGCAGATCTATGG - Exonic
933043031 2:77493689-77493711 CTTTGGGTCCTGCAACTTTTGGG - Intronic
933087398 2:78072675-78072697 CTCTGGTTACTTCACTTTTAAGG + Intergenic
936693431 2:114920066-114920088 CTTTGGCCCCTCCACATTCAGGG + Intronic
937130320 2:119506595-119506617 CTTAGCTTCCTGCACAGGTAGGG + Intronic
939685732 2:145197687-145197709 TTTTGGCTACTGAACATTTATGG - Intergenic
941357981 2:164515601-164515623 CTCTGGTTCCTTCTCATTTTGGG - Intronic
943736201 2:191357809-191357831 TGTTGGTGCATGCACATTTAGGG + Intronic
946652684 2:221910767-221910789 CCTTGGGTCCTGCACATTAATGG + Intergenic
947474371 2:230430048-230430070 CATTGGTGTCTGCACATTTGAGG + Intronic
1170928966 20:20751305-20751327 CTCTGGTTCCTCGTCATTTAAGG + Intergenic
1171999293 20:31759768-31759790 CTTTGTTTGGTACACATTTAGGG - Intronic
1173266524 20:41488117-41488139 CTTTGGTACCAGTTCATTTAGGG + Intronic
1173573849 20:44097324-44097346 CTTTGGATCCTGGAGATTTGGGG + Intergenic
1175726789 20:61323966-61323988 CTCTGGTGCCAGCACATTTGAGG + Intronic
1177154593 21:17488467-17488489 CTAAGGATCCTGCAAATTTATGG + Intergenic
1179325443 21:40338814-40338836 CTTCGGTTCTTCCACATTCATGG - Intronic
1183482711 22:38073930-38073952 CTCTCGTTCCTGGAGATTTAGGG + Intronic
1184334433 22:43844987-43845009 CTTTGGTCCCGGCACACTTCTGG - Intronic
951661107 3:25067740-25067762 TTTTGCTTCCTGCACTTTTTAGG + Intergenic
960511144 3:118550838-118550860 CTGTGGTTCTTGCACATTTCTGG + Intergenic
960762383 3:121087361-121087383 GTTTGGTGCATTCACATTTAGGG + Intronic
961585717 3:127921507-127921529 CTTTGTTTCTTGTACATATAAGG - Intronic
962388442 3:134952067-134952089 CTCTGCTTCCTGCCCATCTATGG + Intronic
963986873 3:151606501-151606523 CTTTGCTCCCTGCTCATTTTTGG + Intergenic
964424179 3:156534293-156534315 CCTTCGTTCCTGCACATCTTAGG - Intronic
966205807 3:177405220-177405242 TTTGGTTTCATGCACATTTAAGG - Intergenic
967260516 3:187637155-187637177 CTTTGCCTCCTGCAAATATATGG + Intergenic
971417023 4:26441079-26441101 CTTTGGGACCTCCACATTTCTGG - Intergenic
971636928 4:29073001-29073023 CATAGGTTCCTGCACAGGTAAGG + Intergenic
972967646 4:44531157-44531179 CAATGATGCCTGCACATTTAAGG + Intergenic
973919789 4:55673444-55673466 CCTTGGCTCTTGGACATTTATGG - Intergenic
974088365 4:57284820-57284842 CTTTGGTTCCTGCTCTTAGAAGG + Intergenic
974701375 4:65452724-65452746 CTTTAGTTCTTTCAAATTTAAGG - Intronic
976999659 4:91481707-91481729 TTTAGTTTCCTACACATTTAGGG - Intronic
978342376 4:107732252-107732274 TTTTGGTTCCTGAATATTTATGG - Intergenic
979342955 4:119549751-119549773 CTTTGCTTCCAGTACTTTTAAGG - Intronic
983348985 4:166562708-166562730 CTTTGGTGCCTGGGCATTTAAGG + Intergenic
985078119 4:186238210-186238232 CTTTGCTTTCTGCACTTTGAGGG - Intronic
985151467 4:186951451-186951473 TTTTGTTTCCTGTACTTTTAAGG + Intergenic
986913246 5:12584234-12584256 CTTTGGTTCCTGTACTTGTGGGG + Intergenic
991228357 5:64299731-64299753 CTTTGGTAACTGCTGATTTAGGG + Intronic
991431409 5:66551626-66551648 CTTTGCTTTCTGCATAGTTAGGG - Intergenic
994341342 5:98632244-98632266 CTTTTGTTCCTATACATATAAGG - Intergenic
995901406 5:117072044-117072066 CATTGGTTCCTGCATATTTGAGG + Intergenic
996583075 5:125053154-125053176 CTTTGGAGCCTCCATATTTATGG - Intergenic
997032353 5:130145563-130145585 TTTTGCTGCCTGCACATTTGAGG - Intronic
998278205 5:140779161-140779183 GTTTGGTGCATACACATTTAGGG + Intergenic
1003556748 6:7146543-7146565 GCTCGGTTCCTCCACATTTATGG - Intronic
1004529185 6:16437715-16437737 CTTTTGTTCCAGCCCATTTGAGG + Intronic
1004789937 6:19014180-19014202 ATTTGGTGCATACACATTTAAGG - Intergenic
1005430843 6:25755268-25755290 GTTTGGTTCCAGCGAATTTATGG + Intronic
1007522153 6:42459017-42459039 CTTTGGTTGTTGCAGATTCAAGG - Intergenic
1009562934 6:65272354-65272376 CTTCGGTTCCTGCTCATGAAGGG - Intronic
1010028560 6:71247509-71247531 TTTTGATACCTGCACATTTGAGG - Intergenic
1010153791 6:72768088-72768110 CATTAGTTCATGGACATTTAGGG - Intronic
1011279087 6:85658810-85658832 TTTTGGTTCCTGAACAATAAGGG + Intergenic
1011500469 6:87982648-87982670 CATTGGTATCTGCACATTTGAGG - Intergenic
1012177557 6:96107254-96107276 CTGTTGTTCCTACACATTTATGG - Intronic
1014705019 6:124735559-124735581 TTTTGGTTTCTGCAAATTGATGG + Intronic
1016306043 6:142684754-142684776 CTATGTTTCCTGGAGATTTACGG - Intergenic
1021885167 7:25130705-25130727 TTTTGGTTCCTGAACAAGTAGGG + Intergenic
1023170986 7:37390233-37390255 CTTGGGTTCCTGCTCAGTTAAGG - Intronic
1025010130 7:55390078-55390100 TTTAGGTTTCTGCACAATTAGGG - Intronic
1026413015 7:70145849-70145871 TTTTGGTTTCAGCACATCTATGG + Intronic
1027465569 7:78510949-78510971 CTCTGGTTTCTGCTCATTTGTGG + Intronic
1027628369 7:80572049-80572071 TTTTGGTTCCTACAAATTTTAGG + Intronic
1030591882 7:111491914-111491936 CTTTTGTTCCTTCACTATTATGG - Intronic
1033877640 7:145842362-145842384 CCTTGGCTCCTGGACATTTATGG - Intergenic
1033900123 7:146127349-146127371 CTTTGGTTTCTGAACTTATAAGG + Intronic
1034141139 7:148817974-148817996 CTTTGATTCCAGCACATTAATGG + Exonic
1034347112 7:150393380-150393402 CTGTGGTTCCTGCCCAGTTCTGG + Intronic
1036422653 8:8612841-8612863 CTTCGGTTCCTGGACTGTTATGG - Intergenic
1036495407 8:9265792-9265814 GTTTGGTTCCTGCAAATCCATGG - Intergenic
1037022939 8:13996530-13996552 TTTTGCTTTCTGCACATTTGAGG - Intergenic
1038847755 8:31245503-31245525 CTTGGGTTCCTGCACTTTATTGG - Intergenic
1043573869 8:81634182-81634204 CTTTGGATGCTTAACATTTATGG + Intergenic
1043650216 8:82582009-82582031 TTTTGTTTCCTGCACTTTTGAGG - Intergenic
1044120125 8:88383987-88384009 TTTTGGTCTCTGCACTTTTATGG - Intergenic
1046268067 8:111858049-111858071 CTGTGGTTCTTGCAGACTTATGG + Intergenic
1047273988 8:123391120-123391142 CTTTGGTTTCTGTAAATTTAGGG - Intronic
1047277826 8:123419058-123419080 CTTTGGCTCCTGCAGCTTTGGGG + Intronic
1047910235 8:129519426-129519448 CTGTGGTTCTTGCAGATTCATGG - Intergenic
1048054283 8:130848608-130848630 CTTGGGTCCCTGCACACTTGGGG + Intronic
1048229436 8:132622610-132622632 CTTGGGCTCATTCACATTTAGGG + Exonic
1050583759 9:7088290-7088312 GTTTTGTTCATTCACATTTAAGG + Intergenic
1050812614 9:9768685-9768707 CTTTGTTTCCTTGTCATTTAAGG - Intronic
1051590471 9:18772376-18772398 CTTTTGTGCCTGCAGATTTGAGG + Intronic
1055040188 9:71862055-71862077 TTTTGGTTACTGGACATTTGGGG + Intergenic
1055339716 9:75267959-75267981 CATTTTTTCCTGCACATTAAAGG + Intergenic
1055771895 9:79726050-79726072 CTTTGGGAGCTGCACAGTTATGG + Intronic
1056466058 9:86856347-86856369 CTTTGGTTTCTTAACATTTCAGG - Intergenic
1059774354 9:117460851-117460873 CTCTGGTACCTGCACCTATAGGG + Intergenic
1059784716 9:117568450-117568472 CTTTGGTTCCTGCAATTCAAGGG + Intergenic
1059931887 9:119269043-119269065 GTTTGTTTCCTGCACAGTGAGGG + Intronic
1059944369 9:119393825-119393847 TTTTGGTTCCTTCTCATTTTAGG + Intergenic
1061921096 9:133782998-133783020 CTTCTGTTCATGCCCATTTAGGG - Intronic
1186241713 X:7575161-7575183 CTCTGCTTCCTGAAAATTTAGGG + Intergenic
1186459240 X:9734919-9734941 GTTGGGTGCCTGCACATCTAGGG + Intronic
1188057755 X:25561659-25561681 CTTTGATTTCTGTACATTTCTGG + Intergenic
1188117937 X:26268019-26268041 CATTGTATACTGCACATTTAGGG + Intergenic
1192304286 X:69943365-69943387 CTTTGGTCACTGCAGCTTTAGGG + Intronic
1194621066 X:96172740-96172762 CTTTCCTTACTGCAGATTTAAGG - Intergenic
1196433557 X:115653794-115653816 GTTTGGTGCTTACACATTTAGGG + Intergenic
1197010199 X:121551646-121551668 CTTTGGTGCCTGGGCATTTAAGG - Intergenic
1200967570 Y:9111161-9111183 CTTTAGTACATGCACATTTCTGG + Intergenic
1201914735 Y:19170042-19170064 CTTTGTTTCCAACAAATTTAGGG + Intergenic
1202143407 Y:21752527-21752549 CTTTAGTACATGCACATTTCTGG + Intergenic