ID: 1147153322

View in Genome Browser
Species Human (GRCh38)
Location 17:38531025-38531047
Sequence TGGGCTTCACCCGAGCGGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 1, 2: 3, 3: 12, 4: 56}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147153312_1147153322 24 Left 1147153312 17:38530978-38531000 CCCATAAATGTGCAGGAACCAAA 0: 5
1: 0
2: 0
3: 8
4: 182
Right 1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG 0: 1
1: 1
2: 3
3: 12
4: 56
1147153313_1147153322 23 Left 1147153313 17:38530979-38531001 CCATAAATGTGCAGGAACCAAAG 0: 5
1: 0
2: 0
3: 18
4: 159
Right 1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG 0: 1
1: 1
2: 3
3: 12
4: 56
1147153310_1147153322 29 Left 1147153310 17:38530973-38530995 CCCAGCCCATAAATGTGCAGGAA 0: 3
1: 2
2: 0
3: 7
4: 162
Right 1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG 0: 1
1: 1
2: 3
3: 12
4: 56
1147153314_1147153322 6 Left 1147153314 17:38530996-38531018 CCAAAGAGAAAGAAAGATGCAAA 0: 1
1: 4
2: 5
3: 111
4: 1003
Right 1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG 0: 1
1: 1
2: 3
3: 12
4: 56
1147153311_1147153322 28 Left 1147153311 17:38530974-38530996 CCAGCCCATAAATGTGCAGGAAC 0: 5
1: 0
2: 0
3: 3
4: 110
Right 1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG 0: 1
1: 1
2: 3
3: 12
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147153322 Original CRISPR TGGGCTTCACCCGAGCGGGT GGG Exonic
906364667 1:45196675-45196697 TGGGCTTCAGCCGGGCGTGGTGG - Intronic
907297133 1:53462409-53462431 CGAGCTTCACCCGGGCAGGTTGG + Intronic
1063368828 10:5507845-5507867 TGGACTTCAGCCCAGCAGGTAGG - Intergenic
1067834890 10:49632455-49632477 AGGGCTTCAGCTGAGAGGGTTGG - Intronic
1083595721 11:63917511-63917533 TGGGCTCCACCCGGGCGGGCGGG - Intergenic
1088916244 11:114230055-114230077 TGGGCTTCAACCGAGAGGGCGGG - Intronic
1091804950 12:3349203-3349225 TGGGCTTCATTCGTGGGGGTTGG - Intergenic
1096978188 12:55712344-55712366 TGGGCTTCAAGAGAGGGGGTTGG - Intronic
1099274822 12:80561397-80561419 TGGGCTTCAACAGAGAAGGTAGG + Intronic
1122871383 14:104640594-104640616 TGGGCATCACTAGAGGGGGTTGG - Intergenic
1128182892 15:65620613-65620635 TGGGTTTACCCCCAGCGGGTAGG + Intronic
1129188931 15:73926632-73926654 TGGCCTTGTCCCGAGCGGGACGG - Exonic
1129737065 15:77972412-77972434 TGGGCCCCACCCAAGCAGGTTGG + Intergenic
1129849016 15:78781223-78781245 TGGGCCCCACCCAAGCAGGTTGG - Intronic
1130323905 15:82863295-82863317 TGGATTTCACCTGAGAGGGTTGG - Intronic
1132870041 16:2111920-2111942 GGGGCTTCTGCCGAGCGGGTGGG - Intronic
1134522498 16:14925030-14925052 GGGGCTTCTGCCGAGCGGGTGGG + Intronic
1134710168 16:16323681-16323703 GGGGCTTCTGCCGAGCGGGTGGG + Intergenic
1134717382 16:16363681-16363703 GGGGCTTCTGCCGAGCGGGTGGG + Intergenic
1134949435 16:18344964-18344986 GGGGCTTCTGCCGAGCGGGTGGG - Intergenic
1134957370 16:18388478-18388500 GGGGCTTCTGCCGAGCGGGTGGG - Intergenic
1135203912 16:20465710-20465732 TGGGCTGCATTCGAGCAGGTTGG + Exonic
1135215093 16:20559232-20559254 TGGGCTGCATTCGAGCAGGTTGG - Exonic
1136690463 16:32024890-32024912 TGGGCTTCCCCCGAGCGGGTGGG + Intergenic
1136791050 16:32968450-32968472 TGGGCTTCCCCCGAGCGGTTGGG + Intergenic
1136878763 16:33885482-33885504 TGGGCTTCCCCCGAGCGGTTGGG - Intergenic
1139478951 16:67217757-67217779 AGGGCTTCAGCAGAGAGGGTTGG - Intronic
1140042572 16:71418172-71418194 TGGGCTTCAGCTGAGAGGCTGGG + Intergenic
1141083766 16:81076984-81077006 GGGGCTTCCCCAGAGCGGGCGGG - Intronic
1203093258 16_KI270728v1_random:1229911-1229933 TGGGCTTCCCCCGAGCAGGTGGG + Intergenic
1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG + Exonic
1151553405 17:74834752-74834774 TGGGCTTCACCTGAGGGGTGAGG + Intronic
1153919940 18:9779733-9779755 TGGGCTTAAGCCAAGCTGGTTGG + Intronic
1155248668 18:23935380-23935402 TGGGCTTCAGCAGATAGGGTGGG + Intronic
1162155495 19:8675457-8675479 TGGGCTCCACCCTAGGGGTTGGG + Intergenic
1165655950 19:37532384-37532406 TGGGCTTCACCCAAGAGGAGTGG + Exonic
1167053838 19:47096375-47096397 TGGGCCGCACCCCAGCGGGAAGG - Intronic
1168510835 19:56972391-56972413 TGGGCTTCACTCTAGCATGTGGG + Intergenic
930007492 2:46909737-46909759 TGGGCTGCAGCCTAGAGGGTAGG + Intronic
931011135 2:57915732-57915754 TGGTCTGCAGCCCAGCGGGTTGG - Intronic
935717133 2:105949036-105949058 TGGCCCTCCCCCGTGCGGGTGGG + Intergenic
937395410 2:121530383-121530405 TAGGCCTCCCCGGAGCGGGTGGG - Intronic
946029871 2:216695285-216695307 TTGGCTGCAGCCGAGAGGGTGGG + Exonic
947702789 2:232249181-232249203 TGGGCTTCTCCTAAGCGGGTTGG + Intronic
947876449 2:233470949-233470971 TGGGCTGCACCTGCGGGGGTGGG + Exonic
1169195824 20:3681618-3681640 TGGGCTGCCCCCGAGGGGGAGGG + Intronic
1175914884 20:62421182-62421204 TGTGCTTCACGCGGTCGGGTGGG + Intronic
1176166923 20:63679254-63679276 TGGGATTCCCCCGACCAGGTCGG - Intronic
1182343047 22:29639907-29639929 AGGACTTCAGCCGGGCGGGTTGG + Intronic
1183956419 22:41382763-41382785 GGGGCTTCTGCTGAGCGGGTGGG + Intronic
967114309 3:186322837-186322859 TGGGCATAACCCGAGCGGCTGGG - Intronic
968080567 3:195843592-195843614 CGGGCTGCACCCGAGCAGGGTGG + Intergenic
970008074 4:11429041-11429063 TGGGCGGCACCCGAGCGGGCCGG - Exonic
975689790 4:76951194-76951216 TGAACTTCTCCCGAGGGGGTAGG - Intronic
987331748 5:16863286-16863308 TGGGCTTCTCCCCAGTGGGTGGG - Intronic
1001186300 5:169576361-169576383 TGGGCTTTACCCCAGCTGCTTGG + Intergenic
1001683876 5:173578027-173578049 TGGGCTCCACCCTGGCGGGGAGG - Intergenic
1002524647 5:179808132-179808154 CGGGCCTCCCCCGGGCGGGTGGG - Intronic
1022802858 7:33792486-33792508 TGGGCTCCACCAGAGCAGGAGGG - Intergenic
1026831528 7:73613156-73613178 TGGGCTTCACGGGAGTGGGGAGG - Intronic
1036552653 8:9828748-9828770 CAGGCTTCAGCAGAGCGGGTGGG - Intergenic
1037838859 8:22230273-22230295 TGGGCTGCCTCCGAGCGTGTGGG - Intronic
1040408480 8:47132776-47132798 TGGGCTTCCCCCCGCCGGGTGGG - Intergenic
1045465644 8:102467358-102467380 TGCACTTCTCCCGAGCAGGTGGG - Intergenic
1056718774 9:89055680-89055702 TGGGCTTCTCCCAAGCAGGAGGG + Intronic
1058959029 9:109975425-109975447 TGGCCTTCACCAGTGTGGGTGGG - Intronic
1059819029 9:117951242-117951264 TGTGCTTTAGCAGAGCGGGTGGG - Intergenic
1060478991 9:124006831-124006853 TGGGCGTCAGCTGAGCAGGTTGG - Intronic
1062405075 9:136392379-136392401 TGTGCTTGACCCGGGTGGGTGGG + Intronic
1187341609 X:18425909-18425931 AGGGCTTCCCCCGAGGGGCTGGG + Intronic
1194170531 X:90575214-90575236 TGGAGTTCATCCGAGCTGGTAGG + Intergenic
1195968651 X:110451676-110451698 TGGGCATCACTCCAGAGGGTAGG - Exonic
1200516774 Y:4152974-4152996 TGGAGTTCATCCGAGCTGGTAGG + Intergenic