ID: 1147153419

View in Genome Browser
Species Human (GRCh38)
Location 17:38531353-38531375
Sequence CTCCCTGGCCACTGTTTTGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 4, 2: 2, 3: 25, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147153419 Original CRISPR CTCCCTGGCCACTGTTTTGG CGG (reversed) Exonic