ID: 1147158442

View in Genome Browser
Species Human (GRCh38)
Location 17:38557310-38557332
Sequence TCACCTCTCTTTTCAACAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 180}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147158442_1147158448 11 Left 1147158442 17:38557310-38557332 CCCCTTGTTGAAAAGAGAGGTGA 0: 1
1: 0
2: 0
3: 13
4: 180
Right 1147158448 17:38557344-38557366 CTGGGTACAGATGAGGACACTGG 0: 1
1: 0
2: 3
3: 37
4: 341
1147158442_1147158449 12 Left 1147158442 17:38557310-38557332 CCCCTTGTTGAAAAGAGAGGTGA 0: 1
1: 0
2: 0
3: 13
4: 180
Right 1147158449 17:38557345-38557367 TGGGTACAGATGAGGACACTGGG 0: 1
1: 0
2: 1
3: 36
4: 313
1147158442_1147158453 25 Left 1147158442 17:38557310-38557332 CCCCTTGTTGAAAAGAGAGGTGA 0: 1
1: 0
2: 0
3: 13
4: 180
Right 1147158453 17:38557358-38557380 GGACACTGGGGCACAGAGAGGGG 0: 1
1: 3
2: 52
3: 433
4: 2750
1147158442_1147158445 -8 Left 1147158442 17:38557310-38557332 CCCCTTGTTGAAAAGAGAGGTGA 0: 1
1: 0
2: 0
3: 13
4: 180
Right 1147158445 17:38557325-38557347 AGAGGTGAAAAACTTAATGCTGG 0: 1
1: 0
2: 0
3: 23
4: 211
1147158442_1147158451 23 Left 1147158442 17:38557310-38557332 CCCCTTGTTGAAAAGAGAGGTGA 0: 1
1: 0
2: 0
3: 13
4: 180
Right 1147158451 17:38557356-38557378 GAGGACACTGGGGCACAGAGAGG 0: 1
1: 22
2: 473
3: 2158
4: 8666
1147158442_1147158454 29 Left 1147158442 17:38557310-38557332 CCCCTTGTTGAAAAGAGAGGTGA 0: 1
1: 0
2: 0
3: 13
4: 180
Right 1147158454 17:38557362-38557384 ACTGGGGCACAGAGAGGGGCAGG 0: 1
1: 5
2: 28
3: 194
4: 1113
1147158442_1147158452 24 Left 1147158442 17:38557310-38557332 CCCCTTGTTGAAAAGAGAGGTGA 0: 1
1: 0
2: 0
3: 13
4: 180
Right 1147158452 17:38557357-38557379 AGGACACTGGGGCACAGAGAGGG 0: 1
1: 9
2: 114
3: 598
4: 3661
1147158442_1147158446 -7 Left 1147158442 17:38557310-38557332 CCCCTTGTTGAAAAGAGAGGTGA 0: 1
1: 0
2: 0
3: 13
4: 180
Right 1147158446 17:38557326-38557348 GAGGTGAAAAACTTAATGCTGGG 0: 1
1: 0
2: 1
3: 19
4: 197
1147158442_1147158450 13 Left 1147158442 17:38557310-38557332 CCCCTTGTTGAAAAGAGAGGTGA 0: 1
1: 0
2: 0
3: 13
4: 180
Right 1147158450 17:38557346-38557368 GGGTACAGATGAGGACACTGGGG 0: 1
1: 2
2: 57
3: 512
4: 3541
1147158442_1147158447 4 Left 1147158442 17:38557310-38557332 CCCCTTGTTGAAAAGAGAGGTGA 0: 1
1: 0
2: 0
3: 13
4: 180
Right 1147158447 17:38557337-38557359 CTTAATGCTGGGTACAGATGAGG 0: 1
1: 0
2: 1
3: 13
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147158442 Original CRISPR TCACCTCTCTTTTCAACAAG GGG (reversed) Intronic
902895456 1:19476762-19476784 TCTCCTTGCATTTCAACAAGTGG + Intronic
904035480 1:27556431-27556453 TCACCTCCCTTTTCCTCCAGGGG + Intronic
908312284 1:62896589-62896611 TCACGTCTCTTTTAAACCAAGGG + Intergenic
909582516 1:77253859-77253881 TTCCCTCTCTTTTCTGCAAGTGG - Intergenic
909762393 1:79307694-79307716 TCAAATATCTTTTCAAGAAGAGG + Intergenic
910330489 1:86067594-86067616 TCACCTTTCATTTCAACATTCGG - Intronic
912035048 1:105301810-105301832 TCCCCTCTCCTTTCTTCAAGAGG + Intergenic
912684254 1:111749547-111749569 TTCCCTCTCTTTTCAGGAAGTGG + Intronic
916276152 1:162995743-162995765 TAATCTATCTTTTCAACAAATGG + Intergenic
919067467 1:192711557-192711579 TGACTTATCTTTTTAACAAGTGG - Intergenic
919845626 1:201640408-201640430 TCTCCTTTTTTTTCAGCAAGTGG + Intronic
920869078 1:209778302-209778324 TGACCTCACTTTACAAGAAGAGG - Intronic
922214415 1:223508908-223508930 TCACCTCTCTTCTCAGCAGATGG - Intergenic
923518476 1:234717663-234717685 TGTCCTCTCTTTGCAACACGAGG + Intergenic
1066435363 10:35392639-35392661 TCTCCTCTGCTTTCAACCAGTGG - Intronic
1068024828 10:51629740-51629762 TCACCTGGCTTATTAACAAGTGG + Intronic
1068784292 10:60953524-60953546 TCACCTCTGTTATTAAAAAGAGG - Intronic
1069302420 10:66925230-66925252 TAACCTCTCTTTTAAAGATGAGG - Intronic
1069671585 10:70209864-70209886 TGGCTTCTCTTCTCAACAAGGGG - Intronic
1076290159 10:129339884-129339906 TCACCTGTTTTTTCAAGAAAGGG - Intergenic
1077623058 11:3744752-3744774 TGACCACTCATTTCAACAAAGGG + Intronic
1079911388 11:26314804-26314826 TTATCTCTATTTTCAACAAGAGG + Intronic
1081129323 11:39358407-39358429 TAATCTATCTATTCAACAAGTGG - Intergenic
1083596728 11:63921157-63921179 TCACCTCTCATCTCAACCCGAGG - Intergenic
1084855811 11:71985356-71985378 TCACCTCTCTTGTCTCAAAGAGG + Intronic
1085371805 11:76014472-76014494 TCCCCTCTCTCTTCAAAAGGTGG + Intronic
1086597606 11:88592732-88592754 TCACATCTATTTTGAACACGAGG + Intronic
1087372128 11:97298293-97298315 TCATCTCTCTTTTCCAGATGGGG - Intergenic
1087874492 11:103339579-103339601 TTTCCTCTCTTTCCCACAAGTGG + Intronic
1087947721 11:104184411-104184433 TCACCTCTTTATAAAACAAGTGG - Intergenic
1089623937 11:119739552-119739574 TCTCCTCCCTTTTCCTCAAGGGG - Intergenic
1091008504 11:131976230-131976252 TCACCTCTCTTTTCATCGCTTGG - Intronic
1091724321 12:2834924-2834946 GCAGCTCTCTTTCCAACAGGAGG + Exonic
1091742621 12:2970860-2970882 CCACCTCTCATTCCAACATGAGG - Intronic
1091923739 12:4326912-4326934 TCACCCCTCATTTCAAAATGAGG + Intronic
1093171080 12:15861505-15861527 TCAACTCTCATTTCAACAGTGGG + Intronic
1095365374 12:41397904-41397926 TTACCTCTCTTCTCTATAAGTGG - Intronic
1096210007 12:49757794-49757816 TCACCTTTCTTTGCTACAAAGGG + Intronic
1100556665 12:95701223-95701245 TCATCTCTCTGTTCAAAAAGTGG - Intronic
1104178475 12:126355393-126355415 TAACCTTTCTTTTTACCAAGAGG - Intergenic
1108153622 13:47562890-47562912 TGACTTCTCTTTGTAACAAGAGG + Intergenic
1110216551 13:73030540-73030562 GCACCTCTCTTTTCAGGCAGTGG - Intergenic
1110666910 13:78127532-78127554 TCACTTCTCTTTCCTACAATTGG + Intergenic
1111242216 13:85489972-85489994 ACACCTCTCTATTCACCTAGTGG + Intergenic
1111734536 13:92121019-92121041 ACACCTCACTATTCAACAGGAGG + Intronic
1111837473 13:93406142-93406164 TCATCACTCTTTCCACCAAGAGG - Intronic
1113949668 13:114065067-114065089 TCAACTCTGTTTTCTGCAAGAGG - Intronic
1116921943 14:50587812-50587834 TCACTGCTCTGTTCAACAGGTGG + Exonic
1118027073 14:61780260-61780282 GCCCCTCTATTTTCAATAAGAGG + Intronic
1121231935 14:92364716-92364738 TCACCTCTCTGATCACCCAGAGG + Intronic
1121943239 14:98093178-98093200 TCTCCTTTCCTTTCATCAAGGGG + Intergenic
1125612441 15:40980606-40980628 TCAACTGTCTTTTCAGTAAGAGG + Intronic
1126059425 15:44765469-44765491 GGACTTCTCTTTCCAACAAGAGG - Intronic
1127548919 15:60017634-60017656 TCAGGTCTCTTTCCACCAAGTGG - Intronic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1131364735 15:91828708-91828730 TCAACTCTCTTATCATCATGAGG + Intergenic
1131569011 15:93514056-93514078 TCAGCAGTCTTTTCAACAAATGG + Intergenic
1131690059 15:94817262-94817284 TAACCTCTCTTGACAATAAGAGG + Intergenic
1131931230 15:97444304-97444326 TCAACAATTTTTTCAACAAGGGG + Intergenic
1132134846 15:99325758-99325780 CCACCTCTCTTCCCCACAAGTGG - Intronic
1132343115 15:101090416-101090438 TCACCCCTCCCATCAACAAGTGG + Intergenic
1133397773 16:5462075-5462097 ACCCGTCTCTTTTCAACAAAAGG + Intergenic
1134428717 16:14179940-14179962 TCTGCACTCTGTTCAACAAGAGG - Intronic
1140951168 16:79818903-79818925 TCACCTCACTTTTAAAAATGTGG - Intergenic
1146920729 17:36708811-36708833 TCACCTCTGTTTTCCAGATGAGG + Intergenic
1146972402 17:37083505-37083527 TCACTCCTCTTTTCAACAAAAGG - Intergenic
1147158442 17:38557310-38557332 TCACCTCTCTTTTCAACAAGGGG - Intronic
1150421750 17:65042769-65042791 TCAAATCTCTCTTCAACATGTGG + Intronic
1151033222 17:70766516-70766538 TCTCCTCCCTTTTCAACATCTGG - Intergenic
1152302432 17:79503090-79503112 TCCCCTCTCTCTTCCACATGAGG - Intronic
1153662032 18:7333632-7333654 TCTCCCCTCTTCTCACCAAGTGG - Intergenic
1154338673 18:13485562-13485584 GCACATCTCTGTTCTACAAGTGG - Intronic
1155590135 18:27418598-27418620 CCACCTCTATGGTCAACAAGGGG - Intergenic
1157263647 18:46197728-46197750 TAGACTCTCTTTTCAAAAAGGGG + Intronic
1158884566 18:61814649-61814671 TCTTCTCTCATATCAACAAGAGG + Exonic
1163563171 19:18032988-18033010 TCAATTCTCTGTTCAAAAAGAGG - Intergenic
1164633735 19:29778006-29778028 TCAGCCCTCATCTCAACAAGGGG - Intergenic
926071424 2:9896221-9896243 TTCCCTCTTTTTTCAAGAAGAGG + Intronic
926365252 2:12127221-12127243 GTACCTCTCTTTTCATCATGTGG + Intergenic
928895022 2:36251442-36251464 TCACCTTTCTTTTCCCCCAGAGG - Intergenic
932134896 2:69219738-69219760 TGTCCTCTGTTTTTAACAAGTGG + Intronic
933748735 2:85589502-85589524 TTACCTTATTTTTCAACAAGGGG - Intronic
934562223 2:95319323-95319345 TCCCCTCTCTTTTGAAAAACTGG - Intronic
935595038 2:104871950-104871972 TCACCTCCCTCTTCAAAGAGCGG - Intergenic
936704330 2:115053747-115053769 ACACCTTTCTTTTCAACTATTGG + Intronic
936963488 2:118101615-118101637 TCACCTCTTTTTTTCTCAAGGGG - Intronic
937200299 2:120199229-120199251 AGAACTATCTTTTCAACAAGTGG + Intergenic
937238838 2:120447311-120447333 TCACCTCTCTTTGAAAGCAGTGG - Intergenic
938395050 2:130939331-130939353 TAATAACTCTTTTCAACAAGTGG - Intronic
939701021 2:145391054-145391076 TCACCTTTCTTTAAAACAATGGG + Intergenic
941093233 2:161203631-161203653 ACACCTTTCTTTTCACCAAGAGG - Intronic
941242569 2:163057773-163057795 ACACTACTCTTTTCAACAAATGG - Intergenic
941316343 2:163997690-163997712 TCACCTCCCCTTTGGACAAGTGG - Intergenic
941373263 2:164694585-164694607 TCATCAGTTTTTTCAACAAGGGG + Exonic
945095811 2:206217954-206217976 TTTCCTCTCTTTGCAACAAAGGG + Exonic
945253440 2:207783960-207783982 TCACCTATCTTATGGACAAGTGG + Intergenic
945272769 2:207958459-207958481 TCAGTTCTATTTTCAACATGGGG + Intronic
947088076 2:226478115-226478137 TCACGTCTCCTTTCCACAAAAGG - Intergenic
1172302534 20:33860129-33860151 GCTCCTGTCTTTTCCACAAGGGG + Intergenic
1173446475 20:43123206-43123228 TCCACTTTCTTTTAAACAAGAGG + Intronic
1174201866 20:48812001-48812023 TCATCTCGCTTTTCAGGAAGGGG - Intronic
1177372891 21:20228860-20228882 TCCCCTGTCTTTTAAATAAGGGG - Intergenic
1178427333 21:32489382-32489404 TCAACTAACTTTTCAACAAGGGG - Intronic
1178778784 21:35579293-35579315 TCATCTCTACTTTGAACAAGGGG - Intronic
1179583188 21:42357926-42357948 TCACCTTTCTTTGCAAGTAGAGG - Intergenic
1181491794 22:23264740-23264762 TCACCTTTCTTTCCAGGAAGTGG - Intronic
949277990 3:2309824-2309846 CCACCTCTGTTTTCCACATGTGG + Intronic
951408936 3:22338444-22338466 TCACCTCTTTTTCCAAAAAAAGG - Intronic
952639735 3:35579345-35579367 TCCCCTCTCCTTTCCTCAAGTGG - Intergenic
952824614 3:37514514-37514536 TCACCACTCATTTCAGCATGGGG + Intronic
953944517 3:47134963-47134985 TCACCTCTCATATCAATCAGAGG + Intronic
954055661 3:48022100-48022122 TTAACTGTCTTTTCAATAAGTGG + Intronic
954258291 3:49421212-49421234 ACCCCTCTCTATTCAACATGTGG - Intronic
954342126 3:49962625-49962647 CCACATCTCTTTTTATCAAGAGG - Exonic
955792665 3:62604693-62604715 TCACCTCCTTTTACAACAAAGGG - Intronic
956204513 3:66741551-66741573 TCATCACTCCTTTCAACAACAGG - Intergenic
959411457 3:106028721-106028743 TCTCTTCTTTTTTCAAGAAGGGG - Intergenic
960322743 3:116256728-116256750 TCACCTCACTTTTCTATGAGTGG + Intronic
966859511 3:184221899-184221921 GCCCTTGTCTTTTCAACAAGTGG + Intronic
967552949 3:190820852-190820874 GAATCTCTCTTTTCAACAAGAGG + Intergenic
967605635 3:191442356-191442378 TCTCCTCCCTTTTCAATGAGTGG - Intergenic
970551245 4:17183717-17183739 TCACCAGTATTTTCAACAATAGG - Intergenic
971364458 4:25966547-25966569 TCAACTCACTATTCAACAAATGG + Intergenic
972443536 4:39120285-39120307 TCACCTCTTTTTTGAACAATAGG - Intronic
972635498 4:40880427-40880449 GCACCTTCCTTTGCAACAAGAGG + Intronic
973616820 4:52687215-52687237 TCACATCTCCTTTCAAGAAGAGG + Intergenic
974489864 4:62550901-62550923 TCATTTTTCTGTTCAACAAGTGG + Intergenic
976398748 4:84583879-84583901 TCACCTCTCTTTTCAGTAGAGGG + Intronic
978607119 4:110492755-110492777 TCACCTCTATATTAAGCAAGAGG - Intronic
979868195 4:125782095-125782117 TAACCCCGCTTTTCAATAAGGGG - Intergenic
980878854 4:138689081-138689103 TCACCGCTTTTTGCAATAAGAGG + Intergenic
982107913 4:152026731-152026753 TGATCATTCTTTTCAACAAGTGG + Intergenic
983281628 4:165688286-165688308 AGACATCTCATTTCAACAAGGGG - Intergenic
988616323 5:32778512-32778534 TCAACTCTCATTTCAATAAATGG + Intronic
993489780 5:88532938-88532960 TGACTTTTCTTTTCAACAAATGG + Intergenic
994586702 5:101717910-101717932 TCACCTTTCTTCTCAGTAAGGGG - Intergenic
994790046 5:104213123-104213145 ACACCTATGTTTTCAACAACTGG + Intergenic
994808830 5:104486942-104486964 CCACCTCTAATTTCAAAAAGTGG - Intergenic
994923251 5:106080012-106080034 TCCCCTTCCTTTTGAACAAGGGG - Intergenic
995402094 5:111754709-111754731 TCACTTGTCATTTCAACAAGTGG - Intronic
1000384823 5:160665051-160665073 TCCCCTCTTTTTTTAACAATGGG + Intronic
1000565199 5:162838011-162838033 TCAACTCTCTTTACAAGAAGGGG - Intergenic
1002282858 5:178143221-178143243 TCAGCTCCCTTTTCAATAAAGGG - Intronic
1008646813 6:53522524-53522546 TCACCTTTATTTTCAATAGGTGG - Exonic
1008678856 6:53850842-53850864 TCACATCTTTATTCAACTAGTGG + Intronic
1010814868 6:80346046-80346068 AAAACTCTCTTTTCAAAAAGAGG - Exonic
1011959919 6:93075184-93075206 TCTCCTCTCTTTAAAACTAGAGG - Intergenic
1012109853 6:95215747-95215769 TGACCTCTTTTCTCATCAAGAGG + Intergenic
1014059558 6:117054960-117054982 TTACCTCTCTTTTAATCAATGGG + Intergenic
1015105845 6:129535820-129535842 TTACATCTGTTTTCAATAAGGGG - Intergenic
1015338824 6:132074319-132074341 TCATCTGTCTTGTCAACATGGGG + Intergenic
1017952888 6:159151461-159151483 TGACCTCCCTTCTCCACAAGAGG - Intergenic
1018993676 6:168694159-168694181 TCTGCTCTCCTTTCAACAAAGGG + Intergenic
1021515860 7:21486139-21486161 TCATCTGTTTTATCAACAAGAGG + Intronic
1021884918 7:25129032-25129054 TCCCCTCTCTTCTCCTCAAGTGG + Intergenic
1022781152 7:33585278-33585300 TCACTTTTCTTTTGAGCAAGGGG + Intronic
1025039737 7:55630708-55630730 TTTCCTCTCTTTCCATCAAGGGG + Intergenic
1027586549 7:80065748-80065770 ACAACTCACTTTTCATCAAGGGG + Intergenic
1028299596 7:89181089-89181111 TCCCCTATCTTTTCCTCAAGTGG + Intronic
1028353462 7:89878613-89878635 TACCTTCTCTTTTCATCAAGTGG + Intergenic
1028671085 7:93400830-93400852 TAAACTCTCTGTTCAACAAAAGG + Intergenic
1028982871 7:96986127-96986149 TCACCTCTCTCTTCATTATGGGG - Intergenic
1029235757 7:99117108-99117130 TCAACAGTCTTTTCAACAAATGG + Intronic
1029430779 7:100528505-100528527 AAACCTGTCTTTTCAACAAATGG - Intergenic
1034240269 7:149605453-149605475 TCACATCTCTTGTTAACAAAAGG - Intergenic
1034871748 7:154691311-154691333 TCATGTCTCTTTTTAACAAATGG + Intronic
1036605659 8:10303412-10303434 TCACCTCTCTGTTCATCATTTGG + Intronic
1037590737 8:20310047-20310069 TCACCTTTGTCTTCAAGAAGGGG + Intergenic
1038179080 8:25209778-25209800 TCACTTCTACTCTCAACAAGAGG + Intronic
1041252134 8:55944868-55944890 TCCCCTTTATTTTGAACAAGAGG - Intronic
1041366673 8:57113883-57113905 CCACCACTCTTTGCCACAAGGGG - Intergenic
1042116380 8:65436155-65436177 TCACCTTTTTTTTAAACAGGTGG + Intergenic
1045419454 8:101999870-101999892 TCATCTCTCCTTTCAAAAACTGG + Intronic
1047033061 8:120904574-120904596 TCACCCCTCTTGGGAACAAGGGG - Intergenic
1047078126 8:121427689-121427711 ACACCTCTCTCTTAAACAACAGG + Intergenic
1047843839 8:128784724-128784746 TCACCTCTTTTTTTAACCAGTGG + Intergenic
1050718953 9:8562981-8563003 TCATCTGCCTTTTCAACAATTGG - Intronic
1051828579 9:21250218-21250240 TCCTCTGTCTTTCCAACAAGTGG + Intergenic
1052929860 9:34047568-34047590 ACAGCACTTTTTTCAACAAGGGG - Intronic
1053231336 9:36412581-36412603 TCATCTCGCTCTTCACCAAGTGG - Intronic
1055074420 9:72198798-72198820 CCACCTATCTTTTCACCAAATGG - Intronic
1055797074 9:79986241-79986263 TCAACACTATTTTCATCAAGTGG + Intergenic
1059204645 9:112452966-112452988 TAACCTCCCTTTTCATCTAGTGG + Intronic
1059258092 9:112948825-112948847 CCACTTCTCTCTTCACCAAGTGG + Intergenic
1187780816 X:22821542-22821564 TCACCACTCTGTTGAACAAAAGG + Intergenic
1191600743 X:63002453-63002475 ACACCTCACTTTTCACCAAGGGG - Intergenic
1191826871 X:65375540-65375562 TTCCCTCTCATTTCCACAAGTGG - Intronic
1193662661 X:84275569-84275591 TCAACACTCTATTCAACAAATGG + Intergenic
1194110174 X:89824204-89824226 TTCCCTCTCTTTTCCTCAAGTGG - Intergenic
1194937570 X:99970078-99970100 TTACCTCTCCTTTCCACAAGTGG + Intergenic
1195678758 X:107527799-107527821 TAAGCTCTCTCTTCAACTAGAGG + Intronic
1196980645 X:121209653-121209675 TCTCTTCTCTTTTCAAGCAGAGG + Intergenic
1200309738 X:155065956-155065978 TCACCTCTGGGTTCACCAAGAGG - Exonic
1200462831 Y:3478945-3478967 TTCCCTCTCTTTTCCTCAAGTGG - Intergenic