ID: 1147153314

View in Genome Browser
Species Human (GRCh38)
Location 17:38530996-38531018
Sequence TTTGCATCTTTCTTTCTCTT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1124
Summary {0: 1, 1: 4, 2: 5, 3: 111, 4: 1003}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147153314_1147153320 2 Left 1147153314 17:38530996-38531018 CCAAAGAGAAAGAAAGATGCAAA 0: 1
1: 4
2: 5
3: 111
4: 1003
Right 1147153320 17:38531021-38531043 CCACTGGGCTTCACCCGAGCGGG 0: 1
1: 2
2: 2
3: 8
4: 104
1147153314_1147153321 5 Left 1147153314 17:38530996-38531018 CCAAAGAGAAAGAAAGATGCAAA 0: 1
1: 4
2: 5
3: 111
4: 1003
Right 1147153321 17:38531024-38531046 CTGGGCTTCACCCGAGCGGGTGG 0: 1
1: 1
2: 5
3: 5
4: 92
1147153314_1147153326 12 Left 1147153314 17:38530996-38531018 CCAAAGAGAAAGAAAGATGCAAA 0: 1
1: 4
2: 5
3: 111
4: 1003
Right 1147153326 17:38531031-38531053 TCACCCGAGCGGGTGGGGCGGGG 0: 1
1: 0
2: 1
3: 18
4: 119
1147153314_1147153324 10 Left 1147153314 17:38530996-38531018 CCAAAGAGAAAGAAAGATGCAAA 0: 1
1: 4
2: 5
3: 111
4: 1003
Right 1147153324 17:38531029-38531051 CTTCACCCGAGCGGGTGGGGCGG 0: 1
1: 0
2: 0
3: 4
4: 98
1147153314_1147153329 19 Left 1147153314 17:38530996-38531018 CCAAAGAGAAAGAAAGATGCAAA 0: 1
1: 4
2: 5
3: 111
4: 1003
Right 1147153329 17:38531038-38531060 AGCGGGTGGGGCGGGGCACGTGG 0: 1
1: 0
2: 7
3: 66
4: 628
1147153314_1147153323 7 Left 1147153314 17:38530996-38531018 CCAAAGAGAAAGAAAGATGCAAA 0: 1
1: 4
2: 5
3: 111
4: 1003
Right 1147153323 17:38531026-38531048 GGGCTTCACCCGAGCGGGTGGGG 0: 1
1: 1
2: 9
3: 10
4: 87
1147153314_1147153325 11 Left 1147153314 17:38530996-38531018 CCAAAGAGAAAGAAAGATGCAAA 0: 1
1: 4
2: 5
3: 111
4: 1003
Right 1147153325 17:38531030-38531052 TTCACCCGAGCGGGTGGGGCGGG 0: 1
1: 1
2: 4
3: 12
4: 89
1147153314_1147153318 1 Left 1147153314 17:38530996-38531018 CCAAAGAGAAAGAAAGATGCAAA 0: 1
1: 4
2: 5
3: 111
4: 1003
Right 1147153318 17:38531020-38531042 CCCACTGGGCTTCACCCGAGCGG 0: 1
1: 3
2: 0
3: 9
4: 96
1147153314_1147153322 6 Left 1147153314 17:38530996-38531018 CCAAAGAGAAAGAAAGATGCAAA 0: 1
1: 4
2: 5
3: 111
4: 1003
Right 1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG 0: 1
1: 1
2: 3
3: 12
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147153314 Original CRISPR TTTGCATCTTTCTTTCTCTT TGG (reversed) Exonic
900469225 1:2844466-2844488 TATGTGTTTTTCTTTCTCTTGGG + Intergenic
901397810 1:8994261-8994283 TGTGCATCTTTCCTTATCTGTGG + Intergenic
901402206 1:9022327-9022349 TGTGCATCTTTCCTTATCTGTGG + Intronic
901461943 1:9397301-9397323 TTTCCCTCTTTCTTTCTGATGGG + Intergenic
901838707 1:11940319-11940341 TCTGCATCATTCTTGCTCTCAGG + Intronic
902104985 1:14027386-14027408 CATGCCTCTTTCTTTCTGTTTGG + Intergenic
902459165 1:16559206-16559228 TCTGCATGTTTCTTGTTCTTGGG + Intergenic
902567133 1:17319148-17319170 CTTGCTTCTTCCTTTTTCTTAGG + Intronic
902661228 1:17905430-17905452 TTTCCATCTTCCATTGTCTTAGG + Intergenic
902704554 1:18195619-18195641 TTTGCACCTGGCGTTCTCTTTGG + Intronic
903152360 1:21419888-21419910 TCTGCATGTTTCTTGTTCTTAGG + Intergenic
903849992 1:26300313-26300335 TTCGCATCTCTCTGTCTCTGAGG - Intronic
904076947 1:27850378-27850400 TTTGCATATTTCTTCTTCTTGGG - Exonic
904101639 1:28034625-28034647 TTGGCAGCTTTCTTACTTTTAGG - Intronic
904220211 1:28961080-28961102 TGTGTCTCTTTCTTTCTTTTAGG + Intronic
904368275 1:30032075-30032097 TTTTTTTCTTTCTTTCTCTTTGG + Intergenic
905117795 1:35657464-35657486 TTTGAAGCTTGCTTTCTATTAGG - Intergenic
905555254 1:38877496-38877518 TTTCTTTCTTTCTTTCTTTTGGG + Intronic
905679481 1:39857582-39857604 TTTTCTTCTTTCTTTGTTTTGGG - Intronic
906862740 1:49379236-49379258 TTTGTAATTTTCTTTCTCTTGGG + Intronic
906978934 1:50607595-50607617 TTTCCATCTGTCTATTTCTTAGG + Intronic
907873158 1:58461511-58461533 TTTTTCTCTTGCTTTCTCTTGGG - Intronic
907942843 1:59105889-59105911 TTTGGATTTTTTTTTCCCTTTGG - Intergenic
908295579 1:62709334-62709356 TTTGCATCTTTTTTTTTTTCTGG - Intergenic
908558144 1:65278677-65278699 TCTCAAGCTTTCTTTCTCTTTGG - Intronic
909324983 1:74339711-74339733 TTTGCTTCTTTGTATCTCTTAGG + Intronic
909783104 1:79574081-79574103 TTAGCATTTTTCTTTCCCTTTGG - Intergenic
910918409 1:92316561-92316583 TTTTCATCTTACTTTCACTAAGG - Intronic
911029285 1:93468752-93468774 TATATATTTTTCTTTCTCTTGGG + Intronic
911336195 1:96583526-96583548 TATGTTTCTTTCTCTCTCTTTGG - Intergenic
911451397 1:98066483-98066505 ATTGCATTTATTTTTCTCTTGGG + Intergenic
911511939 1:98817600-98817622 CTTTCTTCTTTCTTTCTTTTTGG + Intergenic
912155005 1:106907125-106907147 TCTGCATCTTTTTTTTTCCTAGG + Intergenic
912155412 1:106912828-106912850 TTTTGTTTTTTCTTTCTCTTGGG - Intergenic
912969619 1:114268619-114268641 TATACATTTTTGTTTCTCTTGGG + Intergenic
913249882 1:116904394-116904416 TTTGCAACTTTGTCTATCTTGGG - Intergenic
913450082 1:118987334-118987356 TTTGCATTTCTTTTTCTTTTGGG - Intronic
913596771 1:120386172-120386194 TTTGTAACTTTTTTTTTCTTTGG - Intergenic
913939613 1:125088102-125088124 CTTACATCTTTTTTTGTCTTTGG - Intergenic
914043505 1:144071541-144071563 TTTTAATCTTTCTTTTTTTTAGG - Intergenic
914043840 1:144076315-144076337 CTTACATCTTTTTTTCTCTTTGG + Intergenic
914090499 1:144492809-144492831 TTTGTAACTTTTTTTTTCTTAGG + Intergenic
914134248 1:144884176-144884198 CTTACATCTTTTTTTCTCTTTGG - Intergenic
914308108 1:146441413-146441435 TTTGTAACTTTTTTTTTCTTAGG - Intergenic
914310593 1:146462576-146462598 TCTGCATCTTTCTTTGGCTGAGG - Intergenic
914591514 1:149110565-149110587 TCTGCATCTTTCTTTGGCTGAGG + Intergenic
914594000 1:149131720-149131742 TTTGTAACTTTTTTTTTCTTAGG + Intergenic
914942492 1:152035561-152035583 TGTGTCTCTTTCTTTCACTTTGG - Intronic
914951295 1:152116963-152116985 TATGCAGCTCTCTTACTCTTTGG + Intergenic
915640714 1:157223431-157223453 TTTACTTCTTTCTTTCAATTTGG + Intergenic
916278243 1:163019262-163019284 TTTTTATCTTTCTAGCTCTTAGG - Intergenic
916289063 1:163143885-163143907 TTTGCATGTCTATTACTCTTTGG + Intronic
916294924 1:163207898-163207920 TTTTAATCTTTCTTTTTTTTTGG - Intronic
916865679 1:168855095-168855117 TTTCTTTCTTTCTTTTTCTTTGG + Intergenic
916942915 1:169694977-169694999 TTTTCATTTCTCTTTCCCTTAGG + Intronic
917019235 1:170568461-170568483 GTCTCATCTTTCTTACTCTTTGG + Intergenic
917172155 1:172188822-172188844 TTTGCATGTTTATCTCTATTTGG + Intronic
917223968 1:172762191-172762213 CTTGCATTTTTTTTTCCCTTTGG + Intergenic
917381843 1:174419843-174419865 TTTGAATGTTTTTTTCTCTTGGG + Intronic
917452348 1:175157692-175157714 ATTCCATGTTTCTTTTTCTTGGG - Intronic
917554828 1:176073531-176073553 TTTGCATTTTTTATTCTATTAGG - Intronic
917755327 1:178093441-178093463 TTTGTTTCTTTCTTTCTTTATGG - Intergenic
918102569 1:181389186-181389208 ATTGCAGCTTTCTTGCACTTAGG + Intergenic
918170977 1:181997179-181997201 GTTGCAGCATTCTTTCTCATAGG + Intergenic
918309065 1:183272641-183272663 TTTTGCTCTTTCTTTCACTTTGG - Intronic
918510565 1:185309297-185309319 TTTGCTTATTTCTTTTTCATAGG - Intronic
918656006 1:187027407-187027429 ATTGCATCTCTCATTCTCTGAGG + Intergenic
919106991 1:193166164-193166186 TTTTTTTCTTTCTTTCTTTTTGG + Intronic
919206714 1:194427623-194427645 TTTCTCTCTTTCTTTCTCTTTGG - Intergenic
919456266 1:197823451-197823473 TATGTATACTTCTTTCTCTTGGG - Intergenic
919985316 1:202670082-202670104 TCTGAATCTTTCTCCCTCTTGGG - Intronic
920073268 1:203318636-203318658 TTTCTTTCTTTCTTTCTTTTTGG + Intergenic
920420406 1:205829339-205829361 TTTCCAATTGTCTTTCTCTTAGG + Intronic
921469150 1:215527928-215527950 TTTGTATTTTTTTTTCTCTGAGG + Intergenic
921510215 1:216018830-216018852 TTTACATATTTTTTTCTTTTTGG + Intronic
921807777 1:219475530-219475552 TTTCTTTCTTTCTTTCTTTTTGG - Intergenic
921877482 1:220214685-220214707 TATGCTTCTTTCTTTTTATTTGG + Intronic
921974707 1:221189832-221189854 TTTGCCTATTTCTTTCTATTTGG - Intergenic
922408580 1:225345030-225345052 GTTGCCTCTTGTTTTCTCTTTGG + Intronic
923057397 1:230437262-230437284 TTTCTTTCTTTCTTTCTTTTTGG - Intergenic
923102871 1:230830862-230830884 TTTGTTTCTTTCCTTCACTTTGG + Intergenic
923308594 1:232711697-232711719 TTCCCATTTTTCTTTCTCTTGGG + Intergenic
923560039 1:235032195-235032217 TTTCAATTTTTCTTTCTCTATGG - Intergenic
923972669 1:239222494-239222516 TTTTAATCTTTCTACCTCTTTGG + Intergenic
924072227 1:240292841-240292863 ATTTAATCTTTCTTTCTTTTTGG + Intronic
924207087 1:241724551-241724573 ATTACATCTTTCTTTCTTTATGG - Intronic
924389847 1:243542303-243542325 TTTGCTTCTTGCTTTCTTTGTGG - Intronic
924548046 1:245048823-245048845 TTTCTTTCTTTCTTTCTTTTTGG + Intronic
924640413 1:245828047-245828069 TTTTCATCTTTTTTTCCCTATGG - Intronic
924918341 1:248598165-248598187 TTTGAATTTTTCTTGCTTTTAGG + Intergenic
1063152455 10:3349553-3349575 CTTGTAACTTTATTTCTCTTAGG + Intergenic
1063246048 10:4219911-4219933 TTTGCATCTTTCCCTATGTTAGG + Intergenic
1063764493 10:9122549-9122571 TTAGCTTGGTTCTTTCTCTTAGG - Intergenic
1064077766 10:12283586-12283608 TTTCTTTCTTTCTTTCTTTTTGG + Intergenic
1064463778 10:15559551-15559573 TTTGCAGCTTTCTTTTCCTTGGG - Intronic
1064604027 10:17019561-17019583 TCTGCTTCTTTCTTTATCTAAGG + Intronic
1064625173 10:17254051-17254073 ATTGCAGAGTTCTTTCTCTTAGG + Intergenic
1064712784 10:18143336-18143358 TTTTCATCTCTTTTTCGCTTAGG - Intronic
1065142530 10:22732986-22733008 TTTGTATTTGTCTTTCTCTCCGG + Intergenic
1066059693 10:31711568-31711590 TTTGCATCCTCAGTTCTCTTTGG - Intergenic
1066081993 10:31940124-31940146 TTTTCATTTCACTTTCTCTTAGG - Intergenic
1066450820 10:35528310-35528332 GTTGAACCTTTCTTTCGCTTGGG + Intronic
1066956262 10:42176959-42176981 CTTACATCTTTTTTTGTCTTTGG + Intergenic
1067310895 10:45112599-45112621 TTTGCTCCTTACTCTCTCTTAGG - Intergenic
1067537106 10:47120601-47120623 TTTTCAGGTTTTTTTCTCTTTGG + Intergenic
1068196288 10:53721113-53721135 TTTGCATATTTAATTCTTTTTGG + Intergenic
1068792701 10:61044642-61044664 TTTTCCTCATTATTTCTCTTGGG + Intergenic
1068813573 10:61284164-61284186 TTTCTTTCTTTCTTTCTTTTTGG + Intergenic
1068977641 10:63027980-63028002 TTTGTATCTCTTTTTCTGTTTGG - Intergenic
1068987379 10:63119906-63119928 TTTGCATTTTTGTATCCCTTCGG - Intergenic
1069091326 10:64202596-64202618 TTTGAAACTGTCTTTTTCTTTGG + Intergenic
1069138826 10:64799014-64799036 TTTATATCTTTCTTTCTTCTTGG + Intergenic
1069735890 10:70653981-70654003 TTTTCCTCCTTCCTTCTCTTAGG - Intergenic
1069796021 10:71052501-71052523 TCTGCATCCTTCTCTCACTTGGG - Intergenic
1069886848 10:71629220-71629242 TTTGCATCTGTTTGTTTCTTTGG - Intronic
1071228611 10:83560719-83560741 TCTGGATCTTCCTTCCTCTTGGG + Intergenic
1071716684 10:88104070-88104092 GTTGCACCTTTCTTACTCTTAGG - Intergenic
1071927351 10:90425657-90425679 TTTCTTTCTTTCTTTCTTTTAGG + Intergenic
1071939417 10:90572763-90572785 TTTGCATATTTCCTTCTCTCTGG + Intergenic
1072071103 10:91918417-91918439 TTAGCATCTTTGTTTATCTCTGG + Intergenic
1072565939 10:96616657-96616679 TTTGCTTCTCTCTCTGTCTTCGG + Exonic
1072852861 10:98914936-98914958 TTTGTATATTGCTTTATCTTCGG - Intronic
1072853549 10:98923312-98923334 TTAGAATCTTTCTTTATCCTTGG + Intronic
1072904169 10:99435766-99435788 TTTCCTTCTTTCTGTTTCTTTGG - Intergenic
1072995577 10:100240816-100240838 TTTGCATCTTTTTTCGTCTTTGG - Intronic
1073913199 10:108371185-108371207 TTTCTTTCTTTCTCTCTCTTTGG + Intergenic
1074593144 10:114833568-114833590 TTGGAATCTTTCTATCTCTATGG - Intronic
1074952435 10:118351325-118351347 TTTGTAGCTTTCTATGTCTTTGG + Intergenic
1074964323 10:118475424-118475446 CCAGCATCCTTCTTTCTCTTTGG + Intergenic
1075211810 10:120497717-120497739 TTTGTATCTTAATTTCTCCTGGG - Intronic
1075233421 10:120704290-120704312 TGTGCCTCTCTCTTTCTCTCTGG + Intergenic
1075473049 10:122707891-122707913 GTCGCAACTTTGTTTCTCTTGGG + Intergenic
1075538367 10:123290783-123290805 TTTACTTATTTCTTTCTATTTGG - Intergenic
1075643342 10:124081058-124081080 TTTAGATCTGTTTTTCTCTTGGG - Intronic
1076519144 10:131069036-131069058 GTTTTATCCTTCTTTCTCTTGGG - Intergenic
1076710945 10:132333812-132333834 TTTGTAGGCTTCTTTCTCTTTGG + Intronic
1077586810 11:3460070-3460092 TTTCTTTCTTTCTTTCTTTTTGG + Intergenic
1077939190 11:6822292-6822314 TTTGAATCTTTTTTTCTTTTTGG - Intergenic
1078248944 11:9601480-9601502 TCTCTATCTTTCTTACTCTTTGG + Intergenic
1078257855 11:9675286-9675308 TTTCTTTCTTTCTTTTTCTTTGG - Intronic
1078578421 11:12520066-12520088 TTGGGATATTTCTTTCCCTTGGG + Intronic
1078838958 11:15059841-15059863 TTGGCATCTCTATTTCTCTGGGG + Intronic
1078865619 11:15294803-15294825 TTCTCATCTTTGTTTCTCTGTGG + Intergenic
1078877340 11:15411709-15411731 TGTGTATCTTCCATTCTCTTTGG + Intergenic
1079000936 11:16755039-16755061 TTTGCATCTTTTTTGTTTTTGGG - Exonic
1079157068 11:17958081-17958103 TTTTTCTCTCTCTTTCTCTTGGG - Intronic
1079331773 11:19539608-19539630 TTTTCAACATTCTTTTTCTTAGG + Intronic
1079526998 11:21402779-21402801 CTAAGATCTTTCTTTCTCTTAGG - Intronic
1080035372 11:27704264-27704286 TCTGAATCTTTATTTCTTTTTGG + Intronic
1080140413 11:28911843-28911865 TTTGAATCTTTCTTCTGCTTTGG + Intergenic
1080382522 11:31788379-31788401 TTTGAATCTTGCTTTCTGTGCGG - Exonic
1080829598 11:35879224-35879246 TATGTATTTTCCTTTCTCTTGGG + Intergenic
1081829195 11:46092360-46092382 ATTGCTTCTTTTTTTCTTTTGGG - Intronic
1081893432 11:46564471-46564493 TTTGAATCTCTCCTTCACTTAGG - Intronic
1082091139 11:48090766-48090788 TTTCCATCTTTGGTTCTCTCAGG + Intronic
1082634086 11:55576022-55576044 TTTACATCTTTCTTTCTTCGTGG + Intergenic
1082771579 11:57211628-57211650 CTTGCCTCCTTCTTTCTCCTGGG + Intergenic
1083073391 11:60010936-60010958 TTTTCTTCTTTCTTTTTTTTTGG + Intergenic
1083403289 11:62439621-62439643 TGTGCATCTGTCTTTCTTTTTGG + Intronic
1083870048 11:65481558-65481580 TGTTCCTCTTCCTTTCTCTTTGG - Intergenic
1084436527 11:69144789-69144811 TTTGGTTGTTTCTTTTTCTTAGG - Intergenic
1084485948 11:69448398-69448420 TTTTCATGATTCTATCTCTTGGG - Intergenic
1085500525 11:77018396-77018418 TTTTAATTTTGCTTTCTCTTAGG - Intronic
1085665087 11:78407719-78407741 TTTCTTTCTTTCTTTCTTTTTGG - Intronic
1085669106 11:78444949-78444971 TTTGCATCTCTGATTTTCTTAGG - Intronic
1086235988 11:84631219-84631241 TTTCCATTTTTATTTCTCTCAGG + Intronic
1086296704 11:85375959-85375981 TTGGCATTTTTCTTTCTCATTGG - Intronic
1086384780 11:86296027-86296049 TTTTCATTTCTCTTTATCTTAGG + Intergenic
1086722738 11:90141447-90141469 TTTGCATCTTTCATTTTCTTTGG + Intronic
1086825996 11:91497696-91497718 TTTGCATTTTTCTTGATCTTGGG - Intergenic
1087243205 11:95803685-95803707 TTTCCATCTTTTTTTTTTTTCGG + Intronic
1087372108 11:97297888-97297910 TTTTCTTCTTTCTTGCTCTTGGG - Intergenic
1087489620 11:98808049-98808071 TTTTCAGCTTTCTTTTGCTTAGG + Intergenic
1087491421 11:98832206-98832228 TGTGAATTTTTCTTTCTCTGGGG - Intergenic
1087567915 11:99886442-99886464 TTTGAATCTTTCTATTTATTAGG - Intronic
1087946730 11:104170482-104170504 TCTACATCTTTCTTTCTGTAGGG - Intergenic
1087979282 11:104591050-104591072 GTTGCAGCTTCCTTTCTCTTGGG - Intergenic
1088615835 11:111627050-111627072 TTTACATCTTAGTTTCTCCTAGG - Intronic
1088645237 11:111912362-111912384 CTTGCATCTTTCGTTCTATGTGG + Exonic
1088664936 11:112085265-112085287 TTTGCTTCTGTCATTCTCCTGGG + Exonic
1088683293 11:112263787-112263809 TTTTCATATTTCTGTCTCTGTGG - Intronic
1089071202 11:115701059-115701081 TTGGCAGCTTCCTTTCTCTGTGG + Intergenic
1089107923 11:116030222-116030244 TTTGCATTTTTATTACTATTTGG + Intergenic
1089192743 11:116665923-116665945 TTTACATCTTTCTTTAGGTTTGG - Intergenic
1089389665 11:118092084-118092106 TTTCCTTTTTTCTTTCTTTTTGG - Intronic
1089556418 11:119317915-119317937 TCTCCCTGTTTCTTTCTCTTAGG - Intronic
1090637432 11:128699186-128699208 TTTTCATGTCTCTTTCTGTTTGG + Intronic
1091176359 11:133561804-133561826 TTAGTACCTTTCTTTCTCTAAGG + Intergenic
1091491876 12:939750-939772 TTTGCATCTCTCTTCCTATCTGG - Intronic
1091536843 12:1418707-1418729 TTTCTTTCTTTCTTTCTTTTTGG + Intronic
1091965150 12:4734548-4734570 TTCGCTTCTTTCTTTCTCCAGGG + Intronic
1092068368 12:5612061-5612083 GCTCCATCTTTCTTTCTTTTAGG + Intronic
1092392561 12:8093934-8093956 TTTCATTCTTTCTTTCTGTTTGG + Intronic
1092441919 12:8512006-8512028 CTTCCCTCTTCCTTTCTCTTAGG - Intronic
1092653112 12:10655611-10655633 CTTGAATCTTCCTTTCTCTGAGG + Intronic
1092740452 12:11623714-11623736 TTTGAAACTTTCTTTTTCTCAGG - Intergenic
1093390879 12:18619602-18619624 TTTGATTTTTTCTTTGTCTTTGG + Intronic
1093512142 12:19942047-19942069 TTTGCATTTATGATTCTCTTGGG - Intergenic
1093669100 12:21851038-21851060 TTTGTATCTTCCTCTCTCTATGG + Intronic
1093681037 12:22003744-22003766 TTTTCATCTTTCTGTGTGTTGGG + Intergenic
1093825467 12:23680459-23680481 TTTCCATCTTTCTGTCTCTGTGG - Intronic
1093840077 12:23887330-23887352 TTTTCCTCTTTCTTTCAATTTGG - Intronic
1093867543 12:24246922-24246944 CTTGCATTTTTTGTTCTCTTAGG - Intergenic
1093932122 12:24964670-24964692 TCTTCATGTTTCTTTCACTTGGG + Intergenic
1094487451 12:30936350-30936372 TTTTCTTCATTCTTTTTCTTTGG + Intronic
1094690120 12:32760676-32760698 TTTCTTTCTTTCTTTCTTTTAGG + Intergenic
1095297821 12:40547259-40547281 TTTGCATCTTTATTTGATTTGGG + Intronic
1095431099 12:42135684-42135706 TTTGAATCTGGCTTTCTTTTTGG - Intronic
1095587086 12:43861258-43861280 AAAGCATCTTTCTTTCTCTAGGG + Intronic
1095632066 12:44389231-44389253 TTTGCATCTGTATTTATATTTGG - Exonic
1095771462 12:45964155-45964177 TTTTCTTCTTCATTTCTCTTTGG + Exonic
1095925377 12:47573905-47573927 TTAGCATCTTTCTCTCTTTTGGG - Intergenic
1096570361 12:52519671-52519693 CTTCCTTCTTTCTCTCTCTTTGG + Intronic
1096712567 12:53468145-53468167 TTTTTTTCTTTCTTTTTCTTTGG + Intronic
1097001136 12:55877943-55877965 TTGGCTTCTCTCTTTGTCTTTGG - Intergenic
1097325176 12:58268330-58268352 TTTCCCTCTTTCTTCCTTTTTGG + Intergenic
1097509176 12:60514903-60514925 TTTGCTTCTTTCTCTCCCTTAGG - Intergenic
1098021037 12:66156876-66156898 TTTGCATCATTCTTTTTGTTAGG - Intronic
1098207183 12:68123884-68123906 TTTGTTTCTTTCTTTCTCACTGG + Intergenic
1098294391 12:68989713-68989735 TTTGGATATTTTTTTCTCCTTGG + Intergenic
1098953648 12:76666973-76666995 TTTGCATTTTTCATCCTCTGAGG + Intergenic
1099471946 12:83061138-83061160 CTTTCATCTTTCTGTCACTTAGG + Intronic
1099612092 12:84886939-84886961 TTTGTGTCTTTCTTTCCTTTTGG + Intronic
1099713472 12:86260516-86260538 TTTGGAGGTTTCTTTCTATTAGG - Intronic
1100533310 12:95480637-95480659 TTTGCTTTTTCCTTTATCTTTGG + Intronic
1100891310 12:99129172-99129194 TTTGAATGCTTCTTTATCTTGGG - Intronic
1100924260 12:99525990-99526012 TTTGCTCATTTTTTTCTCTTAGG - Intronic
1100941893 12:99732308-99732330 TTTGTGTTTTTATTTCTCTTGGG - Intronic
1101629168 12:106476785-106476807 TTTTCAACTTTCTTTGCCTTTGG + Intronic
1101848905 12:108386847-108386869 TTATCATCCTTCTTACTCTTCGG + Intergenic
1101910307 12:108856489-108856511 TGTGCATCTATCTTTCTGTGTGG - Intronic
1102148549 12:110672572-110672594 TTTGCATTTTTTTTTCTAATAGG + Intronic
1102242286 12:111332082-111332104 TTTTCATTTTTCTTTTTTTTTGG - Intronic
1102629599 12:114266302-114266324 TTTGGATTTTTCTTTCTTTGTGG - Intergenic
1102802513 12:115748929-115748951 ATTGCTTCTTTATTTCTGTTTGG + Intergenic
1103020651 12:117531285-117531307 TCTGAATCTTTCTTTCTCCTGGG + Intronic
1103166586 12:118775006-118775028 CTAGCATCATTCTTTCTCTCTGG - Intergenic
1103180919 12:118910657-118910679 TTTTCAGCTTTCATTCTATTTGG - Intergenic
1103586833 12:121962473-121962495 TTTGATTTTTTCTTACTCTTGGG + Intronic
1104351567 12:128048535-128048557 TTTCCATCATTCTTTCTAATTGG + Intergenic
1104396692 12:128440016-128440038 TTTGCTTTTCTCTTTCTGTTTGG + Intronic
1104737314 12:131143831-131143853 TTGGCAACTTTGTTTCTGTTTGG + Intergenic
1104866544 12:131959321-131959343 TTTGCACCCTTGCTTCTCTTAGG + Intronic
1105341450 13:19529834-19529856 TTTGAAACTTTGTTTCTCTGTGG + Intronic
1105710509 13:23003898-23003920 ATTTCATATTTATTTCTCTTAGG + Intergenic
1105791850 13:23808521-23808543 TTTGCCTCTCTCTGTCTCTAGGG + Intronic
1106095439 13:26639380-26639402 TTTACATATATATTTCTCTTTGG - Intronic
1106642478 13:31598935-31598957 TTTTAATCTTTCTTTTTCTTGGG - Intergenic
1106802736 13:33272798-33272820 TTTGCCTCCTTCTCTGTCTTTGG - Intronic
1106877769 13:34093557-34093579 TTTACCTCCTTCTTTCTCTAGGG - Intergenic
1106934350 13:34701960-34701982 TTTGCATGTTTCTGTGTCATTGG - Intergenic
1107051310 13:36053420-36053442 TTTGCATTTTCCTTTCTCCATGG - Intronic
1107228354 13:38077847-38077869 TTGGCATCTTTCTTTAGGTTTGG - Intergenic
1107387241 13:39925573-39925595 TTTGTAGATTTCCTTCTCTTTGG + Intergenic
1107576529 13:41729986-41730008 TTTACATCTCTCCTACTCTTGGG - Intronic
1107614830 13:42155232-42155254 TTTGCAACAATCTTTCTCTTTGG + Intronic
1108157398 13:47600156-47600178 TTTCCCTCTTTCTTTTTCTCTGG - Intergenic
1108980849 13:56511359-56511381 TTTCCATTTTTCTTTCTCAGTGG + Intergenic
1109154702 13:58892564-58892586 TTTCCCTCTTTCTTTCATTTAGG - Intergenic
1109170164 13:59085294-59085316 TTTGAATCATTTATTCTCTTTGG - Intergenic
1109547535 13:63847622-63847644 GGTGCATTCTTCTTTCTCTTAGG + Intergenic
1109593596 13:64520772-64520794 TTTACCTTTTTCTTTCTGTTGGG + Intergenic
1109744092 13:66597925-66597947 TATGCATCTTTGTTTTTTTTTGG - Intronic
1110393865 13:75007565-75007587 TGTTTATTTTTCTTTCTCTTTGG + Intergenic
1110452676 13:75654619-75654641 TCTGCATCTCTCTTTCCCTGTGG + Intronic
1110509592 13:76333816-76333838 TTTGGGTTTTTCTTTCTTTTTGG - Intergenic
1110531121 13:76600143-76600165 CATGCATCTTTCATTCTCCTGGG - Intergenic
1110768711 13:79310028-79310050 TTTCCATCTTTTTTTTTTTTTGG - Intergenic
1111063770 13:83062668-83062690 CTTGGATCACTCTTTCTCTTTGG - Intergenic
1111093686 13:83480737-83480759 TTTGCAACTTTTTTTCTCATTGG - Intergenic
1111269835 13:85867150-85867172 TTTTCATTTTTCTCTCTCTGGGG + Intergenic
1111283651 13:86061277-86061299 TGTGCATCTTTTTTTATGTTAGG + Intergenic
1111347640 13:86981813-86981835 TTTTCATCTTTCTTTTTTTCAGG + Intergenic
1111472938 13:88708689-88708711 TATGCATATTCATTTCTCTTAGG + Intergenic
1111750710 13:92328333-92328355 TTTGCATTTTTCTCCCTTTTGGG - Intronic
1111870377 13:93824749-93824771 GTGGGATCTTTCTTTCTCTGAGG + Intronic
1112713864 13:102161068-102161090 ATTGTTTCTTTCTCTCTCTTAGG - Intronic
1113047558 13:106171959-106171981 TTTGCATATTTATTTCTGATAGG - Intergenic
1113820821 13:113211234-113211256 TTTGTATCTGGCTTTCACTTAGG + Intronic
1115149415 14:30267234-30267256 TTTGTGCCTTTATTTCTCTTGGG - Intergenic
1116370129 14:44120253-44120275 TTTGCATCTTTTTTGTTTTTGGG + Intergenic
1116500257 14:45612395-45612417 TATGCATGTGTTTTTCTCTTAGG + Intergenic
1116808105 14:49512856-49512878 TTTGTTTGTTTCTTTGTCTTTGG - Intergenic
1117269272 14:54125083-54125105 TTTGCATGTTTATTTTTCATTGG - Intergenic
1117654863 14:57944599-57944621 TTTTCTTCTTTCTTTCTCACAGG - Intronic
1117689581 14:58292759-58292781 TTAACATCTTTCGTTTTCTTAGG - Intronic
1118062615 14:62156990-62157012 GTTTCATGTTTCTCTCTCTTCGG - Intergenic
1118295618 14:64566269-64566291 TTTGTATTTTTCTTTTTTTTTGG - Intronic
1118557086 14:67036409-67036431 TTTACTTCTTTCTTTCCATTTGG - Intronic
1118674227 14:68165497-68165519 TATGCATTTTTTTTCCTCTTGGG + Intronic
1119072815 14:71605366-71605388 TTTGTATATTTCTTTTTGTTTGG + Intronic
1120423496 14:84317042-84317064 TTTGCAAATTTCTTTCTGATTGG - Intergenic
1120532700 14:85653068-85653090 TTTGCTGCCTTCTTTCTTTTAGG - Exonic
1120564733 14:86041519-86041541 TTTGCATTTGTGTTTCTTTTAGG - Intergenic
1121386225 14:93528919-93528941 TTTACATCTGTTTTTCTCTGTGG - Intronic
1122620031 14:103050957-103050979 TTTGGATTTTTGTTTTTCTTAGG - Intronic
1202936732 14_KI270725v1_random:94424-94446 CTTACATCTTTTTTTGTCTTTGG - Intergenic
1123704050 15:22938161-22938183 TTTCCATCTGTGTTTCTCATGGG - Intronic
1123705614 15:22948884-22948906 TTTCAATCTTTTTTTCTCTCTGG - Intronic
1124222047 15:27858373-27858395 TTTTTTTCTTTCTTTCTTTTTGG - Intronic
1124664304 15:31579053-31579075 TGTGCATATTTGATTCTCTTTGG - Intronic
1125264968 15:37868223-37868245 TTTGCATCTTCCATCTTCTTTGG + Intergenic
1125308624 15:38352339-38352361 TTTTCATCCTTATTTCTCTTTGG + Exonic
1125313588 15:38407386-38407408 TAGGCATATTTCTTTGTCTTTGG - Intergenic
1125326004 15:38536361-38536383 TTTGTTTATTTCTTTTTCTTTGG - Intronic
1125412340 15:39418424-39418446 TTTTATTCTTTCTTTCTTTTTGG + Intergenic
1125748747 15:42014658-42014680 TTTGCATCTCCCTTGCCCTTTGG + Intronic
1125854770 15:42938370-42938392 TTTGCCTTTTTCCTCCTCTTTGG + Intergenic
1126566532 15:50107008-50107030 TATGCATACTTCTTTTTCTTAGG - Exonic
1126749956 15:51866508-51866530 TTTTTTTCTTTCTTTCTTTTTGG - Intronic
1127119799 15:55761544-55761566 TGTGCATTTTTCTTTCTCTCTGG - Intergenic
1127359437 15:58232014-58232036 TTTCCATCATTCTTGCTTTTTGG - Intronic
1127876058 15:63112523-63112545 TTTCTTTCTTTCTTTCTTTTTGG + Intergenic
1128264366 15:66253909-66253931 TTTTCCTCTTTCTCTCTGTTTGG + Intergenic
1128753200 15:70163558-70163580 TGTGCATTTTTCTCTCTCCTGGG - Intergenic
1129490208 15:75917619-75917641 TTTTCATCTCTGGTTCTCTTGGG - Intronic
1129540479 15:76343442-76343464 TTTTTTTCTTTCTTTCTTTTGGG - Intergenic
1129616561 15:77103649-77103671 TTTGTCTTTTTCTTTCTTTTTGG - Exonic
1129637537 15:77336989-77337011 TTTGGATATTTCTATATCTTTGG - Intronic
1130522193 15:84671796-84671818 TTTTCTTTTTGCTTTCTCTTGGG + Intronic
1130801578 15:87269283-87269305 TATGCACTTTTCTGTCTCTTGGG - Intergenic
1130977262 15:88786827-88786849 TGTGTATTTTTATTTCTCTTTGG - Intergenic
1130977500 15:88788732-88788754 TGTGTATTTTTATTTCTCTTGGG - Intergenic
1131082954 15:89552394-89552416 TTTTTTCCTTTCTTTCTCTTGGG - Intergenic
1131656590 15:94466833-94466855 TTAGTATTTTACTTTCTCTTCGG + Intronic
1132196895 15:99920309-99920331 TTTGAATCTTTCTTTTCCTTTGG - Intergenic
1132358859 15:101195392-101195414 TTTTCATGTCTCTTTTTCTTTGG - Intronic
1132811439 16:1800078-1800100 TTTCTTTCTTTCTTTCTTTTTGG + Intronic
1133612324 16:7445019-7445041 TTTTCTTCTTTTTTTCTTTTGGG + Intronic
1133713516 16:8425423-8425445 CTTGCATCTTTGTGGCTCTTCGG + Intergenic
1134641848 16:15835559-15835581 TTGGCATCCTTGTGTCTCTTTGG - Intronic
1134758733 16:16694350-16694372 TTGAAATCTTGCTTTCTCTTGGG + Intergenic
1134863553 16:17583828-17583850 TTGGCATCCTTCTTTCACTAAGG - Intergenic
1134987342 16:18664821-18664843 TTGAAATCTTGCTTTCTCTTGGG - Intergenic
1135358434 16:21790394-21790416 TTTGCTTCTTTGTCTCCCTTAGG + Intergenic
1135456936 16:22606519-22606541 TTTGCTTCTTTGTCTCCCTTAGG + Intergenic
1135781232 16:25302947-25302969 TTTCCATCTTTCTCTCTTTATGG + Intergenic
1135933368 16:26758271-26758293 TATGCATTTTTCTCTCTCTCTGG - Intergenic
1136072560 16:27796764-27796786 TTTGTCTCTTTCTTGCCCTTGGG + Intronic
1136648918 16:31648707-31648729 TTTGCATGTTTTCTTCTTTTGGG + Intergenic
1136677796 16:31928811-31928833 TTTGTATTTTTCTTTCTCTCTGG - Intergenic
1136690455 16:32024861-32024883 TTTGCATCTTTCTTTCCCTTTGG - Intergenic
1136698943 16:32115490-32115512 CTTACATCTTTTTTTGTCTTTGG + Intergenic
1136737879 16:32478838-32478860 CTTACATCTTTTTTTGTCTTTGG - Intergenic
1136768663 16:32812337-32812359 CTTACATCTTTTTTTGTCTTTGG - Intergenic
1136791043 16:32968421-32968443 TTTGCATCTTTCTTTCCCTTTGG - Intergenic
1136799450 16:33058790-33058812 CTTACATCTTTTTTTGTCTTTGG + Intergenic
1136878770 16:33885511-33885533 TTTGCATCTTTCTTTCCCTTTGG + Intergenic
1136909266 16:34133236-34133258 TTTGCTTTTTTCTGTCTCCTTGG - Intergenic
1136957122 16:34801740-34801762 CTTACATCTTTTTTTGTCTTTGG + Intergenic
1137227380 16:46526736-46526758 TTTCCATTTTTCTCTCTCTGAGG - Intergenic
1137474841 16:48798765-48798787 GTAGCATCTTTTCTTCTCTTGGG + Intergenic
1137780244 16:51092053-51092075 TTTTGATTTTTGTTTCTCTTTGG - Intergenic
1138766340 16:59609751-59609773 TTTTCTTCTCTCTCTCTCTTTGG + Intergenic
1138862198 16:60772055-60772077 GCTGCATCTTTCTTTCACTGTGG - Intergenic
1140123376 16:72101732-72101754 TCTGCATCTTCCATTCTCTCTGG + Intronic
1140216683 16:73014297-73014319 TTTGCATTTTTTTTTTTTTTTGG + Intronic
1140445679 16:75025762-75025784 TTTCCATTTTTCTTTCTGATGGG + Intronic
1140596743 16:76424808-76424830 TTTTGTTCTCTCTTTCTCTTTGG - Intronic
1140634173 16:76891496-76891518 TTTGCATCAATATTTCTCTCTGG + Intergenic
1140837259 16:78806647-78806669 TCTGCTTGGTTCTTTCTCTTGGG - Intronic
1140867806 16:79079317-79079339 TTTGCCTCTCTTTTTTTCTTGGG + Intronic
1140924256 16:79567315-79567337 TTTGCATTTTTTTTTTTCTGAGG - Intergenic
1141239537 16:82252666-82252688 TTTGTTTCTTTTTTTTTCTTTGG - Intergenic
1141748672 16:85943670-85943692 TTTCCATTTTTCCTTCCCTTAGG + Intergenic
1203015193 16_KI270728v1_random:350739-350761 CTTACATCTTTTTTTGTCTTTGG + Intergenic
1203033528 16_KI270728v1_random:623897-623919 CTTACATCTTTTTTTGTCTTTGG + Intergenic
1203071081 16_KI270728v1_random:1074445-1074467 CTTACATCTTTTTTTGTCTTTGG - Intergenic
1203093251 16_KI270728v1_random:1229882-1229904 TTTGCATCTTTCTTTCCCTTTGG - Intergenic
1142639772 17:1279249-1279271 TGTACTTCTTTCTTTCTGTTGGG - Intergenic
1143048942 17:4106308-4106330 TTTGTTTCTTTCTTTCTTTTAGG + Intronic
1143197798 17:5089431-5089453 TTTGCATCTCACTGTCTCATTGG + Intronic
1143342927 17:6227167-6227189 TTTCGTTCTATCTTTCTCTTTGG - Intergenic
1143616626 17:8055225-8055247 TTTCCTTCTTTCTTTTTTTTGGG + Intergenic
1144119030 17:12131708-12131730 TTTTAATCAATCTTTCTCTTAGG - Intronic
1144255327 17:13461985-13462007 TTTCCTTCTTTCTTGCTCTAAGG - Intergenic
1144504364 17:15817473-15817495 TTTGCATCTTTCTGTGCCTGGGG + Intergenic
1144634121 17:16893141-16893163 TTTGCATCTTTCTGTGCCTGGGG + Intergenic
1144805079 17:17959965-17959987 TGTGTATTTTACTTTCTCTTTGG - Intronic
1145168218 17:20632982-20633004 TTTGCATCTTTCTGTGCCTGGGG + Intergenic
1145693091 17:26765734-26765756 CTTTCATCTTTTTTTGTCTTTGG + Intergenic
1145843816 17:28019975-28019997 TTTGCCCATTTCTTTCTATTTGG + Intergenic
1146134502 17:30306855-30306877 TTTCTTTCTTTCTTTCTCTCAGG - Intergenic
1146164308 17:30575951-30575973 TTTGCATCTTTCTGTGCCTGGGG + Intergenic
1146166435 17:30593368-30593390 TTTGCATCTTTATTTATGATGGG - Intergenic
1146351874 17:32102054-32102076 TTTCTTTCTTTCTTTCTTTTTGG + Intergenic
1146972463 17:37083897-37083919 GTTGTATCTGTCTCTCTCTTTGG - Intergenic
1147153314 17:38530996-38531018 TTTGCATCTTTCTTTCTCTTTGG - Exonic
1147381744 17:40060365-40060387 TTTACCTCTCTCTTTTTCTTGGG - Intronic
1147654231 17:42079676-42079698 TTTCCTTCTTTCTTTTTTTTGGG - Intergenic
1147794915 17:43035414-43035436 TTTCCATCATTCTGTCTCCTGGG - Intergenic
1147920591 17:43914098-43914120 TTTGCTTGTTTCTTTATCTGAGG - Intergenic
1148261369 17:46186551-46186573 TATCCATTTTTCATTCTCTTGGG + Intronic
1148509951 17:48160123-48160145 TTTTCTTCTTTTTTTCTTTTTGG + Intronic
1149076642 17:52603540-52603562 TCAGCATCTTTCTTTATGTTAGG + Intergenic
1149217740 17:54377530-54377552 TTCCCATCTTTTTTTCTCTAGGG + Intergenic
1149242390 17:54665175-54665197 TTTGCTTCTTGCTTTTTTTTTGG - Intergenic
1149703556 17:58675143-58675165 TTTGCATCTTTTTTTTTTTTTGG - Intronic
1150696910 17:67413414-67413436 TTTCTTTCTTTCTTTCTTTTTGG + Intronic
1150710676 17:67528478-67528500 TTAGAATCTTTCTATGTCTTTGG + Intronic
1150852018 17:68712513-68712535 TTTGCTTATCTCTTTCTGTTTGG + Intergenic
1151306519 17:73266162-73266184 TTTCTTTCTTTCTTTCTGTTGGG - Intergenic
1151378424 17:73707966-73707988 TTTCTTTCTTTCTTTCTTTTTGG + Intergenic
1152847323 17:82609485-82609507 TGTTCATATTTCTTTCTTTTTGG - Intronic
1153388140 18:4522944-4522966 TTTGCATCTCCTTTTCTCCTGGG + Intergenic
1153945858 18:10016757-10016779 TTTTCAACTTTTTTTTTCTTTGG - Intergenic
1154035865 18:10801033-10801055 GTTTCATCCTTCTGTCTCTTTGG + Intronic
1154372512 18:13776878-13776900 TTTTTTTCTTTCTTTCTTTTTGG + Intergenic
1155408270 18:25513636-25513658 CTTGCATGTTTCTTTCTGTGGGG - Intergenic
1155409610 18:25528947-25528969 TTTGCCTATTTTTTTCTTTTAGG - Intergenic
1156268387 18:35508718-35508740 GTTGCATCTCTCCTTCTCTCGGG - Intergenic
1156357096 18:36351216-36351238 TTTGCATCTCTTTATCTCTCAGG - Intronic
1156362201 18:36393047-36393069 TTTTAATCTTTCTTTCTCAAAGG - Intronic
1156393004 18:36670218-36670240 TTTTCATGTTTCTTACGCTTGGG + Intronic
1156413429 18:36859612-36859634 TTTCTCTCTTTCTTTCTTTTTGG + Intronic
1156488149 18:37479599-37479621 CATGCTTTTTTCTTTCTCTTTGG - Intronic
1156657468 18:39306117-39306139 TTTGCTTCTTTATATCTCATTGG + Intergenic
1156786273 18:40919244-40919266 TTTACATCCTACTTTTTCTTGGG + Intergenic
1156894961 18:42235359-42235381 TTTGTATCTATCTTCCTCTCTGG - Intergenic
1157119977 18:44900109-44900131 ATCTCAGCTTTCTTTCTCTTTGG - Intronic
1157220716 18:45826911-45826933 TTTGTTTGTTTGTTTCTCTTTGG + Intronic
1157587203 18:48811018-48811040 ATTGCATCTTTCTTAAGCTTGGG - Intronic
1157786971 18:50492378-50492400 TTTTCTTCTTTCTGTGTCTTGGG + Intergenic
1158199954 18:54928882-54928904 TTTGTATCTTATTTTCTCCTAGG - Exonic
1158426214 18:57341790-57341812 TTTGCCTCTTCCTTTATTTTTGG - Intergenic
1158810928 18:61033314-61033336 CTTGCATTTTTAATTCTCTTGGG + Intergenic
1159298652 18:66531990-66532012 TTTTAATCTTTCTCTCTCTCAGG + Intronic
1159330203 18:66983718-66983740 TTTTCCTCTTTTTTTGTCTTAGG + Intergenic
1159801182 18:72901310-72901332 TATGCTGCTTTCATTCTCTTGGG - Intergenic
1160178692 18:76616281-76616303 TGAGCATCTTTTTTTCTTTTTGG + Intergenic
1160251272 18:77205280-77205302 TCTTCACCTTTCCTTCTCTTTGG + Intergenic
1161292872 19:3505100-3505122 GTTACATGTTTGTTTCTCTTGGG + Intergenic
1161806041 19:6443582-6443604 TTAGCATCTTCCTTCCTCTCCGG + Intronic
1163644475 19:18480631-18480653 TTTTTTTCTTTCTTTCTTTTTGG + Intronic
1164089753 19:21938607-21938629 TTTGCTTCTTTCTGTTTCCTGGG - Intronic
1164104960 19:22101858-22101880 TTTCTTTCTTTCTTTCTTTTTGG - Intergenic
1164194070 19:22938526-22938548 TTTGCTTCTTTCTGTTTCCTGGG - Intergenic
1164439168 19:28258951-28258973 TTTCCATCCTGCTGTCTCTTGGG + Intergenic
1164457810 19:28423160-28423182 TTTCCCTCTCTCTCTCTCTTTGG - Intergenic
1164491956 19:28723104-28723126 TTTGCGTCTTCCCTGCTCTTTGG - Intergenic
1166622100 19:44310460-44310482 ATTCCATGGTTCTTTCTCTTGGG - Intergenic
1167412951 19:49355825-49355847 TTTGCCTTTTTTTTTCTTTTTGG - Intronic
1167552700 19:50172091-50172113 TTTCTTTCTTTCTTTTTCTTTGG + Intergenic
1168175785 19:54626714-54626736 TTTTGATTTTTATTTCTCTTGGG + Intronic
1168607399 19:57770848-57770870 TTGGCATCTTTTTTTTTTTTCGG + Intronic
1202675411 1_KI270711v1_random:1390-1412 TCTGCATGTTTCTTGTTCTTGGG + Intergenic
1202683085 1_KI270712v1_random:28653-28675 CTTACATCTTTTTTTCTCTTTGG + Intergenic
1202708310 1_KI270714v1_random:678-700 TCTGCATGTTTCTTGTTCTTGGG - Intergenic
925229370 2:2219177-2219199 TTTGCATCTTTTTGTTTTTTGGG + Intronic
925523247 2:4771633-4771655 TTTTTATCTTTCTTTTTTTTGGG + Intergenic
925528477 2:4832110-4832132 TTTGCATCTTTCCAAATCTTTGG - Intergenic
925532718 2:4883062-4883084 TGTGCACCTTTCATTCTCTGTGG - Intergenic
925605462 2:5655542-5655564 TTTGTAACTTTTTTTTTCTTAGG - Intergenic
925619365 2:5776108-5776130 TTTTCTTCTTTTTTTCCCTTTGG - Intergenic
925668436 2:6287028-6287050 TCTGCATCTTTTTTTCTACTTGG + Intergenic
925884583 2:8383720-8383742 TTTGTGTCTTTGTTTCCCTTTGG - Intergenic
926442517 2:12904769-12904791 TTTGTTTTTTTGTTTCTCTTAGG + Intergenic
926469792 2:13239527-13239549 TTTGTATCTCTCTCTTTCTTTGG - Intergenic
926692687 2:15748193-15748215 TTTGCCTCTTTCTGTCTCAGGGG + Intergenic
926752931 2:16212992-16213014 TTTGCATTTTTATTTCTCTAGGG + Intergenic
927063668 2:19447887-19447909 TGTGTCTTTTTCTTTCTCTTTGG - Intergenic
927388990 2:22571613-22571635 TAGGTATCTTTATTTCTCTTAGG + Intergenic
927590009 2:24347264-24347286 TTTGCTTCTTTCTCTATTTTTGG - Intronic
927613709 2:24567363-24567385 TTTTCTTCTTACTTTCACTTAGG + Intronic
927728924 2:25452748-25452770 TTTTAATCTTTCTATCTCTTTGG + Intronic
928060559 2:28108719-28108741 TTTTGATCTCTCTTCCTCTTTGG + Intronic
928272564 2:29869832-29869854 TTTGCATATTTGTTTGTTTTTGG - Intronic
928735520 2:34283992-34284014 TTTGCAGCTTCCTTTCTTTCTGG - Intergenic
929000308 2:37341830-37341852 TTTCTTTCTTTCTTTCTTTTTGG - Intergenic
929195589 2:39181183-39181205 CTTGAAACTTTGTTTCTCTTTGG + Intronic
929674264 2:43909292-43909314 TTTGGATCTTGGGTTCTCTTGGG + Intronic
930252431 2:49049864-49049886 TTTGCTTCTTTCTTTTATTTGGG - Intronic
930400626 2:50880178-50880200 TTCTGATCTTTTTTTCTCTTGGG - Intronic
930734709 2:54764784-54764806 TTTTCAGCTTTCTTTCTATTTGG + Intronic
930935207 2:56940798-56940820 TATGTATCTTTCTATTTCTTTGG - Intergenic
931036209 2:58245830-58245852 TGTGCATCTTCTTTCCTCTTTGG - Intergenic
931215680 2:60241983-60242005 CTTCCACCTGTCTTTCTCTTTGG - Intergenic
931391514 2:61847949-61847971 TTTGCATGGTTCATTCTTTTGGG - Intronic
931482423 2:62655081-62655103 TTTGCCAATTTCTTACTCTTAGG + Intergenic
931660004 2:64551264-64551286 TTTTAATCTATTTTTCTCTTAGG - Intronic
932009330 2:67959626-67959648 TTATCATCTTTCTTGCTGTTAGG + Intergenic
932441704 2:71741432-71741454 TTCCCATCTTTCTTTTTCTGAGG + Intergenic
932541114 2:72653606-72653628 TTTCTTTCTTTCTTTCTTTTTGG - Intronic
932710059 2:74056274-74056296 TAAGCATCTCTCTTTCTGTTAGG + Intronic
933326601 2:80845787-80845809 TTTGCTTCTTTACTTCTCTTTGG + Intergenic
933371503 2:81420812-81420834 TTTGCATATTTCTTTCTTGTGGG + Intergenic
933392171 2:81684907-81684929 TTTGCATGTTTCTCTGTGTTTGG + Intergenic
934081198 2:88469086-88469108 TTAGCCTCTTTCATTCTCTCAGG - Intergenic
934123125 2:88859336-88859358 ATTACATATTTCTTTCTTTTTGG + Intergenic
934189074 2:89768182-89768204 CTTACATCTTTTTTTGTCTTTGG - Intergenic
934248712 2:90326523-90326545 CTTACATCTTTTTTTGTCTTTGG - Intergenic
934260868 2:91476956-91476978 CTTACATCTTTTTTTGTCTTTGG + Intergenic
934304196 2:91808914-91808936 CTTACATCTTTTTTTGTCTTTGG + Intergenic
934329059 2:92043836-92043858 CTTACATCTTTTTTTGTCTTTGG - Intergenic
934467279 2:94273759-94273781 CTTACATCTTTTTTTGTCTTTGG - Intergenic
934501517 2:94863345-94863367 TTTGCATTTTTTTTTGTCCTTGG - Intergenic
935269552 2:101422116-101422138 TCTGTTTCTTTCTTTGTCTTGGG + Intronic
935316632 2:101841462-101841484 TTTTCATCTTTTTTTTTTTTTGG + Intronic
936458187 2:112691556-112691578 TCTTCCTCTCTCTTTCTCTTAGG + Intergenic
936792611 2:116167045-116167067 TTAGCATCTTTTTTTCCGTTCGG - Intergenic
936871883 2:117143238-117143260 TTTATTTCTTTCTTTCACTTTGG + Intergenic
936887773 2:117333831-117333853 TTTTCCTTTTTTTTTCTCTTAGG - Intergenic
936918792 2:117666495-117666517 TTTGCCTATTTTTCTCTCTTGGG - Intergenic
936961672 2:118081627-118081649 TTTGGATTTTTTTTTCTATTGGG - Intergenic
937043490 2:118838329-118838351 TTTGCCTTGTGCTTTCTCTTGGG + Intergenic
937527255 2:122786699-122786721 TATGCATCTCTCATCCTCTTTGG - Intergenic
937598659 2:123702429-123702451 TTTGCAACGGTCTTTATCTTTGG - Intergenic
937638964 2:124190056-124190078 TTTGTATCTTCTTTTCTCTTTGG - Intronic
937705504 2:124915799-124915821 TATGCATCATTCTTTGTCCTGGG + Intergenic
937972734 2:127563244-127563266 TTTGCTCCTTTCCTCCTCTTGGG + Intronic
938107622 2:128544248-128544270 TTTGCATCTCTCTTTCTGTGTGG + Intergenic
938518429 2:132038896-132038918 CTTACATCTTTCTTTGTCTTTGG - Intergenic
938627499 2:133127050-133127072 TTTTTTTCTTTTTTTCTCTTGGG - Intronic
938689920 2:133778065-133778087 TTTGCATCCCTTTTGCTCTTTGG + Intergenic
939121464 2:138122836-138122858 TTTACTTGTTACTTTCTCTTTGG - Intergenic
939350911 2:141036575-141036597 TTTGCAGCTTACTTTGCCTTTGG - Intronic
939697517 2:145344645-145344667 TTTCTCTCTTTCTTTTTCTTAGG + Intergenic
939879614 2:147615025-147615047 CTTTCATCTTTCTTTCTCAGAGG - Intergenic
939914603 2:148022668-148022690 TTTTCATCTCAATTTCTCTTGGG + Intronic
939991532 2:148880487-148880509 TATACATTTTTATTTCTCTTGGG + Intronic
940002029 2:148975915-148975937 TTAGCTTCCTTCTTTCTCCTGGG + Intronic
940069902 2:149674413-149674435 TTTTCATGTCTCTATCTCTTTGG + Intergenic
940135235 2:150428064-150428086 TTAGGATCTTTATTTCTTTTTGG - Intergenic
940185705 2:150982801-150982823 TTTACTTTTTTATTTCTCTTTGG + Intergenic
940210827 2:151254975-151254997 TTTGAATCTGTCTATATCTTGGG - Intronic
940503064 2:154519069-154519091 TATGCATTTTTTTTTCTTTTAGG + Intergenic
940589653 2:155705511-155705533 TTTCTTTCTTTCTTTCTTTTTGG + Intergenic
940718738 2:157258406-157258428 TCTGCATTTTTCTTTCCCTCTGG - Exonic
940755429 2:157676433-157676455 TTTACCTCTGCCTTTCTCTTGGG - Intergenic
941414561 2:165203968-165203990 TTTTTTTCTTTCTTTCTCTGTGG + Exonic
941674119 2:168325496-168325518 TTTGCACCATTTTTTTTCTTTGG - Intergenic
941711004 2:168713309-168713331 TTTGAATCTCTCTCTCTCTAGGG - Intronic
941964024 2:171282999-171283021 GTTGCTTTTTTCTTTCTCTATGG + Intergenic
942494170 2:176521469-176521491 CTTGCTTCCCTCTTTCTCTTAGG + Intergenic
942665548 2:178312891-178312913 TTTCCTTCTTTCTTTTTTTTTGG + Intronic
942991003 2:182202637-182202659 TTAGCATCTTGGTTTCTCTGGGG - Intronic
943166838 2:184339295-184339317 TATGCATCTTTCTGTGTGTTGGG + Intergenic
943772943 2:191738514-191738536 TTTCTCTCTTTCTTGCTCTTGGG + Intergenic
944012671 2:194992854-194992876 TCTGTTTCTTTGTTTCTCTTTGG + Intergenic
944273316 2:197806054-197806076 TTTCCATCTTCCTTCCACTTGGG + Intronic
944608958 2:201380711-201380733 CTGGCATCTTCCATTCTCTTGGG + Exonic
944695201 2:202194383-202194405 TTTGCATCTCTCTTCTACTTGGG + Intronic
944975817 2:205049557-205049579 TTTCCATGTTTCTATCACTTAGG + Intronic
945051654 2:205829663-205829685 TTTGCTAATTTCTTTCTCCTTGG - Intergenic
945194955 2:207228928-207228950 TTTGCATCCTCTTTTCTGTTTGG + Intergenic
945369054 2:208994194-208994216 TTTCTTTCTTTCTTTCTTTTGGG + Intergenic
945609375 2:211979571-211979593 TTTACATTTTTCTTTCTCCTGGG + Intronic
945686272 2:212974318-212974340 TCAGCATATTGCTTTCTCTTTGG - Intergenic
945699182 2:213150086-213150108 TTTCCTTCTTTCCTTCTCTGAGG - Intronic
945757456 2:213866123-213866145 TTTCTTTCTTTCTTTCTTTTTGG - Intronic
945844821 2:214931410-214931432 TCCCCATCTTTCTCTCTCTTTGG - Intergenic
946102626 2:217339521-217339543 AATCCATCTTTCTTTCTCTAAGG + Intronic
946442128 2:219705404-219705426 TTGGCATCTACATTTCTCTTTGG - Intergenic
947339211 2:229119850-229119872 TCTGCATTTTTCTTGCTTTTAGG - Intronic
947810960 2:233003694-233003716 TTTGCGTCTTTGTTTCTCCAGGG - Intronic
948113083 2:235472536-235472558 TTTCCATTTTCCTTTCTCTCAGG - Intergenic
1169373806 20:5049676-5049698 TCTGCATATTTCTTTATCTCAGG + Intergenic
1169584528 20:7066183-7066205 TATGCATTTTTCTTTATCTTTGG - Intergenic
1171425431 20:25045733-25045755 TTTTCTTCTTCCTTTCTCTGAGG - Intronic
1171896758 20:30815526-30815548 TTTGCTTCCTTCTGTCTCCTTGG + Intergenic
1171904728 20:30892003-30892025 TTTGCTTCTTTCTGTCTCGTTGG - Intergenic
1171945858 20:31377056-31377078 TTTCCAGCCTTCTTTCTCATGGG + Intergenic
1172419265 20:34800729-34800751 TTGGGGTCTGTCTTTCTCTTTGG - Intronic
1172646353 20:36472735-36472757 TTGCCATTTTTCTTTCACTTTGG - Intronic
1172836364 20:37875801-37875823 TTTCAATCTGTCTTGCTCTTTGG + Intergenic
1173092018 20:39982074-39982096 TTTGCAACTGTCTTTCTCAAAGG + Intergenic
1173321931 20:41996129-41996151 ATTGCATCTATCTCTCTCTTTGG + Intergenic
1173399068 20:42708520-42708542 TGTCTATGTTTCTTTCTCTTGGG - Intronic
1173718489 20:45231975-45231997 TTTGCATCTTCCTATATCTCTGG + Intergenic
1173925617 20:46779084-46779106 TTTCTTTCTTTCTTTCTCCTCGG - Intergenic
1174776593 20:53348556-53348578 TTTGTTTCTTTGTTTCTTTTGGG - Intronic
1174963878 20:55188704-55188726 TCTTCATATTTCTTTATCTTTGG + Intergenic
1175405679 20:58724949-58724971 TTTAGATTTTTCTTTATCTTTGG - Intergenic
1176586582 21:8594552-8594574 CTTACATCTTTTTTTGTCTTTGG + Intergenic
1177323716 21:19556324-19556346 TTCCCATCTCTTTTTCTCTTAGG - Intergenic
1177425250 21:20914593-20914615 TTTGCCTATTTTTTTCTGTTGGG - Intergenic
1177627708 21:23685187-23685209 TTTCCATGTTTTTTTCTCTGAGG + Intergenic
1177829280 21:26118877-26118899 TTTTCATTTTTTTTTCCCTTTGG - Intronic
1177903674 21:26948928-26948950 TTAGCTTCATTCTCTCTCTTGGG + Intronic
1179010161 21:37550331-37550353 TTGGCATCTCTCATTCTCTACGG + Intergenic
1179202663 21:39240492-39240514 TTTGATTTTTTCTTTTTCTTAGG - Intronic
1179485616 21:41708582-41708604 ATTGCATCTTGCATTCTCGTTGG - Intergenic
1180269389 22:10571457-10571479 CTTACATCTTTTTTTGTCTTTGG + Intergenic
1180281228 22:10698719-10698741 CTTACATCTTTTTTTGTCTTCGG + Intergenic
1180317171 22:11285323-11285345 TTTGCTTCTTCCTGTCTCCTTGG + Intergenic
1180338153 22:11598141-11598163 TTTGCTTCTTTCTGTCTCCTTGG - Intergenic
1180595476 22:16970193-16970215 TTCCCTTCTTTCTCTCTCTTAGG - Exonic
1180663868 22:17494095-17494117 TTTCTTTCTTTCTTTCTTTTTGG + Intronic
1182722600 22:32415388-32415410 TTTTTTTCTTTCTTTCTTTTTGG - Intronic
1182989722 22:34755529-34755551 TTTGCTTCTTTCTTTCTTTGGGG - Intergenic
1183002049 22:34868711-34868733 TTTGCAACTTCCTTTCTTTCAGG + Intergenic
1184065596 22:42118090-42118112 TTTGCATCTTTGTGTCTCTATGG + Intergenic
1185159896 22:49217348-49217370 TATGCAGAATTCTTTCTCTTTGG - Intergenic
1203238314 22_KI270732v1_random:30199-30221 CTTACATCTTTTTTTGTCTTCGG + Intergenic
949143393 3:663967-663989 TTTACCACTTTCTTTTTCTTTGG + Intergenic
949292104 3:2479072-2479094 TTTCCATCTTTCTGTCACTTTGG + Intronic
949336680 3:2982483-2982505 TTTCTCTCTCTCTTTCTCTTGGG + Intronic
949622832 3:5834958-5834980 TTTGGGTCTGTCTCTCTCTTTGG + Intergenic
949757008 3:7423656-7423678 TTTGTATCCATATTTCTCTTTGG - Intronic
949856707 3:8468512-8468534 TTTGAAGCTTTCTTTCCCTAAGG - Intergenic
950573543 3:13816932-13816954 TTTCCATTTTTCTTTTACTTGGG - Exonic
950800565 3:15548941-15548963 TTCACATATTTCTGTCTCTTTGG + Intergenic
951053834 3:18124595-18124617 TTTCTAGCTTTCTTTCTTTTGGG + Intronic
951232985 3:20200947-20200969 ATTTCTTCTTTCTTTCTCTGTGG - Intergenic
951262363 3:20525275-20525297 ATTTCATATTTCTTTATCTTTGG - Intergenic
951698624 3:25471844-25471866 TTTCCATATTTCCTTCTCCTGGG + Intronic
951739010 3:25899280-25899302 ATTCCTTCTTTCCTTCTCTTTGG - Intergenic
952283796 3:31948294-31948316 TTTTCATCTTTCCATCTCTCTGG + Intronic
952703069 3:36346615-36346637 TTTGTTTCTTTTTTCCTCTTGGG - Intergenic
952787883 3:37174095-37174117 TTGGCATCTTTTTTTTACTTTGG - Intronic
953079327 3:39600704-39600726 TTTGCATCGTTCTTCTTGTTTGG + Intergenic
953473639 3:43187440-43187462 TTTGCTTCTTCCTTTCAATTTGG + Intergenic
954002005 3:47565261-47565283 TTTGCATATCTCTTGCTTTTGGG - Intronic
954840092 3:53503882-53503904 TTTGTGTCTTGCTTTCACTTGGG + Intronic
954845597 3:53552690-53552712 GTATCTTCTTTCTTTCTCTTTGG + Intronic
955026120 3:55169307-55169329 TTTTCATTTTTTTTTCTCTGGGG - Intergenic
955497509 3:59550286-59550308 TTTGCATCTTTGGTTGTCCTAGG - Intergenic
955825309 3:62939887-62939909 TTTGCATCTCTTCTTCCCTTAGG - Intergenic
955919550 3:63941204-63941226 TTTTCATCTTTCTAGCTCCTTGG + Intronic
955951734 3:64249591-64249613 TTTGTAACTTTCTTCCCCTTGGG - Intronic
956057503 3:65315807-65315829 TTTGCATATCTCTGTCTCTGTGG + Intergenic
956089115 3:65645114-65645136 TTTAACTCTTTCTTTCTTTTGGG - Intronic
956282961 3:67578035-67578057 TTTGTATCTTCCTTTCTTTCTGG + Intronic
956399400 3:68861155-68861177 TTTCCATTTGTCTTTCTCTCGGG + Intronic
956544247 3:70382251-70382273 ATTTCTTCTCTCTTTCTCTTTGG + Intergenic
956656957 3:71561859-71561881 TTTCTTTTTTTCTTTCTCTTGGG + Intronic
956663544 3:71621368-71621390 TGTGCCTCTTTGGTTCTCTTTGG - Intergenic
956790365 3:72675472-72675494 TTTCTATCTTCCTCTCTCTTAGG + Intergenic
956803356 3:72784134-72784156 TTTGTATCTTTTTTTTTTTTAGG - Intronic
956967329 3:74477377-74477399 TTTTCATCTCTTTTCCTCTTTGG - Intronic
956980270 3:74628569-74628591 TTTGCATCCTATTTTCTGTTGGG - Intergenic
957152885 3:76509338-76509360 TCTGCCTCTTTCTCTCTCTCTGG - Intronic
957465696 3:80587916-80587938 TTTGTGTTTTTTTTTCTCTTTGG + Intergenic
957914430 3:86669143-86669165 TTTGAAATTTTCTTTGTCTTTGG + Intergenic
957922731 3:86767594-86767616 TTTATATTTTTCTTTATCTTCGG - Intergenic
957993899 3:87663397-87663419 GTGGCATTTTTCTTTCTGTTTGG - Intergenic
958118081 3:89248467-89248489 TCTTCATTTTTATTTCTCTTCGG + Intronic
958825142 3:99021288-99021310 TTTGTATGTTTCTTTATCATTGG + Intergenic
958881181 3:99672392-99672414 TTTCCATCTTTTTATCTCATTGG + Intronic
959866924 3:111281496-111281518 TTTGCCTCCTTCTTTCTTTCAGG - Intergenic
959952176 3:112192553-112192575 TTTGTTTTTTTCTTTCTTTTTGG + Intronic
960342779 3:116495990-116496012 ATTTCATATTTCTTTCTTTTAGG - Intronic
960538085 3:118834944-118834966 TTTGCTTCTTTTTTCCTCCTGGG - Intergenic
960538189 3:118835995-118836017 TTTGAATTTTCCTTTATCTTAGG - Intergenic
961169480 3:124786495-124786517 GTTGCATATTTCTTTAGCTTAGG + Intronic
961187022 3:124924328-124924350 GTAGCATCTTTCTTTCTCTGGGG + Intronic
961415058 3:126751034-126751056 TTCTCATCTTTCTTGCTCTCTGG + Intronic
961430661 3:126880400-126880422 TTTGCATCTTGTTTTCTGATGGG - Intronic
961793508 3:129393304-129393326 TTAGCATCTTTGTTTCTTTGGGG - Intergenic
961807505 3:129499922-129499944 TTAGCATCTTTGTTTCTTTGGGG - Exonic
962266098 3:133945359-133945381 TGTGCATCTTTATTTCTTTTGGG + Intronic
962394853 3:135006536-135006558 TTTGCATCATTCTCTTTCTTAGG - Intronic
962400344 3:135053593-135053615 TATGCATCTTTTGTTTTCTTGGG + Intronic
962837290 3:139200786-139200808 TTTGAATCTTTTTTTTTTTTTGG - Intronic
963017818 3:140842415-140842437 TTTGCCTCTTTTGTTCTCTCTGG - Intergenic
963691518 3:148508947-148508969 TTTGCTTCTTGCTTTGTCCTGGG + Intergenic
964296840 3:155242475-155242497 TTAGCATATTTCTCTCCCTTAGG + Intergenic
964438836 3:156682816-156682838 TATGGAGCTGTCTTTCTCTTAGG - Intronic
964542726 3:157797665-157797687 CTTGCTTCTTTCTTTCTCACTGG + Intergenic
964574619 3:158151377-158151399 TTAGGATGTTTCTTTCTTTTGGG + Intronic
964797662 3:160517446-160517468 TATGCATTTTCATTTCTCTTGGG + Intronic
965038111 3:163468790-163468812 CTCGTTTCTTTCTTTCTCTTGGG - Intergenic
965858430 3:173117436-173117458 TTTGCCTGTTTCTTTCTAGTTGG + Exonic
966088151 3:176096227-176096249 TTTTCATTTTTCTTGCGCTTTGG + Intergenic
966187290 3:177239209-177239231 TGTTCATTTTTCTTTCCCTTAGG - Intergenic
966383976 3:179375104-179375126 TTTCTATCTTTATTTCTGTTTGG + Intronic
966560869 3:181318945-181318967 TATACATTTTTCTTTTTCTTTGG + Intergenic
966600117 3:181766545-181766567 TTTGCATCATTTTTTCTAATTGG - Intergenic
966710823 3:182971263-182971285 TGTCCATCTTTCTTCCTCTGTGG - Intronic
967231404 3:187340879-187340901 TTTGCATTCTTCTTACACTTTGG + Intergenic
967470840 3:189860229-189860251 TTACTATCTTTCTTTCTCTGTGG - Intronic
967549398 3:190772894-190772916 TTTTTATCTTTCTTTCATTTTGG + Intergenic
967760459 3:193219026-193219048 TTTTTATCTTACCTTCTCTTTGG + Intergenic
970640130 4:18055066-18055088 CTTGCATCTTTCCTACTTTTAGG + Intergenic
970736275 4:19172526-19172548 TTTATATGTTTCTTTCTCTTAGG - Intergenic
971539023 4:27791997-27792019 TTTGTTTTCTTCTTTCTCTTTGG + Intergenic
971623824 4:28892708-28892730 CTTTCATCTTTCTTTTTCTTAGG - Intergenic
971669346 4:29536261-29536283 TTCACATTTTTCTTTCTTTTGGG + Intergenic
971706036 4:30044943-30044965 TTTCAATCTTACTTTCTCTGAGG + Intergenic
971971596 4:33627619-33627641 TATGCTTCTTTTTTTCTCCTTGG + Intergenic
972062961 4:34903374-34903396 TCTTCATCTTTCTTTCTCTCAGG + Intergenic
972127225 4:35783500-35783522 TTTGCATGTTTCTTTGTACTTGG - Intergenic
972172507 4:36363892-36363914 TATCTTTCTTTCTTTCTCTTGGG + Intergenic
972211982 4:36849509-36849531 TTTTCATATTTCTTTATCTGTGG - Intergenic
972318139 4:37946861-37946883 CATGCATTTTCCTTTCTCTTGGG - Intronic
972330618 4:38061167-38061189 TTTGCGTCTTTCCTGCCCTTTGG + Intronic
972369992 4:38414187-38414209 TTTGGATCTTTCTCTGTTTTAGG - Intergenic
972495551 4:39631002-39631024 TTTGCTGCTTTGTTACTCTTGGG - Intronic
972836614 4:42878314-42878336 ATTTCATCATGCTTTCTCTTCGG + Intergenic
973070613 4:45853876-45853898 TTTGCATCTTTATTTCATTTTGG + Intergenic
973661887 4:53116526-53116548 TTTCCAGCTTTCTTCCTTTTGGG - Intronic
973971650 4:56218916-56218938 TTACCATCTTTCTTGCTATTTGG + Intronic
974107883 4:57491372-57491394 TTTCAATCTTTCTTTTTATTAGG + Intergenic
974141209 4:57889365-57889387 TATGTATCTTTCTTTCCATTTGG - Intergenic
974330877 4:60477064-60477086 CTTGCTTCTTTATTTCTCATTGG + Intergenic
974361935 4:60892644-60892666 TTTGTATTTTGATTTCTCTTTGG + Intergenic
974387565 4:61222435-61222457 TATGTATCTCTCATTCTCTTTGG + Intronic
974560655 4:63512359-63512381 TTTTCTTCTTTTTTTCTTTTTGG - Intergenic
974708084 4:65549103-65549125 TTTGCATTTATGTTGCTCTTTGG - Intronic
974871591 4:67650746-67650768 TGTGGGTCTTTCTTTTTCTTAGG - Intronic
974926003 4:68298255-68298277 TGTGCAGCTTTATTTCTATTTGG + Intergenic
975632801 4:76419665-76419687 TCTGCTTCTCTCTCTCTCTTAGG + Intronic
975686920 4:76925457-76925479 TCTGAACCTTCCTTTCTCTTTGG + Intergenic
976028319 4:80719376-80719398 TTGACATTTTTGTTTCTCTTGGG + Intronic
976640938 4:87337366-87337388 TTTGCATATATCTTTCTTTTAGG - Exonic
977031341 4:91888513-91888535 TGGGCATCTTTTTTTCTGTTAGG - Intergenic
977287834 4:95131193-95131215 TTTTCATCTTTTTTCCTTTTAGG + Exonic
977643211 4:99381168-99381190 TTTGAATTTTTCTTTTTCTGAGG + Intergenic
977662396 4:99605786-99605808 TTAGCATCTTTCCTTCTATTGGG + Intronic
977984257 4:103362998-103363020 TTTGCATGTTTTATTCTCATAGG - Intergenic
978011667 4:103693320-103693342 TTTGCATCTTTATTTTTTATGGG + Intronic
978161146 4:105549747-105549769 TTTCTATCTCCCTTTCTCTTAGG - Intergenic
978455735 4:108889261-108889283 TTTTCATCTTTGGTTTTCTTTGG - Intronic
978523873 4:109644789-109644811 TTTGCATTTTTATTTCTATAGGG + Intronic
978525977 4:109665791-109665813 TTCGCTTCTTTCTTTCTTTTTGG + Intronic
978722344 4:111925804-111925826 ATTTCATCTTTTTTTATCTTAGG + Intergenic
978875422 4:113635146-113635168 TTTGATTATTTCTTTCTCATAGG - Intronic
978900451 4:113943169-113943191 TTTGCTCCTGTTTTTCTCTTGGG + Intronic
979416382 4:120445500-120445522 TTTTCTTTTTTCTTTTTCTTTGG + Intergenic
979466644 4:121046917-121046939 TTTACATATTTCTTTCTGTGAGG - Intronic
979511660 4:121561124-121561146 TTTTCATTTTGCTTTCTATTTGG + Intergenic
979720734 4:123897187-123897209 TTTGCTTGTTTGTTTCTCTTTGG + Intergenic
979770316 4:124516176-124516198 CTTGACTTTTTCTTTCTCTTTGG + Intergenic
979789199 4:124756944-124756966 TTTGCATCTCTCCTCGTCTTTGG + Intergenic
980001287 4:127491706-127491728 TTTGCATCTGTTTTACTCTTTGG - Intergenic
980105166 4:128581119-128581141 TTTGTCCATTTCTTTCTCTTGGG + Intergenic
980323067 4:131304019-131304041 TTTAAATCTTTCTTCCCCTTTGG - Intergenic
980495549 4:133585019-133585041 TTGCCATCTCTCTTTCTTTTGGG + Intergenic
980664637 4:135915134-135915156 TTTGTATTTTTCTTCTTCTTTGG + Intergenic
980754651 4:137141837-137141859 TTCTCAGCTTTCTTTCTCTGTGG + Intergenic
981164382 4:141540079-141540101 TTTTTTTCTTTCTTTCTTTTTGG - Intergenic
981216329 4:142173352-142173374 TTGGCATCTTTCATTTTCTTTGG - Intronic
981318060 4:143361214-143361236 TTTGCATCTTTCAGTCTGATAGG + Intronic
982064286 4:151639574-151639596 TGTACATCTTTCCTTCTTTTTGG + Intronic
982362323 4:154532827-154532849 TTTGCAGCTTACATTCTATTGGG + Intergenic
982367037 4:154590594-154590616 TTTTCTTCTTGCTTTCTCTCTGG - Intronic
982687182 4:158504900-158504922 TATACTTCTTTCTTTCTTTTGGG - Intronic
982964433 4:161885772-161885794 TTTGCTTCTTTCCTTGTTTTAGG + Intronic
983145194 4:164205520-164205542 TTAAAATCTTTCTTTTTCTTAGG - Intronic
983340722 4:166457103-166457125 TTTGCATTCTTTTTTCACTTAGG - Intergenic
983440051 4:167770568-167770590 TTTGCATTTTTATTTTTATTAGG - Intergenic
984152797 4:176155244-176155266 TTTTTCTCTTTCTTTCTCTCAGG + Intronic
984199859 4:176704950-176704972 TATGTATCTTTCTATCTCTGTGG + Intronic
984424771 4:179569174-179569196 TTAGGATCTTTCTTTATCCTTGG + Intergenic
984514277 4:180719309-180719331 TTTACCTCCTTCTGTCTCTTGGG + Intergenic
984636271 4:182113295-182113317 CTTGCTTCTCTTTTTCTCTTGGG + Intergenic
984727394 4:183034975-183034997 TGTTCAACTTTCTTTCTCCTAGG + Intergenic
984729085 4:183049471-183049493 ATTGCAGCTTTCATTTTCTTAGG + Intergenic
985318077 4:188679689-188679711 TTTGCTACGTTCTTTCTCTTTGG - Intergenic
985892365 5:2725522-2725544 TTTGGATGTTTCTTATTCTTAGG - Intergenic
986196466 5:5540907-5540929 TGTGCTTCTTTCTTTCTTTTTGG - Intergenic
986350485 5:6873844-6873866 TTTGAGTATTTCTTTCTCTTTGG + Intergenic
986951200 5:13087015-13087037 TTTTCATCTTTTTTACTCTTTGG - Intergenic
987048122 5:14126449-14126471 TTTGCTCTTTCCTTTCTCTTCGG + Intergenic
987095029 5:14542015-14542037 TTTGCTTCTTTGTGTTTCTTGGG + Intergenic
987201253 5:15580343-15580365 CTTGCCTCTTTATTTCACTTGGG - Intronic
987226140 5:15843471-15843493 TATGAATCTTTCCTTCTGTTTGG + Intronic
987255816 5:16149773-16149795 TATGCAGCTGTCTTTCTCCTGGG - Intronic
987826921 5:23043713-23043735 TTCTCATCTTTCTTGCTCTTTGG + Intergenic
988150934 5:27378932-27378954 TTTCCCTCTTTCTTACTCTCGGG + Intergenic
988203315 5:28098560-28098582 TTTCTCTCTTTTTTTCTCTTTGG + Intergenic
988274171 5:29059015-29059037 TTTACTACTTTTTTTCTCTTAGG + Intergenic
988835380 5:35027290-35027312 TTTCTTTCTTTCTTTCTTTTTGG + Intronic
988973515 5:36492919-36492941 TTTGGAATTTTCTTTCTCTCAGG + Intergenic
989122953 5:38022424-38022446 TTAGCATCTTTCAGTCTCTCTGG - Intergenic
989162862 5:38408580-38408602 TTTGCTTCTTTCCTTCTATCAGG - Intronic
989274759 5:39574680-39574702 TTTGAATCATTGTTTCTCTATGG - Intergenic
989462178 5:41713411-41713433 TTTAGATCTTTCTTTGTCTTTGG + Intergenic
989489747 5:42036593-42036615 TTTGCATCTAGCCTTATCTTGGG + Intergenic
989504103 5:42205937-42205959 TTTCCTTCTTTCTTTTACTTTGG - Intergenic
989607033 5:43254383-43254405 TATGTATCATACTTTCTCTTGGG - Intronic
989728222 5:44614201-44614223 TTTTCATTTTTCTTTCTTTTGGG + Intergenic
990027395 5:51211146-51211168 TTTTCATCATTTTTTCTCTCTGG + Intergenic
990079657 5:51897777-51897799 ATTTCATTTTTCATTCTCTTGGG - Intergenic
990604370 5:57394229-57394251 TTCCCTTCTTTTTTTCTCTTGGG + Intergenic
990691428 5:58368536-58368558 TTTTCATCTTTTTCTCTCTCTGG - Intergenic
991012716 5:61900741-61900763 TTTTCTTCTTTCTCTCTATTTGG - Intergenic
991384611 5:66071366-66071388 TTTCTTTCTTTCTTTCTTTTTGG - Intronic
991691964 5:69234157-69234179 TTTTCATTTTTCTCTCTCTTAGG - Intergenic
991733073 5:69607681-69607703 CTTGCTTCTTTCTTTCTTTTTGG + Intergenic
991809509 5:70462826-70462848 CTTGCTTCTTTCTTTCTTTTTGG + Intergenic
991861880 5:71020170-71020192 CTTGCTTCTTTCTTTCTTTTTGG - Intronic
992121360 5:73596524-73596546 TTTTCAGTTTTCTGTCTCTTTGG - Intergenic
992246644 5:74831546-74831568 TTTGCATTTTCCTTTCTTGTTGG + Intronic
992707626 5:79413300-79413322 TTTGCACTTGTATTTCTCTTGGG - Intronic
992746082 5:79822113-79822135 TTTGCTTTTTTTTTTTTCTTTGG + Intergenic
992842807 5:80712760-80712782 TTTGCATCTTTTTTTTTTGTTGG + Intronic
992904119 5:81328442-81328464 TTTGCATTTTCCTTTTTCTTAGG - Intergenic
992917307 5:81470564-81470586 TTTACATATTTCTTTGTTTTAGG + Intronic
993149016 5:84135992-84136014 TCTTTTTCTTTCTTTCTCTTTGG - Intronic
993246234 5:85457092-85457114 TTAGCATTTTTTTTTCTTTTTGG + Intergenic
993528315 5:88993859-88993881 TTTGCATCTTTCCATTTTTTTGG + Intergenic
993688018 5:90964726-90964748 TTTGCATTTTTTTTTTTTTTTGG - Intronic
993735173 5:91467546-91467568 TTTCTTTCTTTCTTTCTTTTTGG + Intergenic
993740308 5:91530548-91530570 TTTCCGTCTTTCTTTATATTTGG - Intergenic
994289495 5:98011654-98011676 ATTCCATTCTTCTTTCTCTTTGG - Intergenic
994579352 5:101618988-101619010 TTTTTCTCCTTCTTTCTCTTTGG + Intergenic
994669212 5:102746513-102746535 TTTCCATCTTTGAATCTCTTTGG + Intergenic
995177433 5:109195056-109195078 TGTGTTTCTTTCTTTCTTTTGGG - Exonic
995299022 5:110556386-110556408 TTTCCTTCTTTCTTTCTTTCAGG + Intronic
995687840 5:114790371-114790393 TTGCCATCTTTCTCTCTCTGGGG + Intergenic
995756188 5:115506809-115506831 TTTGCATGTTTCTCTTTCATGGG + Intergenic
995822954 5:116258714-116258736 TCGTCCTCTTTCTTTCTCTTTGG + Intronic
996065960 5:119079653-119079675 TTTGTACCTTGCTTTCTCTTTGG + Intronic
996065966 5:119079750-119079772 TTTGTACCTTGCTTTCTCTTTGG + Intronic
996647738 5:125836870-125836892 TTTCCATCCTTCTTTGCCTTAGG - Intergenic
996740438 5:126793876-126793898 TTTCTTTCTTTCTTTCTTTTTGG - Intronic
996932933 5:128912414-128912436 TTTTCATCTCTTTTTCTTTTTGG + Intronic
997417897 5:133743004-133743026 TTTGAATATTTCTTTCATTTAGG + Intergenic
997922563 5:137996589-137996611 TTTTCATCTTTCTTTTTTTTTGG + Intronic
998194145 5:140052463-140052485 TTTGTTTCTTTCTTTCCTTTTGG - Intergenic
998277627 5:140772807-140772829 TTTGCTTTTTTCTTGATCTTGGG + Intergenic
998479229 5:142447938-142447960 TATGCGTTTTTATTTCTCTTAGG + Intergenic
998547144 5:143039201-143039223 TTTTCTTTTTTCTTTTTCTTTGG + Intronic
998939165 5:147261824-147261846 TTTGAATTATTTTTTCTCTTTGG + Intronic
999035532 5:148344589-148344611 TTTCCATCTTCCTCTCTTTTAGG - Intergenic
999088318 5:148912702-148912724 TTTGCCTCTCTCTTTTCCTTGGG + Intergenic
999121034 5:149209563-149209585 TTTGGATCCATCCTTCTCTTGGG - Intronic
999595204 5:153195606-153195628 TTTCCATATTTCTTGCTCCTTGG + Intergenic
999680099 5:154049535-154049557 TTTGTATCTGGCTTTCTTTTAGG + Exonic
999707102 5:154283571-154283593 TCTTCTTCTTTGTTTCTCTTAGG - Intronic
999963268 5:156779842-156779864 TTTTTATCTGTCTTTTTCTTAGG - Intergenic
1000142385 5:158418323-158418345 ATTGAATCTGTCTTTATCTTAGG + Intergenic
1000204109 5:159041042-159041064 TTTGCCTCTGTATTTCTCTTTGG - Intronic
1000594501 5:163198787-163198809 TTTGAATGAGTCTTTCTCTTCGG - Intergenic
1000797734 5:165686127-165686149 TTTGCCTCTTTCCTGATCTTAGG + Intergenic
1001007360 5:168064861-168064883 TTTCTTTCTTTCTTTCTTTTTGG - Intronic
1001922910 5:175614507-175614529 TTACCATGTTTCTTTTTCTTTGG + Intergenic
1002039115 5:176498130-176498152 CTTGCATTTTTCTTTTTTTTTGG - Intronic
1003622541 6:7713634-7713656 GTAGCATCTTTCTTTTCCTTTGG + Intergenic
1003696733 6:8413699-8413721 TTTCCTTATTTCTTTCTCTTAGG - Exonic
1004497080 6:16174753-16174775 ATTTCAACTTTCTTTCTCTTTGG - Intergenic
1004803024 6:19171966-19171988 TTTGAATTTTTCTTCTTCTTTGG + Intergenic
1004879733 6:19995892-19995914 TTTTCTTCTTTCTTTCTCTAGGG + Intergenic
1004928024 6:20434676-20434698 TTTGCTTCTTTGTTTCATTTAGG + Intronic
1004956173 6:20730344-20730366 TATCTATCTTTCTTTCTTTTCGG - Intronic
1005027688 6:21479277-21479299 TTTGCATTTTTTGTTATCTTTGG + Intergenic
1005140792 6:22629396-22629418 TTTCCATTTTTCTTCCTCTTTGG + Intergenic
1006328010 6:33368452-33368474 TTTAAATTTTTTTTTCTCTTGGG - Intergenic
1006551358 6:34825902-34825924 TGTGTACTTTTCTTTCTCTTGGG + Intronic
1007183402 6:39947187-39947209 TGTTCATCTTTCTTTCTCCAAGG - Intergenic
1007998003 6:46329097-46329119 TTTGTTTCTTTCTTTTTTTTTGG - Intronic
1008076779 6:47153916-47153938 ATTGCAGAATTCTTTCTCTTTGG + Intergenic
1008110741 6:47490762-47490784 TTTCCTTCTCTTTTTCTCTTTGG + Intronic
1008197688 6:48544698-48544720 TTTGTTTCTTTCCTTCTCCTTGG - Intergenic
1008355795 6:50551737-50551759 TTTGCTTCATTCTTTCTGTTTGG + Intergenic
1008723790 6:54391964-54391986 TTTTCCTTTTTCTTTCACTTTGG - Intergenic
1008893742 6:56527234-56527256 TTTTCATCATTCTGTCCCTTGGG + Intronic
1009426943 6:63524665-63524687 TTTGCATTTCTCTTTTGCTTTGG - Intronic
1009522145 6:64696004-64696026 TTTGAATATTTCTTTTTGTTTGG - Intronic
1009932723 6:70195212-70195234 TTTGCTTCTTTCTGTTTTTTTGG + Intronic
1009935189 6:70225444-70225466 TTTCTTTCTTTCTTTCTTTTTGG + Intronic
1011070178 6:83372906-83372928 TTTGAATATTTCTTTCTTTCCGG - Intronic
1011169305 6:84488470-84488492 TAAACATCTTTCTTTCTCTGTGG - Intergenic
1011500592 6:87984742-87984764 TTTCCATTTTTATTTGTCTTTGG - Intergenic
1011706817 6:90008856-90008878 TTTGTTTCTTTCTTTCTTTCAGG - Exonic
1012183451 6:96184323-96184345 TTTGGATTTTTCTTTCTTCTTGG + Intronic
1012184967 6:96202183-96202205 TTTTCAAGTTTTTTTCTCTTCGG - Intronic
1012367660 6:98461920-98461942 ATTGCATCTCTCTTTCCCCTAGG - Intergenic
1012442677 6:99276163-99276185 TATTCTTCTTTCTTTCTTTTAGG - Exonic
1012692539 6:102333299-102333321 TTTGTATTTTTCTTTCTTTGAGG + Intergenic
1012934056 6:105347153-105347175 TTTTCATTTTCTTTTCTCTTTGG - Intronic
1013131337 6:107236089-107236111 TTTTCATGTTTCTTTTGCTTGGG - Intronic
1013338503 6:109190224-109190246 TTTCTTTCTTTCTTTTTCTTAGG + Intergenic
1013451824 6:110289139-110289161 TTTGCTTTTCTCTTTCTTTTTGG - Intronic
1013621161 6:111890844-111890866 TTTCTTTCTTTCTTTGTCTTAGG - Intergenic
1013859921 6:114623630-114623652 TATGCATATTTCTTTCTGCTGGG + Intergenic
1013935020 6:115583642-115583664 AGTGCATCTTTCCTTCTCTCTGG + Intergenic
1014349450 6:120321636-120321658 TTTTCTTCTTTCTGTTTCTTAGG - Intergenic
1014437880 6:121440622-121440644 TTTGTTTTTTTCTGTCTCTTTGG - Intronic
1014479812 6:121922017-121922039 TGTGCATTTTTCTTTTTTTTTGG + Intergenic
1014533255 6:122585899-122585921 TTTTTCTCTTTCTCTCTCTTAGG + Exonic
1014867893 6:126554461-126554483 ATTTCACCTTTCTTTTTCTTGGG + Intergenic
1014901224 6:126967898-126967920 TTTGCATATTTTTCTTTCTTTGG - Intergenic
1015273968 6:131365533-131365555 TTTCCATCTTTTTTTTTTTTTGG - Intergenic
1015409339 6:132874983-132875005 TTTGCATCATTTTTCCTTTTGGG + Intergenic
1015762804 6:136683319-136683341 TTTTCCTGTATCTTTCTCTTAGG - Intronic
1016596120 6:145803244-145803266 TTTGTATCTTTTCTTCCCTTTGG - Intronic
1016973276 6:149785319-149785341 TTTCGTTCTATCTTTCTCTTTGG + Intronic
1017897543 6:158693702-158693724 TTTCTTTCTTTCTTTCTTTTTGG + Intronic
1017958664 6:159202809-159202831 TTGTTATCTTTCTTTCTCATTGG - Intronic
1018478232 6:164164320-164164342 TTTGCATGTTTGTTTTGCTTTGG - Intergenic
1018528981 6:164742909-164742931 ATTCTACCTTTCTTTCTCTTTGG - Intergenic
1018670837 6:166175803-166175825 TTGGCATCTGTTTTTCTCTCTGG - Intergenic
1018965341 6:168482208-168482230 TTTATTTCTTTCTTTTTCTTAGG - Intronic
1019066089 6:169299258-169299280 TGGGCATCTTTCTATCTCTGAGG - Intergenic
1019116727 6:169770950-169770972 TTTTGATTTTTTTTTCTCTTTGG + Intronic
1019125012 6:169832472-169832494 TCTCTATCTCTCTTTCTCTTTGG + Intergenic
1019591600 7:1838335-1838357 AATGCATTTTTGTTTCTCTTGGG - Intronic
1019757803 7:2786396-2786418 TTTGCTGCTTTATTTTTCTTTGG - Intronic
1020017875 7:4842054-4842076 GTTGCATCTTTTTTTTTTTTTGG - Intronic
1020350671 7:7215260-7215282 TTTGCATGTCTCTTTCTGTATGG - Intronic
1020472073 7:8549100-8549122 TTGGTTTCTTTCTTTCTCTTCGG + Intronic
1020492848 7:8810896-8810918 TTTGTTTTTTTTTTTCTCTTTGG + Intergenic
1020514624 7:9101868-9101890 TTTGCATTTCTCCTTTTCTTAGG + Intergenic
1020624009 7:10556362-10556384 TTTGCATCTATGTTTATCATTGG - Intergenic
1020679215 7:11216156-11216178 AGTGCATATTTCTTTCTCTAAGG - Intergenic
1020852267 7:13369483-13369505 TTTTCATCTATCTTTCTCTTTGG - Intergenic
1020873083 7:13658048-13658070 CTTCCATCTTTGTTTCTCTGGGG - Intergenic
1021475933 7:21060430-21060452 TTTGGATATTTTTTTCTCCTTGG + Intergenic
1021814650 7:24435431-24435453 TTTGCTTCTTTTTTTCCTTTTGG - Intergenic
1021881775 7:25101941-25101963 TTTGAATCTCTCTTTCCTTTTGG + Intergenic
1022125852 7:27356453-27356475 ATTGCATCCTTCTTTGGCTTTGG + Intergenic
1022610337 7:31865481-31865503 GTAGCATCTTTTTTTCCCTTAGG - Intronic
1022714867 7:32890833-32890855 TTAACATCTTTTTTTCCCTTGGG - Intronic
1022789229 7:33670265-33670287 TCTGCCTCTCTCTTTCTCATTGG - Intergenic
1023099961 7:36707155-36707177 TGTGACTCTTTCTTTCACTTGGG + Intronic
1023450191 7:40276053-40276075 TTTGGATATTTTTTCCTCTTAGG + Intronic
1024108395 7:46117721-46117743 TTTGCATTTTTTTTTTTTTTTGG + Intergenic
1024263674 7:47590306-47590328 TCTTCTTCTTTCTCTCTCTTAGG + Intergenic
1024795411 7:53013566-53013588 TTTGCTTCTTTTTTTTTTTTTGG + Intergenic
1025039349 7:55626831-55626853 TTTTTTTCTTTCTTTCTTTTTGG + Intergenic
1025168662 7:56736093-56736115 TTTGCATTTTTTTTTTTTTTAGG + Intergenic
1025561613 7:62379218-62379240 CTTACATCTTTTTTTGTCTTTGG + Intergenic
1025838661 7:65122951-65122973 CTTACATCTTTTTTTGTCTTCGG + Intergenic
1025884411 7:65573031-65573053 CTTACATCTTTTTTTGTCTTCGG - Intergenic
1026389670 7:69887865-69887887 CTTTCATTTTTTTTTCTCTTGGG + Intronic
1026735889 7:72948523-72948545 TTTGCTCTCTTCTTTCTCTTTGG + Exonic
1027807389 7:82845835-82845857 TTTACATAGTTCTTTCTCTAAGG + Intronic
1028505617 7:91567384-91567406 TCTGCATGTTTCTTTCTCTCTGG - Intergenic
1028766420 7:94564879-94564901 ATTGCAGGGTTCTTTCTCTTGGG + Intergenic
1028955457 7:96684434-96684456 TATCCATCTTTCTTTCACATGGG - Intronic
1029340136 7:99935841-99935863 TTTGGACCTTAGTTTCTCTTAGG - Intergenic
1029583561 7:101454595-101454617 TTTGCATCTTTCTGCCTTTTTGG + Intronic
1029977932 7:104851723-104851745 TCTGTATCTTTAGTTCTCTTGGG - Intronic
1030063945 7:105644706-105644728 TTTGCATCTTTTTATCATTTGGG - Intronic
1030567103 7:111171450-111171472 AATGCTTCTTTCTCTCTCTTTGG - Intronic
1031078851 7:117239260-117239282 CTGCCATCTTTCCTTCTCTTAGG - Intergenic
1031505884 7:122581802-122581824 GATGCATATTTCTTTCTTTTTGG - Intronic
1032093530 7:128924227-128924249 TTTACATTTTTTTTTCTCTGTGG + Intergenic
1032123005 7:129170163-129170185 TCTGTAGCTTTCTTTCTCTTCGG + Intergenic
1032400029 7:131618343-131618365 TTTGCATGCTTCTCTCGCTTAGG + Intergenic
1032459921 7:132102827-132102849 TTTGTTTTTTTCTTTCTATTGGG + Intergenic
1032570517 7:132991279-132991301 TTTTCATATTTCTTTCTGTTTGG + Intronic
1032977092 7:137238012-137238034 TTTACTTCCTTCTTGCTCTTTGG + Intronic
1033717572 7:144018645-144018667 TTAGCATGTTTCAGTCTCTTGGG - Intergenic
1033811548 7:145018889-145018911 ATTGGACCTTTCTTTCTATTTGG - Intergenic
1034056308 7:148038790-148038812 ATTGCTTCTCTCTCTCTCTTTGG - Intronic
1035592843 8:830631-830653 TTTCCATCTTTTTTTCTTTTTGG + Intergenic
1035904837 8:3498380-3498402 TTTTCTTTTTTCTTTTTCTTGGG + Intronic
1035922397 8:3691767-3691789 TTTACACATTTATTTCTCTTTGG + Intronic
1036375227 8:8194070-8194092 TTTCTTTCTTTCTTTCTTTTTGG - Intergenic
1036470805 8:9050859-9050881 TTTGCACCTTATTATCTCTTTGG - Intronic
1036854312 8:12229078-12229100 TTTCTTTCTTTCTTTCTTTTTGG + Intergenic
1036875673 8:12471578-12471600 TTTCTTTCTTTCTTTCTTTTTGG + Intergenic
1036909967 8:12749347-12749369 TTTGGTTTTTTCTTTCCCTTTGG - Intronic
1037087760 8:14873873-14873895 TTGGCAACTGTCTTTCTCTTAGG + Intronic
1037216696 8:16463179-16463201 TTAGGATCTTTCATTTTCTTAGG - Intronic
1037328912 8:17724397-17724419 ATTGCATTTTTCTTCCTGTTTGG - Intronic
1037409263 8:18578130-18578152 TTTTCTTGTTTTTTTCTCTTAGG + Intronic
1037475220 8:19250494-19250516 TTGTCATCTTCATTTCTCTTGGG + Intergenic
1037563840 8:20099346-20099368 TTTTTTTCTTTCTTTCTTTTTGG - Intergenic
1037700997 8:21273641-21273663 TCTGCATCTTTCTTCCTCCTCGG - Intergenic
1038086546 8:24203904-24203926 TTTGCAGATTTCTTTATCTGTGG - Intergenic
1038582079 8:28756577-28756599 TGTGGATTTTTATTTCTCTTGGG + Intergenic
1038762115 8:30393920-30393942 CTTGCATTTGTATTTCTCTTAGG + Intronic
1038919044 8:32061994-32062016 TTAGAATTTTGCTTTCTCTTGGG - Intronic
1038964956 8:32561949-32561971 TTTGAGTCTTCCTTTCTTTTAGG - Intronic
1039053637 8:33516238-33516260 TTGGCATCTTGCTTCCACTTGGG - Intergenic
1039178469 8:34836351-34836373 TTTTCATCTTTGTGTCACTTGGG - Intergenic
1039550610 8:38440433-38440455 TTTGCAGCTCTCCTTCTATTTGG - Intronic
1039992812 8:42504452-42504474 TTTTAGTCTTTCTTTCTCCTCGG - Intronic
1040503071 8:48022135-48022157 TTTGGATCTTTTTTTTTTTTTGG + Intronic
1040944100 8:52864220-52864242 TTTTCTTCTTTGATTCTCTTGGG + Intergenic
1040973418 8:53162888-53162910 GTTGCATGCTTATTTCTCTTTGG - Intergenic
1041017828 8:53609176-53609198 TTTCTTTCTTTCTTTTTCTTAGG - Intergenic
1041602193 8:59732236-59732258 TTTGCCTCTTTCATTGTCTTTGG - Intergenic
1041626305 8:60031726-60031748 TTTACTTCTTTCTTTTTCTTTGG - Intergenic
1041767164 8:61431198-61431220 TTTTTTTCTTTCTTTCTTTTTGG + Intronic
1041807848 8:61873151-61873173 TTTGCTTCCTTCTTTCTCTTAGG + Intergenic
1042342383 8:67694004-67694026 TTTGCCTCTTTCTTTGTTGTAGG - Intronic
1042471013 8:69188224-69188246 TGTCCATCTTACTTTCTCTTTGG + Intergenic
1042472059 8:69201859-69201881 TTTGCATCTTTCCTTCTCTGGGG + Intergenic
1042774588 8:72415930-72415952 TTTGCCTCTTTGTGTCTGTTAGG - Intergenic
1043059307 8:75479572-75479594 TTTGCATTTTTTTTTTTTTTTGG + Intronic
1043187299 8:77170290-77170312 TTTGCATCTTCAGTTCTCATAGG + Intergenic
1043200375 8:77362184-77362206 TTTTTATCTTTCTTGATCTTGGG + Intergenic
1043325164 8:79041173-79041195 TATGCAACTTTTGTTCTCTTTGG + Intergenic
1043519605 8:81030096-81030118 TTTCTAACTTTCCTTCTCTTTGG - Intronic
1043627605 8:82282246-82282268 TTTTCTTCTTTCTTTCCTTTTGG - Intergenic
1043781241 8:84338376-84338398 TTAACATCTTTAGTTCTCTTCGG - Intronic
1044082197 8:87899157-87899179 TCAGCATCTTCCTTTCTTTTTGG - Intergenic
1044132630 8:88544265-88544287 TTTTCATCTTGTTTTCCCTTGGG - Intergenic
1044647930 8:94464268-94464290 TTCTCATGTTTCCTTCTCTTTGG - Intronic
1044769845 8:95619434-95619456 TTTGAATCTGTCTTTCTTTATGG + Intergenic
1045061115 8:98411948-98411970 TTTGCCTCTTTCTGTTCCTTGGG + Intronic
1045675495 8:104603320-104603342 TTTCTCTCTTTCTCTCTCTTTGG - Intronic
1045737236 8:105310513-105310535 TTTTCCTCTTTCTATCCCTTTGG - Intronic
1045851275 8:106701505-106701527 TTTGAGTTTTTCTTTTTCTTTGG + Intronic
1045989747 8:108292116-108292138 TCTGCCTCTTTCTTTAGCTTTGG - Intronic
1046185602 8:110711923-110711945 TTTTCTTATTTCTTTGTCTTCGG + Intergenic
1046196705 8:110873469-110873491 TCTCCTTCTTTCTTTCCCTTTGG + Intergenic
1046461007 8:114535982-114536004 TCTACTTGTTTCTTTCTCTTTGG - Intergenic
1046613069 8:116446668-116446690 ATTCCCTCTTTCTTTCTCTCAGG - Intergenic
1046897623 8:119489534-119489556 ATGGCACTTTTCTTTCTCTTTGG + Intergenic
1047355140 8:124113629-124113651 TTTGCATTATTATATCTCTTTGG + Intronic
1047559787 8:125974009-125974031 TTTTCATAATTCTTTCTCTAGGG - Intergenic
1048406340 8:134126485-134126507 CTTGCAGCTCTCTTTCTCCTTGG + Intergenic
1048525601 8:135199589-135199611 TTGGAATGTTTCTTTGTCTTAGG - Intergenic
1048533020 8:135267740-135267762 CATGCATCTTTCTTTTTCTTGGG - Intergenic
1048677155 8:136796064-136796086 TTTTTATTGTTCTTTCTCTTTGG - Intergenic
1050002944 9:1098086-1098108 TTTGCATATTCCTGTCTCCTTGG + Intergenic
1050006612 9:1138584-1138606 TTTGTTTCTTTCTTCCTCTCTGG + Intergenic
1050219167 9:3366735-3366757 TTTCTTTCTTTCTTTCTTTTTGG + Intronic
1050258816 9:3819674-3819696 TTTTCTTCTTTCTTTTTCTCAGG + Intergenic
1050263687 9:3867931-3867953 TGAACATCATTCTTTCTCTTTGG - Intronic
1050373140 9:4943129-4943151 TGGGCAATTTTCTTTCTCTTTGG - Intergenic
1050764175 9:9111941-9111963 TTTGCACCTTCTTTTCTCCTAGG - Intronic
1050775091 9:9249608-9249630 TCTTCCTCCTTCTTTCTCTTGGG + Intronic
1050969388 9:11849535-11849557 ATTACATCTTTTTTTCTCTAGGG + Intergenic
1051444014 9:17121199-17121221 TTTCCATCTCTCTTTCAATTAGG + Intergenic
1051986195 9:23090455-23090477 TTTGCGTGTTACTATCTCTTTGG - Intergenic
1052100329 9:24438325-24438347 TTTGCAAATTTTTTTCACTTCGG - Intergenic
1052155637 9:25186301-25186323 TTTAGATCTTTTTTTCTCTCTGG - Intergenic
1052388817 9:27854655-27854677 TTTGGAACTTTTTTTCTTTTTGG + Intergenic
1052609542 9:30755385-30755407 GTTGCAGCTTTCTTTGTTTTTGG - Intergenic
1052911663 9:33888021-33888043 TTTGCAGGTATCTTTCTGTTAGG + Intronic
1053031906 9:34787549-34787571 CTTACACTTTTCTTTCTCTTAGG - Intergenic
1053382101 9:37657573-37657595 TTGGCCTCTTTCTTTCTCCCTGG + Intronic
1053452386 9:38203866-38203888 TTTTCTTCTTTCTTTCTGCTGGG + Intergenic
1053697699 9:40651859-40651881 CTTACATCTTTTTTTGTCTTTGG - Intergenic
1053943725 9:43280713-43280735 CTTACATCTTTTTTTGTCTTTGG - Intergenic
1054308990 9:63451267-63451289 CTTACATCTTTTTTTGTCTTTGG - Intergenic
1054407785 9:64775381-64775403 CTTACATCTTTTTTTGTCTTTGG - Intergenic
1054440930 9:65259215-65259237 CTTACATCTTTTTTTGTCTTTGG - Intergenic
1054489346 9:65762271-65762293 CTTACATCTTTTTTTGTCTTTGG + Intergenic
1054749418 9:68889220-68889242 CAGGCATGTTTCTTTCTCTTTGG + Intronic
1054822911 9:69541542-69541564 TTTGCATTTTTTTTTTTTTTTGG + Intronic
1055085636 9:72311331-72311353 TTTGCAATTTTCTTTTTTTTAGG + Intergenic
1055173072 9:73284663-73284685 GTTGCTTCTTTCTTTCTTTCCGG + Intergenic
1055253959 9:74343913-74343935 TTTGCCTCTTTCCTAATCTTGGG - Intergenic
1055958019 9:81792561-81792583 TTTCTTTCTTTCTTTCTTTTTGG - Intergenic
1055958552 9:81797330-81797352 TCTCCATCTTTCTGTTTCTTAGG + Intergenic
1056400440 9:86222595-86222617 TTTGCTTGATTCTTTCTCCTTGG - Intronic
1057552181 9:96059702-96059724 TTTTCATCTATTTTTCTCTTTGG - Intergenic
1057719183 9:97518542-97518564 TTTGGTTTTTTCTTTGTCTTGGG + Intronic
1058042288 9:100316001-100316023 TTTAAATCTTTCTTCCCCTTGGG + Intronic
1058274441 9:103022761-103022783 TTTGCCTCTTTTTTTCTCTAAGG - Intergenic
1058311197 9:103505252-103505274 TTTTCCTCTTTCTTTATTTTTGG + Intergenic
1058592522 9:106580884-106580906 TTACCATCTTGTTTTCTCTTTGG - Intergenic
1058693361 9:107538109-107538131 TTTGTATATTTCTTTCTGTTAGG - Intergenic
1058758829 9:108109840-108109862 TTTCCTTCTTTCTTTCTCTAGGG + Intergenic
1058982268 9:110181183-110181205 TTTGACTCTTTCTCTTTCTTAGG - Intergenic
1059081512 9:111255149-111255171 TTCTCATTTTTCTTTCTCCTGGG + Intergenic
1059088513 9:111331306-111331328 TTTGCATATTTCTTACTTTCTGG - Intergenic
1059232964 9:112738417-112738439 TTTTTTTCTTTCTTTCTTTTAGG + Intergenic
1059687368 9:116650386-116650408 ATTGCTTCTTTTTTTCTCTTCGG - Intronic
1059802321 9:117762988-117763010 TTTCCTTCTTTCTTTTGCTTTGG - Intergenic
1060184407 9:121555193-121555215 TTTCTCTCTTTCTTTCTTTTTGG + Intergenic
1060401239 9:123350718-123350740 TTTGCAGCTGGCCTTCTCTTGGG + Intergenic
1061044551 9:128157850-128157872 ATTTAATCTTTTTTTCTCTTTGG + Intergenic
1061751244 9:132778522-132778544 TTTGCATTTTAATTTTTCTTTGG + Intronic
1061917828 9:133764711-133764733 TTTTCATCCTTTTTTCTCTCTGG - Intronic
1202780078 9_KI270717v1_random:25259-25281 CTTACATCTTTTTTTGTCTTTGG - Intergenic
1203586843 Un_KI270747v1:10616-10638 CTTACATCTTTTTTTGTCTTTGG - Intergenic
1186010952 X:5132359-5132381 TTTGCATCTTTAGCTCTCTTGGG - Intergenic
1186035559 X:5419287-5419309 TTTGCATGTTTATTTTTATTTGG + Intergenic
1186336192 X:8591377-8591399 TCTGAATCTACCTTTCTCTTTGG + Intronic
1186374157 X:8980649-8980671 TTTTCTTCTTTCTTCCTTTTTGG + Intergenic
1186380870 X:9057393-9057415 TCTGCCACTTCCTTTCTCTTAGG - Intronic
1186684207 X:11907810-11907832 TTTGCACCTTTTTTTCCCCTGGG + Intergenic
1186871204 X:13775531-13775553 TTTGCAACCTTCTTGCACTTAGG - Intronic
1187003133 X:15202767-15202789 TTTTCATCTTTAGCTCTCTTTGG + Intergenic
1187312514 X:18158946-18158968 TCTGCACCTTTCATTGTCTTTGG + Intergenic
1187722939 X:22170874-22170896 TGTGCTTCTTTGTTTCTCTGGGG + Intronic
1187728272 X:22226421-22226443 TTTCCTTTTTTCTTTCTGTTAGG + Exonic
1187888522 X:23911865-23911887 TTTGCTTATTTTTTTCTCTGAGG + Intronic
1188162093 X:26816640-26816662 TTTGCATCTTTAGTTCCCTGGGG + Intergenic
1188648762 X:32603400-32603422 TTTAGATCTTTCTATCTTTTTGG - Intronic
1188712458 X:33416938-33416960 TTTGCTGCTTTGTTTTTCTTTGG - Intergenic
1189014697 X:37085167-37085189 CTTGCATTTGTATTTCTCTTAGG + Intergenic
1189585514 X:42457311-42457333 TTTGCATCTTTGATTATTTTAGG + Intergenic
1189973310 X:46439492-46439514 TTTTCTTCTTTTTTTTTCTTTGG + Intergenic
1190390305 X:49924563-49924585 TTTACATTTTTCTTCTTCTTTGG + Intronic
1190920205 X:54843735-54843757 TTTGAATTTTTTTTTCTTTTTGG - Intergenic
1191109973 X:56796655-56796677 TTTTCATCTTCCTCTCTTTTTGG + Intergenic
1191131820 X:57021921-57021943 TTTTTTTCTTTTTTTCTCTTGGG + Intergenic
1192003592 X:67184896-67184918 TTTTCATCTTTTTTTCTTTGTGG - Intergenic
1192143168 X:68662009-68662031 TTTCTTTCTTTCTTTCTTTTTGG + Intronic
1193157142 X:78186074-78186096 TTTCCATCTTTATTTCGTTTTGG - Intergenic
1193516937 X:82477465-82477487 TTTGCATCTTTTATTTCCTTTGG + Intergenic
1193558451 X:82985659-82985681 TTTGAATCTTTATGTCTTTTGGG + Intergenic
1193673358 X:84417147-84417169 TTTCTTTCTTTCTTTCTTTTTGG - Intronic
1193681172 X:84520075-84520097 TTTTCTTCTTCCTTTCTCTACGG - Intergenic
1193758174 X:85434377-85434399 TTTGAATCTCTCTTTCTCTTTGG + Intergenic
1194162686 X:90473885-90473907 TTAGCAGCTTTCTTTCCCTCGGG + Intergenic
1194424761 X:93722637-93722659 TTACCATCTTTCATTGTCTTTGG - Intergenic
1194428634 X:93772257-93772279 TTTCCTTCTTTCTTTCTCCCAGG + Intergenic
1194603330 X:95950550-95950572 TTTTCATCCTTCTCTCTCATTGG + Intergenic
1194853504 X:98899112-98899134 TATGCATCTCTTTTTCCCTTGGG + Intergenic
1194877394 X:99207156-99207178 TTTACATATCTCTTTCTCTCTGG + Intergenic
1195105133 X:101596275-101596297 TTTTCTTCTTCCTTTTTCTTGGG - Intergenic
1195170050 X:102258639-102258661 TTTACATCTTCCTTTCTGATTGG + Intergenic
1195188807 X:102428461-102428483 TTTACATCTTCCTTTCTGATTGG - Intronic
1195584539 X:106550530-106550552 TTGGTATCTTTCTTTCCTTTAGG - Intergenic
1196002398 X:110800011-110800033 TCTACATATTTCTTTTTCTTTGG + Intergenic
1196049586 X:111290812-111290834 CTTGCATCTTTTCTTCTCCTGGG + Intergenic
1196088001 X:111707329-111707351 TTTGCATTTTTCTTTTTTATTGG + Intronic
1196147540 X:112335358-112335380 TTTGTTTCTTTCTTTCTTTTAGG - Intergenic
1196420375 X:115514850-115514872 TTTGCATGTTTATTTTTCTGGGG + Intergenic
1196648801 X:118147835-118147857 TTTCTTTCTTTCTTTCTTTTTGG - Intergenic
1196737195 X:118990254-118990276 CTTGCATTTCTCTTTCTGTTGGG + Intronic
1196771029 X:119293197-119293219 TTTCCTTCTTTCTTTCTTTTGGG - Intergenic
1197080533 X:122408875-122408897 TTTGCATCTTTATTTTTCCTTGG - Intergenic
1197186067 X:123588742-123588764 TTTGCATCTTTCTTTACATTTGG + Intergenic
1197775423 X:130115642-130115664 TTTCTCTCTTTCTTTCTTTTTGG - Intergenic
1198177059 X:134166940-134166962 TTTGCTTCTGTCATTCTCCTGGG - Intergenic
1198230093 X:134680886-134680908 TTTGCAATTTTCTATCTATTAGG - Intronic
1199396291 X:147342611-147342633 TTTGCTTCTTTTTATCTCTGAGG - Intergenic
1199644846 X:149898217-149898239 TTTGCCTGTTTCTTTAGCTTTGG - Intergenic
1199885217 X:152014326-152014348 TTAGCATTATTCTTGCTCTTTGG - Intergenic
1200428362 Y:3047040-3047062 TTTCCTTCTTTCTTTCTTTTTGG + Intergenic
1200508960 Y:4051621-4051643 TTAGCAGCTTTCTTTCCCTCGGG + Intergenic
1200979742 Y:9251621-9251643 TTTTCACCTTTGTTTCTCATAGG - Intergenic
1201065643 Y:10092241-10092263 TTTGTTTCTTTCTATCTCCTTGG + Intergenic
1201073276 Y:10169191-10169213 TTTGCTTCTTTCTGTCTCCTTGG - Intergenic
1201194834 Y:11481771-11481793 CTTACATCTTTTTTTGTCTTTGG - Intergenic
1201635764 Y:16121008-16121030 TTTACATTTTTATTTTTCTTTGG - Intergenic
1201671124 Y:16521604-16521626 CTAGCATCTTTCTGTCTATTAGG - Intergenic
1201703575 Y:16910723-16910745 TGTGTATTTTTATTTCTCTTGGG - Intergenic
1202027220 Y:20537331-20537353 TTCTCAGCTTTCTTTCTCTTGGG - Intergenic
1202131641 Y:21617626-21617648 TTTTCACCTTTGTTTCTCATAGG + Intergenic
1202590734 Y:26480630-26480652 TTTGAAACTTTGTTTCTCTGTGG - Intergenic
1202625929 Y:56858313-56858335 TTTCTTTCTTTCTTTCTTTTTGG - Intergenic