ID: 1147155782

View in Genome Browser
Species Human (GRCh38)
Location 17:38543925-38543947
Sequence CCCCGGAGTCACCACCTTCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 134}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147155776_1147155782 -4 Left 1147155776 17:38543906-38543928 CCGCCTTCAGCCGAGAGGCCCCC 0: 1
1: 0
2: 2
3: 19
4: 198
Right 1147155782 17:38543925-38543947 CCCCGGAGTCACCACCTTCATGG 0: 1
1: 0
2: 0
3: 8
4: 134
1147155774_1147155782 2 Left 1147155774 17:38543900-38543922 CCTGGGCCGCCTTCAGCCGAGAG 0: 1
1: 0
2: 1
3: 8
4: 117
Right 1147155782 17:38543925-38543947 CCCCGGAGTCACCACCTTCATGG 0: 1
1: 0
2: 0
3: 8
4: 134
1147155771_1147155782 11 Left 1147155771 17:38543891-38543913 CCGCCTGGCCCTGGGCCGCCTTC 0: 1
1: 0
2: 6
3: 51
4: 426
Right 1147155782 17:38543925-38543947 CCCCGGAGTCACCACCTTCATGG 0: 1
1: 0
2: 0
3: 8
4: 134
1147155773_1147155782 3 Left 1147155773 17:38543899-38543921 CCCTGGGCCGCCTTCAGCCGAGA 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1147155782 17:38543925-38543947 CCCCGGAGTCACCACCTTCATGG 0: 1
1: 0
2: 0
3: 8
4: 134
1147155770_1147155782 12 Left 1147155770 17:38543890-38543912 CCCGCCTGGCCCTGGGCCGCCTT 0: 1
1: 0
2: 3
3: 45
4: 469
Right 1147155782 17:38543925-38543947 CCCCGGAGTCACCACCTTCATGG 0: 1
1: 0
2: 0
3: 8
4: 134
1147155772_1147155782 8 Left 1147155772 17:38543894-38543916 CCTGGCCCTGGGCCGCCTTCAGC 0: 1
1: 1
2: 1
3: 43
4: 414
Right 1147155782 17:38543925-38543947 CCCCGGAGTCACCACCTTCATGG 0: 1
1: 0
2: 0
3: 8
4: 134
1147155778_1147155782 -7 Left 1147155778 17:38543909-38543931 CCTTCAGCCGAGAGGCCCCCGGA 0: 1
1: 0
2: 1
3: 4
4: 96
Right 1147155782 17:38543925-38543947 CCCCGGAGTCACCACCTTCATGG 0: 1
1: 0
2: 0
3: 8
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147155782 Original CRISPR CCCCGGAGTCACCACCTTCA TGG Exonic
900317700 1:2067622-2067644 CCCCCGTGCCACCACCCTCATGG - Intronic
900795162 1:4703376-4703398 CCCCCGAGTCACCACCAGGACGG - Intronic
901174330 1:7287758-7287780 TCCCTGAGTCACCACCTGGAGGG - Intronic
901974247 1:12931908-12931930 CCCCAGAGTCTCCCCCTCCAGGG + Intronic
902010928 1:13269860-13269882 CCCCAGAGTCTCCCCCTCCAGGG - Intergenic
906412262 1:45588177-45588199 CACCGCAGTCTCCACCTCCAGGG + Intronic
907368177 1:53979738-53979760 CACTGCAGTCTCCACCTTCAGGG - Intergenic
908540990 1:65121913-65121935 CACTGCAGTCTCCACCTTCAGGG + Intergenic
915367119 1:155322868-155322890 TCGGGAAGTCACCACCTTCAAGG + Exonic
915519736 1:156435125-156435147 CCTAAGAGTCACCACCTTGATGG + Intergenic
917528865 1:175815047-175815069 CCCAGGAGGCCCCACCTTCCTGG - Intergenic
920569709 1:207007422-207007444 TCCCAGAGTCCCCACCTTCAAGG - Intronic
923783376 1:237044611-237044633 CCACTGTGTCACCTCCTTCAAGG - Intronic
1066043442 10:31576481-31576503 CCAGGGAGTCCCCACCTCCAAGG + Intergenic
1072725183 10:97808322-97808344 CGCCAGAGTCACTACCTACAAGG + Intergenic
1075300938 10:121323614-121323636 ACCCTGAGTCACCTCCTTCCAGG + Intergenic
1075541626 10:123318676-123318698 CCCCTGAGTCACCATGTGCAGGG + Intergenic
1080864999 11:36186098-36186120 CCCTGGAGTCACCAACTGCCTGG + Intronic
1082063396 11:47879539-47879561 CCCCTGTGCCTCCACCTTCAGGG + Intergenic
1084519652 11:69655546-69655568 TCCCGGAGCCCCCACCCTCAGGG - Intronic
1090733090 11:129588753-129588775 CCCCTGAGTCATCACCCTCTAGG + Intergenic
1091344907 11:134846038-134846060 CCCAGGAGCCACCTCCTTCCAGG + Intergenic
1093175912 12:15912991-15913013 CCCCATATCCACCACCTTCAAGG - Intronic
1096500269 12:52060492-52060514 CCCCCAAGTCTCCACCTCCATGG + Intergenic
1101717198 12:107320984-107321006 CCCCGGCCCCACCCCCTTCAAGG - Intronic
1102234509 12:111285851-111285873 CCCCGGATTCCCCAACTTGAGGG - Intronic
1103166606 12:118775101-118775123 CCCGGAAGTCACCAGCTTCCAGG - Intergenic
1105385603 13:19926437-19926459 CACCGCAGCCCCCACCTTCAGGG + Intergenic
1108907739 13:55500448-55500470 CCCCTCAGCCACCACCTGCAGGG - Intergenic
1113506125 13:110817158-110817180 CACAGGAGGCACCACCTGCAGGG + Intergenic
1113802225 13:113092582-113092604 CATTGGAGTCACCACCTGCAGGG - Intronic
1118632023 14:67714209-67714231 CCCTGCAGCCTCCACCTTCAGGG + Intronic
1119770663 14:77218953-77218975 CCCAGGACTCACCACCCACAGGG - Exonic
1122642138 14:103166166-103166188 CCCCGGAGGCACCTCCAGCAGGG + Intergenic
1125281015 15:38042809-38042831 CCTCCGAGGCCCCACCTTCAGGG + Intergenic
1126455856 15:48861365-48861387 GCCCAGTCTCACCACCTTCAGGG + Intronic
1129053803 15:72805703-72805725 CACTGGAGTCACCAGATTCAGGG + Intergenic
1130432397 15:83861357-83861379 CCCCGGAGTCACCCCCTAGTAGG + Intronic
1135745976 16:25016341-25016363 CCCTGGAGTCAGCACATTCAGGG + Intergenic
1136061907 16:27732474-27732496 CCCAGGAGGCAAGACCTTCAAGG - Intronic
1137390394 16:48076301-48076323 CCCCAGCCTCATCACCTTCATGG + Intergenic
1137410383 16:48223164-48223186 CCCTGCTGTCACCAGCTTCATGG - Intronic
1138286339 16:55813027-55813049 CCCCAGAGTCAACCCCTTCTGGG - Exonic
1139483107 16:67241484-67241506 CCCCAGAGCCACCCCCGTCAGGG + Intronic
1140965749 16:79964432-79964454 CACTGCAGTCACCACCTCCAGGG + Intergenic
1144871306 17:18373287-18373309 CACTGCAGTCACCACCTTCTAGG - Intergenic
1147155782 17:38543925-38543947 CCCCGGAGTCACCACCTTCATGG + Exonic
1148822374 17:50367041-50367063 CCCTGGAGTGTCTACCTTCAGGG + Intergenic
1151744145 17:76002503-76002525 CCACAGTGTCACCACCTGCAGGG - Exonic
1153024745 18:662061-662083 CCCCCGAGACACCACTTACAAGG - Intronic
1153962812 18:10153882-10153904 CCCCGGAGTCCCTTCCATCATGG - Intergenic
1154312906 18:13281518-13281540 CCCTGCAGGAACCACCTTCAAGG - Intronic
1160693478 19:471023-471045 CCGGGGAGCCCCCACCTTCATGG + Intronic
1160730796 19:640845-640867 CGCCTGAATCACCACCATCAGGG + Intronic
1161825858 19:6564765-6564787 CTCCTGAGGCACCATCTTCATGG - Intergenic
1162744849 19:12792470-12792492 CCGCGGCGCCTCCACCTTCAAGG + Exonic
1165730160 19:38140099-38140121 CCCTGGAGCCACCCCGTTCATGG - Intronic
927554287 2:24021584-24021606 CTCCGGTGTCACCACCTCCAGGG + Intronic
928410565 2:31051016-31051038 CCTCGGAGAAACCACCTTCAGGG + Intronic
935561756 2:104567166-104567188 CCCTGGAGTGGCCACCTTGATGG + Intergenic
938066255 2:128283515-128283537 GCCCGGGGTCACCTCCTCCATGG - Intronic
938959124 2:136325089-136325111 ACCTGGAGTCACCTCCTCCAGGG - Intergenic
948715401 2:239857721-239857743 TCCAAGAGTCATCACCTTCATGG + Intergenic
948836956 2:240630524-240630546 CAGGGCAGTCACCACCTTCAGGG - Exonic
948921669 2:241068810-241068832 CCCCGCAGTCACCTCCTGCCTGG + Intronic
949070770 2:242022750-242022772 CCCCAGAGTCTCCAGCTGCAAGG - Intergenic
1169488342 20:6052133-6052155 GCCCGGACTCACCCCGTTCAAGG + Exonic
1174484177 20:50851106-50851128 TCCCCGAGTCACCTCCTGCAGGG - Intronic
1175508636 20:59505886-59505908 CCAGGGAGTCACAACCTTCCGGG + Intergenic
1179340715 21:40506388-40506410 CCCCGGACTCACTGACTTCACGG + Intronic
1182556935 22:31134308-31134330 CCCAGGAGCCACCACCACCAGGG - Exonic
1184937969 22:47738983-47739005 CCCCGGCTTCACCACCTACAAGG + Intergenic
950569680 3:13792271-13792293 ACCAGGAGTAACCACCTTAAAGG + Intergenic
954655435 3:52191433-52191455 CCCCTGCCTCATCACCTTCAAGG - Intergenic
954845100 3:53548555-53548577 CTCTGGAGCCACCACCTGCAGGG - Intronic
955735723 3:62036242-62036264 AACCAGAGTCACCTCCTTCAAGG - Intronic
956990434 3:74756824-74756846 CCCCTGAAACACCACCTACAAGG + Intergenic
959406770 3:105970423-105970445 CCCAGGTGTCAACCCCTTCAGGG + Intergenic
961331815 3:126147086-126147108 TCCTGGAGTGACCACCTTCTGGG + Intronic
961415063 3:126751061-126751083 CCCTGGAGTCACCACCGGTAGGG + Intronic
962671505 3:137713623-137713645 CCCTGGAGTCACCAAGATCAAGG + Intergenic
964385168 3:156139464-156139486 CCCTGGAGGAACCACTTTCATGG + Intronic
964444225 3:156741940-156741962 CCCCCTAGACCCCACCTTCAAGG - Intergenic
966958445 3:184908831-184908853 CCCCAGACTCACCACATTGAGGG - Intronic
967890334 3:194360183-194360205 CCCCGGAGAGAGCTCCTTCAGGG + Exonic
968105683 3:195999776-195999798 CCCCCGGGTCTCCAGCTTCACGG + Intergenic
968304293 3:197638924-197638946 CCCCCGAGTCTCCAGCTGCACGG - Intergenic
969202487 4:5616909-5616931 GCCGGGACTCACCAGCTTCAAGG + Intronic
978145705 4:105368866-105368888 CCCCAGAGTCATCACCATAAGGG + Intergenic
978847721 4:113293498-113293520 CTCCTCAGTCACAACCTTCAGGG - Exonic
983202940 4:164882177-164882199 CACCGGAGCCTCCACCTTCCAGG + Intronic
987066489 5:14295024-14295046 CCCAGCAGGCATCACCTTCATGG - Intronic
987955946 5:24740107-24740129 CCCACCAGTCTCCACCTTCAGGG - Intergenic
991663138 5:68970317-68970339 CCCCCCAGTGACTACCTTCATGG + Intergenic
997611624 5:135219733-135219755 CCCTGGAGAGACCACGTTCAGGG + Intronic
1004219174 6:13730900-13730922 CCCGGGAGTCACAGCCTACAGGG - Intergenic
1006187111 6:32187850-32187872 CCCCAGAGTCACCATTGTCATGG + Intronic
1006642541 6:35496643-35496665 CCCCGGCTTCCCCACCTTCCCGG + Intronic
1008491132 6:52088379-52088401 GCCCTGAGTCTCCACCTTCAAGG + Intergenic
1014421078 6:121245966-121245988 TCCCCCAGTCACCACCATCATGG + Intronic
1017981165 6:159402064-159402086 CCACAGAGACACCACATTCAGGG + Intergenic
1018468141 6:164071172-164071194 CCCAGCAGTCCCTACCTTCAAGG + Intergenic
1019476195 7:1245602-1245624 ACCCGGTTTCTCCACCTTCAAGG - Intergenic
1019625388 7:2013323-2013345 CACCGCAGTCTCCACCATCAAGG + Intronic
1019627831 7:2030034-2030056 CACCGGGCTCACCACATTCAGGG + Intronic
1022518421 7:30989881-30989903 CTCTGGACTCTCCACCTTCACGG - Intronic
1023889355 7:44381485-44381507 CCCCCGAGTCACCAGCCACATGG + Exonic
1024235144 7:47392187-47392209 CCCCGCAGCCACCACCTGCCAGG + Intronic
1024609886 7:51055189-51055211 CCCTGGAGACACCAACCTCATGG - Intronic
1026580030 7:71608016-71608038 TCCCTGAGTCACCACCTGGAAGG - Intronic
1026744930 7:73004371-73004393 CCCCAGGGTCACCACCTCCCAGG - Intergenic
1026911091 7:74092483-74092505 CCCCGGAGTGACAACCCTCAGGG - Intronic
1027031035 7:74889038-74889060 CCCCAGGGTCACCACCTCCTAGG - Intergenic
1027098810 7:75360711-75360733 CCCCAGGGTCACCACCTCCCAGG + Intergenic
1029399909 7:100337514-100337536 CCCCAGGGTCACCACCTCCCAGG + Intronic
1029610072 7:101622129-101622151 CCCCGGACCCATCAACTTCACGG - Exonic
1029716948 7:102333988-102334010 CCCCAGGGTCACCACCTCCCAGG - Intergenic
1029733864 7:102454843-102454865 CCCAGGAGCCACCGCCTGCAGGG - Exonic
1032080932 7:128858131-128858153 GCCCCGAGTCACCACCTTGCTGG - Exonic
1032091316 7:128913029-128913051 GCCCCGAGTCACCACCTTGCTGG + Intergenic
1035115241 7:156518230-156518252 GGCCGCAGTCACCACGTTCATGG + Intergenic
1035423713 7:158752335-158752357 TCTCTGAGTCAACACCTTCATGG - Intronic
1035567710 8:652310-652332 CGTCAGAGTCACCACCTTTAGGG + Intronic
1036653324 8:10659776-10659798 TCCCTGAGTCACCATCTCCACGG + Intronic
1036687838 8:10923694-10923716 CCTCCGTGTCACCACGTTCATGG - Intronic
1036797954 8:11769643-11769665 CCCCGCAGCCTCCACCTACAGGG + Intronic
1038503836 8:28067522-28067544 CTCCAGAGTCATCACCCTCAAGG - Exonic
1039775684 8:40733886-40733908 CCAAGGTGTCAGCACCTTCAGGG - Intronic
1043514195 8:80981135-80981157 CCCCGGCCTCAGCACCCTCATGG + Intronic
1045100227 8:98836448-98836470 CTCCAAAGTCACCACCTTCAGGG + Intronic
1049987859 9:969615-969637 CCGCGGAGTCGTCACCTCCAAGG + Intergenic
1051257679 9:15231979-15232001 CCCCCGAGTCACCCCCACCAGGG + Intronic
1055445655 9:76379718-76379740 CCTAGGAGTCACCACCTCTAGGG - Intergenic
1056481513 9:87011608-87011630 CTCCGTAGTCACCAACTGCAAGG + Intergenic
1057230889 9:93320698-93320720 CCCCGGGGCCGCCACCTCCAGGG - Intronic
1060265397 9:122108982-122109004 CCCCAGCACCACCACCTTCAGGG + Intergenic
1060405197 9:123369567-123369589 CCCCAGAGTCACGACTTTCCAGG + Intronic
1062520045 9:136954000-136954022 CCCTGGAGGCACCTCCTTCCAGG + Intronic
1186023372 X:5281895-5281917 CCCTGGAGTCGCCAAATTCAGGG + Intergenic
1187842644 X:23504926-23504948 CCCAGGACTCCCCACCTCCAGGG - Intergenic
1190385532 X:49879628-49879650 CCCCGCCGTCTCCACCTTCTCGG - Intergenic
1190385799 X:49881078-49881100 ACCAGGAATCACCACCCTCACGG + Exonic
1192809749 X:74537430-74537452 CCCAGGAGACTCCACCTTAAGGG - Intergenic