ID: 1147159490

View in Genome Browser
Species Human (GRCh38)
Location 17:38562050-38562072
Sequence GCCCCAGCGCCATCCTGGAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 1, 2: 4, 3: 29, 4: 263}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147159490_1147159506 30 Left 1147159490 17:38562050-38562072 CCGCTCCAGGATGGCGCTGGGGC 0: 1
1: 1
2: 4
3: 29
4: 263
Right 1147159506 17:38562103-38562125 CTCCCAGCCTCTCGGCCGCGTGG 0: 1
1: 0
2: 2
3: 19
4: 166
1147159490_1147159504 22 Left 1147159490 17:38562050-38562072 CCGCTCCAGGATGGCGCTGGGGC 0: 1
1: 1
2: 4
3: 29
4: 263
Right 1147159504 17:38562095-38562117 CGGGGCGCCTCCCAGCCTCTCGG 0: 1
1: 0
2: 0
3: 17
4: 177
1147159490_1147159498 2 Left 1147159490 17:38562050-38562072 CCGCTCCAGGATGGCGCTGGGGC 0: 1
1: 1
2: 4
3: 29
4: 263
Right 1147159498 17:38562075-38562097 GGGCTGACGCCCTGGGCGGCCGG 0: 1
1: 0
2: 1
3: 13
4: 203
1147159490_1147159496 -5 Left 1147159490 17:38562050-38562072 CCGCTCCAGGATGGCGCTGGGGC 0: 1
1: 1
2: 4
3: 29
4: 263
Right 1147159496 17:38562068-38562090 GGGGCTGGGGCTGACGCCCTGGG 0: 1
1: 0
2: 4
3: 68
4: 538
1147159490_1147159499 3 Left 1147159490 17:38562050-38562072 CCGCTCCAGGATGGCGCTGGGGC 0: 1
1: 1
2: 4
3: 29
4: 263
Right 1147159499 17:38562076-38562098 GGCTGACGCCCTGGGCGGCCGGG 0: 1
1: 0
2: 1
3: 20
4: 206
1147159490_1147159495 -6 Left 1147159490 17:38562050-38562072 CCGCTCCAGGATGGCGCTGGGGC 0: 1
1: 1
2: 4
3: 29
4: 263
Right 1147159495 17:38562067-38562089 TGGGGCTGGGGCTGACGCCCTGG 0: 1
1: 0
2: 11
3: 115
4: 954
1147159490_1147159500 4 Left 1147159490 17:38562050-38562072 CCGCTCCAGGATGGCGCTGGGGC 0: 1
1: 1
2: 4
3: 29
4: 263
Right 1147159500 17:38562077-38562099 GCTGACGCCCTGGGCGGCCGGGG 0: 1
1: 0
2: 0
3: 24
4: 197
1147159490_1147159497 -2 Left 1147159490 17:38562050-38562072 CCGCTCCAGGATGGCGCTGGGGC 0: 1
1: 1
2: 4
3: 29
4: 263
Right 1147159497 17:38562071-38562093 GCTGGGGCTGACGCCCTGGGCGG 0: 1
1: 0
2: 1
3: 34
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147159490 Original CRISPR GCCCCAGCGCCATCCTGGAG CGG (reversed) Exonic
900300441 1:1974231-1974253 GCCCCACAGTCATCCTGGGGTGG + Intronic
901755107 1:11436764-11436786 GCCCCAGGTCATTCCTGGAGTGG - Intergenic
902336447 1:15757611-15757633 GCCCCAGAGCCACCCTGGAGGGG + Intronic
903031390 1:20466554-20466576 ACCCCAGCACCATCCTGGGAAGG - Intergenic
905824294 1:41017243-41017265 CTGCCAGCGCCATCCAGGAGTGG - Exonic
906660363 1:47577670-47577692 GCCTCAGGGCCCTCCTGGATGGG - Intergenic
907185188 1:52603533-52603555 TCCCCAGGTCCATCCTGAAGAGG - Intronic
911299707 1:96157281-96157303 GCCCCAGCCCCAGCTGGGAGGGG + Intergenic
912079014 1:105912345-105912367 ACCCCACTGCCTTCCTGGAGAGG + Intergenic
915118148 1:153612971-153612993 GCCCCAGAGCCCTGCTGGAGAGG - Intronic
915535059 1:156530459-156530481 GCCCCAGCCATATCCTGCAGAGG - Intronic
915664884 1:157435247-157435269 GCCCCAGCCACTTCCTGGAAAGG - Intergenic
915671364 1:157491627-157491649 GCACCAGCTCCATCAAGGAGTGG + Intergenic
915996929 1:160572955-160572977 GCCCCAGCCCAATCCAGGAGGGG - Intronic
916610458 1:166386552-166386574 GCCCTAGCAGCTTCCTGGAGGGG - Intergenic
917191664 1:172424926-172424948 GCCACAGGGCCAGCCTGGAGTGG + Intronic
917684168 1:177399019-177399041 GCCTGAGAGCCATCCTGGGGTGG - Intergenic
918070149 1:181128668-181128690 GCCCTGGGGCCAGCCTGGAGAGG - Intergenic
922785720 1:228281395-228281417 GTCCCAGTGGCATCCTGGTGTGG + Intronic
922897811 1:229114057-229114079 GCTCCAGTGCCATCTTTGAGAGG + Intergenic
1064716265 10:18180020-18180042 GCCCCAGCTCCAGCCAGCAGAGG - Intronic
1064867355 10:19895981-19896003 GCTCCAGGACCTTCCTGGAGTGG - Intronic
1067081986 10:43217213-43217235 CCCCCAGCCCCATGCTGGGGTGG - Intronic
1069846372 10:71374610-71374632 TCCCCATCTCCATCCTGGAAGGG + Intergenic
1070394500 10:76000494-76000516 GTCCCAGCCTCATGCTGGAGAGG + Intronic
1071086508 10:81874063-81874085 GCCGCACCGCCATCCGGCAGGGG + Intergenic
1071528483 10:86372130-86372152 GCCCCAACGCCTGCCTGGGGTGG + Intergenic
1071604005 10:86972179-86972201 GCCCCACCAGCCTCCTGGAGTGG - Intronic
1072572717 10:96672744-96672766 GCCCCAGCCCCAGCTGGGAGAGG - Intronic
1075723882 10:124602021-124602043 GCCCCAGCTCCATCCGGGGGTGG + Intronic
1075897510 10:126009849-126009871 GCCGCTGCTCCCTCCTGGAGTGG + Intergenic
1076871797 10:133198204-133198226 CCCCCAGGGCCATGCGGGAGGGG + Intronic
1076880579 10:133237511-133237533 GCGCCAGCGTCCCCCTGGAGAGG + Exonic
1077216289 11:1396501-1396523 GCCCTCGGGCCAGCCTGGAGGGG - Intronic
1077509235 11:2947383-2947405 GACCCAGTGCCTTGCTGGAGGGG + Intronic
1081330372 11:41793326-41793348 ACCCCACTGCCTTCCTGGAGAGG + Intergenic
1081627464 11:44663980-44664002 CCCCCACCTCCCTCCTGGAGGGG - Intergenic
1081712533 11:45226595-45226617 GCCTCAGCGTCATCCTGGATGGG + Intronic
1082996880 11:59262113-59262135 CCCCGAGCACTATCCTGGAGCGG - Intergenic
1084533162 11:69741236-69741258 GCCTCAGAGCCCACCTGGAGAGG - Intergenic
1084684894 11:70687765-70687787 GCCCCTGCCCCATCCAGGTGGGG + Intronic
1085472275 11:76766142-76766164 GGCCCAGCTCCCTGCTGGAGTGG - Intergenic
1087589077 11:100161803-100161825 GCTCCAGGGCTATCCTTGAGAGG - Intronic
1091236767 11:134027235-134027257 GCCCAAGAGCCATCCTAGAAAGG + Intergenic
1091435037 12:465728-465750 GCCCCAGCACCATCAAGCAGGGG - Intronic
1091435071 12:465850-465872 GCCCCAGCACCATCAAGCAGGGG - Intronic
1091435141 12:466096-466118 GCCCCAGCACCATCAAGCAGGGG - Intronic
1096531992 12:52248289-52248311 GGCCCAGGGCCCTGCTGGAGGGG + Intronic
1096541451 12:52309599-52309621 ACCCCAGGGCCTTCCTGGAGGGG + Intergenic
1103558361 12:121779298-121779320 GTCCCAGGGGCAGCCTGGAGGGG + Exonic
1104479118 12:129091785-129091807 GCCCCAACTCCATCCTGGTCTGG + Intronic
1106569087 13:30910832-30910854 GCCTCACCTCCATCCTGCAGTGG + Intronic
1107044989 13:35984478-35984500 TCAACAGCCCCATCCTGGAGAGG - Intronic
1109730407 13:66405811-66405833 AAACCAGCTCCATCCTGGAGAGG - Intronic
1113642726 13:111969735-111969757 GCCTCAGTGCCAGCCTGGCGGGG + Intergenic
1113898664 13:113783630-113783652 ACCCCAGCTACTTCCTGGAGAGG + Intronic
1114493704 14:23118782-23118804 GCCCCAGCGCCTTCCTGTCTGGG + Exonic
1117372664 14:55093109-55093131 CCCCCTGCCCCATCATGGAGAGG - Intergenic
1118241796 14:64066903-64066925 GCCCCAGCCCCAGCCTACAGGGG - Intronic
1119400572 14:74359645-74359667 GCCTCAGTGCCATCCTTTAGAGG - Exonic
1123113860 14:105885078-105885100 ACCTCAGCCCCCTCCTGGAGGGG - Intergenic
1123116087 14:105894713-105894735 ACCTCAGCCCCCTCCTGGAGGGG - Intergenic
1123983592 15:25624686-25624708 GCCCCAGAGCCAAGCTGGACCGG - Intergenic
1124223067 15:27866286-27866308 GCCCCAGCGTCGTGCTGAAGAGG + Intronic
1129234749 15:74217425-74217447 GCCCCAGAGCCCACCTGCAGGGG - Intergenic
1129570806 15:76682058-76682080 GCCCCAGCGGCACCCTGGTTGGG - Intronic
1131827676 15:96333571-96333593 GCCCCAGCCCCAGCCCGGCGGGG - Intronic
1132658760 16:1052458-1052480 GCCCCCGCCCCATGGTGGAGGGG - Intergenic
1132836279 16:1954841-1954863 GCCCCAGGGCCATCGAGGAAAGG - Intronic
1132875543 16:2135442-2135464 GGCCCAGCGGCACCCGGGAGAGG - Intronic
1133138631 16:3729181-3729203 GGCCCAGCCCCCTCCTGCAGCGG - Exonic
1133156743 16:3881021-3881043 GCCCCAGCGGGCTCCGGGAGCGG + Intergenic
1133238844 16:4403001-4403023 GCCCCATCTCCTTCCTGGCGGGG - Intronic
1134200093 16:12190844-12190866 CCCCCAGCGTCATCTTGGAAAGG - Intronic
1134519444 16:14911918-14911940 GGCCCAGCGGCACCCGGGAGAGG + Intronic
1134554492 16:15154317-15154339 GGCCCAGCGGCACCCGGGAGAGG - Intergenic
1134707114 16:16310573-16310595 GGCCCAGCGGCACCCGGGAGAGG + Intergenic
1134960426 16:18401551-18401573 GGCCCAGCGGCACCCGGGAGAGG - Intergenic
1135415431 16:22265094-22265116 AGCTCAGCCCCATCCTGGAGGGG + Intronic
1136142331 16:28295372-28295394 GCTCCGGAGCCATCCTAGAGTGG - Intronic
1136398321 16:30004934-30004956 GCCCAGGCGCCTCCCTGGAGAGG + Intronic
1137237206 16:46625892-46625914 GCCCCAGCCCCTTCCAGGCGGGG - Intergenic
1137244032 16:46688656-46688678 GTCCCCACGCCCTCCTGGAGGGG - Intronic
1138103660 16:54274880-54274902 GTTCCAGCTCCATCCTGGTGGGG + Intergenic
1140700269 16:77575071-77575093 GGCCCAGGGAAATCCTGGAGGGG + Intergenic
1141989474 16:87602230-87602252 GCCCCCGCCCCCTCCGGGAGTGG - Intronic
1142225164 16:88873620-88873642 GCCCCAGAGCCTTCCTGGGCAGG + Intergenic
1142251108 16:88992472-88992494 GCCCCAGCCCCACCCTGTAGAGG - Intergenic
1142265603 16:89062808-89062830 GCTCCAGGCCCATCCTGGACCGG + Intergenic
1142685393 17:1574659-1574681 GCCCAGGAGCCATCCTGGCGTGG - Exonic
1143627474 17:8118784-8118806 GGCCCAGGGCGGTCCTGGAGCGG - Exonic
1143681099 17:8476627-8476649 GACCCAGCTCCAGCCTGGTGTGG + Intronic
1143739906 17:8945018-8945040 GCACCAGCATCTTCCTGGAGAGG - Intronic
1143756596 17:9072211-9072233 GCTCCAGGGCCACCCGGGAGGGG - Intronic
1143917759 17:10306570-10306592 ACACCAGCGCCCACCTGGAGCGG - Exonic
1143928299 17:10392942-10392964 ACACCAGCGCCCACCTGGAGCGG - Exonic
1143932581 17:10445087-10445109 ACACCAGCGCCCACCTGGAGCGG - Exonic
1143939346 17:10523607-10523629 ACACCAGCGCCCACCTGGAGCGG - Exonic
1144608706 17:16689988-16690010 GCTCCAGCGCCAACCTGGGCTGG - Intergenic
1144904110 17:18625839-18625861 GCTCCAGCGCCAACCTGGGCTGG + Intergenic
1145128481 17:20320903-20320925 GCTCCAGCGCCAACCTGGGCTGG - Intergenic
1145841635 17:28000051-28000073 GCCACTGCGCCGGCCTGGAGTGG - Intergenic
1146052182 17:29562925-29562947 GCCTCATCGACATCCCGGAGCGG + Exonic
1146543388 17:33717552-33717574 ACCCCAGCTCCAGCCTGGACCGG - Intronic
1147159490 17:38562050-38562072 GCCCCAGCGCCATCCTGGAGCGG - Exonic
1147429701 17:40363804-40363826 TCCCCAGCGCCATGGGGGAGTGG - Exonic
1147684910 17:42281328-42281350 CCCCCAGGGCCCTTCTGGAGGGG - Intergenic
1148205267 17:45775829-45775851 GGCCCAGCCCCATCCTGCTGTGG + Intergenic
1148337394 17:46851239-46851261 GCCTCCGCCCCATCCCGGAGAGG + Intronic
1148354966 17:46969476-46969498 ACCCCAGCCCCACCCTGCAGAGG + Intronic
1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG + Intronic
1149034155 17:52115670-52115692 GCCCCAGCCCCAACCGAGAGGGG - Intronic
1149625067 17:58074346-58074368 CCCCCACCTCCCTCCTGGAGGGG + Intergenic
1151320396 17:73349162-73349184 GCCCCGGAGCCAGCCTGGCGGGG + Intronic
1151756878 17:76080206-76080228 GCCCCAGCCCCTTCTTGGACGGG - Intronic
1152168088 17:78723899-78723921 GCTCCAACACCGTCCTGGAGGGG + Intronic
1152928746 17:83099611-83099633 GCCCCTGTGCCAGCCTGCAGTGG + Intergenic
1152962352 18:87375-87397 GCCCAGGCCCCATCCTGCAGGGG + Intergenic
1154209215 18:12365121-12365143 GCCCCAGAGCAATCCCAGAGGGG + Intronic
1154367806 18:13726996-13727018 GCCCCAGGGCCGTGCTGGGGAGG + Intronic
1155072372 18:22327756-22327778 GCCCCAGTGCCTTCCTGCAATGG + Intergenic
1156482737 18:37446319-37446341 GACACAGCCCCAGCCTGGAGGGG + Intronic
1160199868 18:76787557-76787579 TCGCCTTCGCCATCCTGGAGGGG - Intergenic
1160530280 18:79558524-79558546 GCCCCTCCGCCAGCCTGAAGTGG + Intergenic
1160832814 19:1111524-1111546 GCCCCAGGGATACCCTGGAGGGG - Exonic
1160859270 19:1230842-1230864 GTACCAGCGCCATCCTCGGGGGG + Exonic
1160948845 19:1656092-1656114 CCCCCAGCGCCCTCCAGCAGGGG + Intergenic
1161014529 19:1977196-1977218 GCCCCAGTGCCATCCTGGGCTGG + Intronic
1161349707 19:3784996-3785018 TCCCCAGAGGCATCCTGGATGGG + Intronic
1161733731 19:5977931-5977953 GCCACGGCGCTAGCCTGGAGCGG + Intronic
1162018211 19:7856885-7856907 GAGCCAGCTCCGTCCTGGAGAGG - Intronic
1162140145 19:8580636-8580658 TCCCCAGACCCACCCTGGAGGGG + Exonic
1163028606 19:14529002-14529024 GCCCCAGCCCCATTCTGGGGTGG - Intronic
1163038077 19:14583211-14583233 GCCCCAGCCCCAGCCTGGCCGGG - Intronic
1163038769 19:14587468-14587490 GCCCCAGCCCCAGCCTGGCCAGG - Intronic
1163039515 19:14592135-14592157 GCCCCAGCCCCAGCCTGGCCAGG - Intronic
1163393658 19:17046084-17046106 GCCCCAGCCCCATCCAGGGCAGG - Intergenic
1163760371 19:19133094-19133116 GCCCCAGCCCCAGCCTTGGGAGG - Intronic
1166283534 19:41810250-41810272 CCCCCTACGCCTTCCTGGAGAGG + Intronic
1166304124 19:41928107-41928129 GCCCCCGCGGCGTCCTGGGGAGG + Intronic
1166531974 19:43548138-43548160 CCCCCACCTCCCTCCTGGAGGGG - Intronic
1167005719 19:46775366-46775388 GCCCCAGCACCCTCCAGGACAGG - Exonic
1168297399 19:55384142-55384164 GCAGCAGCGCCATCCGGCAGCGG + Exonic
925129480 2:1484356-1484378 GCCCCATCACCATCCTGGGAAGG + Intronic
925295510 2:2773873-2773895 TCCCCAGCGCCACCCAGGAAAGG + Intergenic
926128170 2:10284577-10284599 GCCCCTCTGCCATCCTGGTGCGG + Intergenic
926394638 2:12428423-12428445 CCTCCAGCCCCATCCTGGTGAGG + Intergenic
929127767 2:38536417-38536439 GCCCCGGGGCCAACCTGGACAGG + Intergenic
932793435 2:74675014-74675036 GCCCCAGCCCAGACCTGGAGAGG + Exonic
933709796 2:85316458-85316480 GCAGCAGCGCCATCCTGAAGTGG + Intergenic
933713267 2:85343305-85343327 GCAGCAGCGCCATCCTGAAGCGG - Exonic
934787587 2:97024862-97024884 GCCCAAGCGGCTACCTGGAGAGG + Intergenic
936146998 2:109986847-109986869 GCCCCAGCCCCATCAGGGCGCGG + Intergenic
936197694 2:110384636-110384658 GCCCCAGCCCCATCAGGGCGCGG - Intergenic
936247011 2:110837111-110837133 GCCCCTGTCCCATGCTGGAGGGG - Intronic
938776384 2:134544975-134544997 TCCCCAGCCCCCTCCTGGAGGGG + Intronic
940318963 2:152354274-152354296 GCTCCAGCTCCATCCTGGAATGG + Intronic
942276233 2:174326125-174326147 ACCCCCGCGACACCCTGGAGTGG - Intergenic
945978852 2:216292406-216292428 GCTCCACCTCCACCCTGGAGGGG - Intronic
946038758 2:216765972-216765994 ACCCCAGAGCCAGCCAGGAGTGG - Intergenic
947733748 2:232444497-232444519 GCCTCAGCCCCATGCTGGGGAGG + Intergenic
947742959 2:232493184-232493206 GCCCCAGCTCCAACCTGGACAGG + Intergenic
947772514 2:232681885-232681907 ACCCCAGGACCCTCCTGGAGGGG - Exonic
948593612 2:239066091-239066113 GCCCCAGCGTCATGCTGGAATGG + Intronic
1171183544 20:23109122-23109144 ACCCCAGAGCCATCCTTGTGTGG - Intergenic
1171861393 20:30405389-30405411 CCCCCACCTCCCTCCTGGAGGGG - Intergenic
1174020538 20:47525719-47525741 CCCCCACCTCCATCCCGGAGGGG + Intronic
1174382540 20:50165817-50165839 GCCCCATTGACATCCTGGACTGG - Intergenic
1174858657 20:54069787-54069809 GCCCCAGCTCCACCCTGGGCTGG - Intronic
1175433152 20:58921489-58921511 GCCCCAGGGCCTTCCTCGTGGGG - Intergenic
1175468840 20:59211197-59211219 GCCCCAGCAACAGCCTGGAATGG + Intronic
1175935871 20:62513786-62513808 GCCCCAGCCCCATCCCCGTGTGG + Intergenic
1176040044 20:63060547-63060569 GCCCCAGGGCCAGCCAGGAGGGG - Intergenic
1176053688 20:63133968-63133990 GCCCCAGGGCCACTCTGCAGGGG - Intergenic
1179449301 21:41457519-41457541 GTCCCAGTCCCATCCTGGAAGGG + Intronic
1179565601 21:42245991-42246013 GCCCCAGGAGCATCCTAGAGAGG + Intronic
1179933679 21:44589862-44589884 GCTCCAGGACCATCCTGGGGAGG - Intronic
1180741854 22:18059019-18059041 GCCCCAGATCCAGCCTGGTGAGG + Intergenic
1180951971 22:19724546-19724568 GCCCTCGCGCCAACCTGGACCGG + Exonic
1182468360 22:30532048-30532070 GGCCCAGCCCCATCTTGGATGGG - Intronic
1182834734 22:33332812-33332834 GCCCCAGCCCCAGCCAGCAGAGG + Intronic
1183339683 22:37273316-37273338 GCCCCAGCGCTGCCCTGGGGTGG + Intergenic
1183407560 22:37637987-37638009 GCCCCAGCTCCGGCCTGGTGAGG - Intronic
1183482099 22:38070763-38070785 GGCCCAGGGCCATGCTGGGGAGG - Intronic
1183524144 22:38313944-38313966 GCCCCAGGGCCATCCCAGATGGG - Intronic
1183579743 22:38716855-38716877 GCCACGGCGGCAGCCTGGAGTGG + Exonic
1183748164 22:39704168-39704190 CCCCCAGCTCCCTCCTGGCGGGG - Intergenic
1184234120 22:43174028-43174050 GCCCCAGCAAAAACCTGGAGAGG + Intronic
1184322258 22:43751524-43751546 GTCCCAGCTCCATCCTGGAGTGG - Intronic
1184423034 22:44392784-44392806 GCCCCAGCCCCAGCCTCCAGGGG + Intergenic
1184464387 22:44660368-44660390 GACCCATCGCAGTCCTGGAGTGG + Intergenic
1185070344 22:48652564-48652586 CACCCAGCGCCATCCAGGAGGGG + Intronic
1185247602 22:49781389-49781411 GCCCCAGGGCCCACCTGGGGAGG + Intronic
1185333311 22:50261129-50261151 GCCGCGGCGCCTTCCCGGAGCGG + Intronic
950018598 3:9770501-9770523 GCCTCAGCTCCATCTTGCAGAGG - Intronic
950424146 3:12915543-12915565 GCCCCAGCACCACCCGGGCGGGG - Intronic
954481298 3:50803842-50803864 CCCCCACCTCCATCCTGGACGGG + Intronic
956122132 3:65977209-65977231 GCCCCACCACCATCCCGCAGTGG + Intronic
956290313 3:67654316-67654338 GCCCCTGCCCCACACTGGAGCGG + Intronic
957952238 3:87141614-87141636 GTCCCAGCCCCAGCATGGAGGGG - Intergenic
961391573 3:126555428-126555450 GGCCCAGTTCCATGCTGGAGCGG - Intronic
961603165 3:128076142-128076164 GGACCAGCGCTATTCTGGAGGGG + Intronic
961750325 3:129090584-129090606 GCCCCAGCCCCTTCCAGGCGGGG - Exonic
968229304 3:196995956-196995978 GCCACAGCCCTATCCTGGTGTGG - Intronic
968631714 4:1655347-1655369 GCCCCGGCGCCGTCCTGCCGAGG - Exonic
969050401 4:4368999-4369021 GCTCCAGCCCCATGGTGGAGTGG + Intronic
969496601 4:7529909-7529931 GGCCCCCCGCCATCCTGGGGAGG + Intronic
970397208 4:15681307-15681329 GCCCCAGCCCCGACCTGGCGGGG - Intronic
973293371 4:48490857-48490879 GTCTCACCGCCTTCCTGGAGGGG + Exonic
984985805 4:185328771-185328793 GCCCCAGGCGCTTCCTGGAGAGG + Intronic
985915414 5:2914563-2914585 GCCCCAGCTCCTGACTGGAGAGG - Intergenic
986480421 5:8181038-8181060 GCCCCAGCACCCACCTGGTGAGG - Intergenic
989626332 5:43432569-43432591 GCCCCAGGCCAATCCTGGAAAGG - Intergenic
992098161 5:73381526-73381548 GCCCCAGCGCCCTCCTACACCGG - Intergenic
992460304 5:76953963-76953985 GCCGCAGCGCCGTCCTCGGGCGG - Intronic
997241425 5:132311172-132311194 GCCCTAGCTCCATCTTGGATGGG - Intronic
999197363 5:149791524-149791546 CCCCCAGCCCCAATCTGGAGTGG - Intronic
999262980 5:150249025-150249047 GTCCCATCCCCATCCTGCAGTGG - Intronic
999400169 5:151258321-151258343 GCCCTTGCAACATCCTGGAGAGG + Intronic
1002052533 5:176579405-176579427 GCCCCAGCGCCATCATTTACTGG - Intronic
1002176055 5:177402167-177402189 GTTCCTGCGCCATCCTGGCGCGG + Exonic
1002344030 5:178535788-178535810 TCCCCAGCCCCATCGTGGAGAGG + Intronic
1002458170 5:179357832-179357854 GCCCCAGCTACAGCCTGGACCGG - Intergenic
1002695570 5:181086179-181086201 GGCTCAGCGCCCTGCTGGAGGGG - Intergenic
1006149031 6:31976268-31976290 CCCCCACCTCCCTCCTGGAGGGG + Intronic
1006725511 6:36196817-36196839 GCCCCAGCGCGGGCCGGGAGGGG + Exonic
1007612682 6:43160611-43160633 GCCCCAGAGGCATCCTTGGGTGG + Intronic
1007941496 6:45785697-45785719 GCTCCAGCTCCATCCTGCAGGGG - Intergenic
1010637829 6:78282739-78282761 TCCCCAACACCAGCCTGGAGTGG - Intergenic
1013751596 6:113413858-113413880 TGCTCAGCCCCATCCTGGAGGGG - Intergenic
1015925770 6:138308904-138308926 GCCACAGAGCCACCCTGGAAAGG - Intronic
1016994832 6:149954447-149954469 GTCCCGGCGCCCTCCTGTAGCGG + Intergenic
1017003773 6:150014989-150015011 GTCCCGGCGCCCTCCTGTAGCGG - Intergenic
1017891610 6:158644284-158644306 GCCCCAGCCCCAGCCTGGAGCGG - Intronic
1017966468 6:159271110-159271132 GCCCCAACCCCAGCCTGGGGTGG - Intronic
1019293716 7:262922-262944 GCCCCAGTGCCAACCAGCAGGGG + Intergenic
1019293728 7:262975-262997 GCCCCAGCGCCGACCAGCAGGGG + Intergenic
1019293740 7:263028-263050 GCCCCAGCGCCGACCAGCAGGGG + Intergenic
1019293752 7:263081-263103 GCCCCAGCGCCGACCAGCAGGGG + Intergenic
1019293772 7:263187-263209 GCCCCAGCGCCGACCAGCAGCGG + Intergenic
1019293792 7:263293-263315 GCCCCAGCGCCGACCAGCAGCGG + Intergenic
1019293822 7:263452-263474 GCCCCAGCGCCGACCAGCAGCGG + Intergenic
1019293834 7:263505-263527 GCCCCAGCGCCAACCAGCAGGGG + Intergenic
1019293844 7:263558-263580 GCCCCAGCGCCGACCAGCAGCGG + Intergenic
1019293856 7:263611-263633 GCCCCAGCGCCGACCAGCAGGGG + Intergenic
1019293868 7:263664-263686 GCCCCAGCGCCGACCAGCAGGGG + Intergenic
1019293880 7:263717-263739 GCCCCAGCGCCGACCAGCAGGGG + Intergenic
1019293890 7:263770-263792 GCCCCAGCGCCGACCAGCAGCGG + Intergenic
1019293930 7:263982-264004 GCCCCAGCGCCGACCAGCAGCGG + Intergenic
1019293940 7:264035-264057 GCCCCAGCGCCGACCAGCAGCGG + Intergenic
1019430509 7:996882-996904 CCCCCAATGCCATCCTGGGGTGG + Intergenic
1019718603 7:2554846-2554868 GCCCCAGGGCCAGCCTGGGCTGG + Intronic
1021991905 7:26148278-26148300 CCCCCAGCTCCCTCCCGGAGGGG - Intergenic
1021991928 7:26148325-26148347 CCCCCAGCTCCCTCCCGGAGGGG - Intergenic
1021991951 7:26148372-26148394 CCCCCAGCTCCCTCCCGGAGGGG - Intergenic
1023811479 7:43915571-43915593 GCCCCAGCCCCAGCTGGGAGGGG - Intronic
1024256427 7:47543325-47543347 TCCCCAGGGCCATGCTGGAGGGG + Intronic
1026941618 7:74290516-74290538 GCCCCAGCCCCACCCTGGGAAGG + Intronic
1032127165 7:129203507-129203529 GCCCCTGTGCCATCGTGGAGAGG + Exonic
1032250954 7:130256787-130256809 GCCCCAGCCCCAGCCAGGAAGGG - Intergenic
1032291092 7:130591027-130591049 CCCCCACCTCCCTCCTGGAGGGG - Intronic
1033266795 7:139894088-139894110 GCCCCAGCGCCATTCTTGAGAGG + Intronic
1033870718 7:145751021-145751043 ATCCCACCGCCTTCCTGGAGAGG - Intergenic
1034105150 7:148483620-148483642 GCTCCAGCGCCTCCCTGGATTGG - Intergenic
1035469423 7:159100132-159100154 GCCCCACCGCCCTCCCTGAGTGG - Intronic
1037835308 8:22211921-22211943 GCCCCAGCCCCTTGCTGGTGGGG - Exonic
1040305656 8:46210503-46210525 GCCCCAGCGCCGTCCCGGACAGG + Intergenic
1040326007 8:46341920-46341942 GCCCTAGGGCCATCCTGGGCCGG + Intergenic
1042303565 8:67310948-67310970 GCCCCACCTCCCTCCTGGACGGG - Intronic
1049405703 8:142451046-142451068 GCCCCCGCCCCCTCCTGGGGAGG + Intronic
1049734897 8:144199659-144199681 CCCTCATAGCCATCCTGGAGGGG + Intronic
1049799571 8:144511584-144511606 GCCCCAGCCCCAGCCTGCAGCGG + Intronic
1049799591 8:144511637-144511659 CCCCCAGCCCCAGCCTGCAGCGG + Intronic
1051817989 9:21132181-21132203 GTCCCAGGGCCAACATGGAGAGG + Intergenic
1056949758 9:91032666-91032688 ACCCCAGGGCCAGCCTGGAGTGG + Intergenic
1057257950 9:93566590-93566612 GCGCCAGCCCCTCCCTGGAGCGG - Intergenic
1057293050 9:93819265-93819287 GGCCCAGCGCCACCCGGAAGGGG - Intergenic
1057305969 9:93912214-93912236 GCCCCAGCCCCATCCTGGCCTGG - Intergenic
1057845414 9:98518826-98518848 GAGCCAGCCCCATCCTGTAGAGG + Intronic
1057941570 9:99289625-99289647 CTCTCAGCCCCATCCTGGAGGGG + Intergenic
1059467632 9:114478949-114478971 GTCCCACCCCCATCCTGAAGTGG + Intronic
1061231949 9:129320401-129320423 GCCTCAGCCCCGCCCTGGAGTGG - Intergenic
1061297066 9:129682519-129682541 GCCCCAGCCCCACCCTGGGGCGG + Intronic
1061642864 9:131973307-131973329 GACCCAGAGTTATCCTGGAGGGG - Intronic
1061767289 9:132889363-132889385 ACCCCCACTCCATCCTGGAGGGG - Intronic
1061941666 9:133887247-133887269 CCCCCACCCCCATCCTGGGGTGG - Intronic
1062303451 9:135888771-135888793 GCCCCAGCTCCATCCTGGAGAGG + Intronic
1062454713 9:136630045-136630067 GCCCAAGACCCATCCTGGACTGG + Intergenic
1062726109 9:138074612-138074634 TGCCCAGGGCCATCCTGGTGTGG + Intronic
1062735789 9:138136742-138136764 GCCCAGGCCCCATCCTGCAGGGG - Intergenic
1190937438 X:55009286-55009308 GCCACAGACACATCCTGGAGGGG + Exonic
1191778527 X:64843976-64843998 GCCCCTGCAACCTCCTGGAGGGG - Intergenic
1194066825 X:89271350-89271372 GACCCAGCCCCAGCCTGGAGGGG + Intergenic
1200398006 X:156002533-156002555 GCCCAGGCCCCATCCTGCAGGGG - Intronic
1200428245 Y:3046068-3046090 GCCCTAGCCCCATCCAGGTGGGG - Intergenic
1200720991 Y:6605509-6605531 GACCCAGCCCCAGCCTGGAGAGG + Intergenic
1200836776 Y:7740054-7740076 GCCACATGGCCATCCTGCAGTGG + Intergenic
1200985821 Y:9303179-9303201 GCCCCTGTGCCATCCAGGCGGGG - Intergenic