ID: 1147160967

View in Genome Browser
Species Human (GRCh38)
Location 17:38569255-38569277
Sequence GAGCTGCCCTGGGGCCGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 414}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147160953_1147160967 26 Left 1147160953 17:38569206-38569228 CCTTCCCTAGAGACCAGAAGGCC 0: 1
1: 0
2: 1
3: 17
4: 156
Right 1147160967 17:38569255-38569277 GAGCTGCCCTGGGGCCGGGTTGG 0: 1
1: 0
2: 2
3: 44
4: 414
1147160951_1147160967 30 Left 1147160951 17:38569202-38569224 CCTTCCTTCCCTAGAGACCAGAA 0: 1
1: 0
2: 2
3: 22
4: 283
Right 1147160967 17:38569255-38569277 GAGCTGCCCTGGGGCCGGGTTGG 0: 1
1: 0
2: 2
3: 44
4: 414
1147160954_1147160967 22 Left 1147160954 17:38569210-38569232 CCCTAGAGACCAGAAGGCCCTTC 0: 1
1: 0
2: 1
3: 12
4: 148
Right 1147160967 17:38569255-38569277 GAGCTGCCCTGGGGCCGGGTTGG 0: 1
1: 0
2: 2
3: 44
4: 414
1147160957_1147160967 13 Left 1147160957 17:38569219-38569241 CCAGAAGGCCCTTCCAGATGGCT 0: 1
1: 0
2: 4
3: 21
4: 210
Right 1147160967 17:38569255-38569277 GAGCTGCCCTGGGGCCGGGTTGG 0: 1
1: 0
2: 2
3: 44
4: 414
1147160958_1147160967 5 Left 1147160958 17:38569227-38569249 CCCTTCCAGATGGCTTAGTACAA 0: 1
1: 0
2: 1
3: 11
4: 119
Right 1147160967 17:38569255-38569277 GAGCTGCCCTGGGGCCGGGTTGG 0: 1
1: 0
2: 2
3: 44
4: 414
1147160955_1147160967 21 Left 1147160955 17:38569211-38569233 CCTAGAGACCAGAAGGCCCTTCC 0: 1
1: 1
2: 2
3: 25
4: 204
Right 1147160967 17:38569255-38569277 GAGCTGCCCTGGGGCCGGGTTGG 0: 1
1: 0
2: 2
3: 44
4: 414
1147160961_1147160967 0 Left 1147160961 17:38569232-38569254 CCAGATGGCTTAGTACAAGGAAA 0: 1
1: 0
2: 0
3: 11
4: 133
Right 1147160967 17:38569255-38569277 GAGCTGCCCTGGGGCCGGGTTGG 0: 1
1: 0
2: 2
3: 44
4: 414
1147160959_1147160967 4 Left 1147160959 17:38569228-38569250 CCTTCCAGATGGCTTAGTACAAG 0: 1
1: 0
2: 0
3: 7
4: 89
Right 1147160967 17:38569255-38569277 GAGCTGCCCTGGGGCCGGGTTGG 0: 1
1: 0
2: 2
3: 44
4: 414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147160967 Original CRISPR GAGCTGCCCTGGGGCCGGGT TGG Intronic
900119809 1:1043737-1043759 GTGAGGCCCTGGGGCCGGGCGGG + Intronic
900124651 1:1064051-1064073 GAGCAGCTCTGGGGCCCGGGTGG + Intergenic
900126909 1:1072791-1072813 GAGCAGGCCTGGGGCCCTGTGGG - Intronic
900138219 1:1127773-1127795 GAGTTTCGCTGGGGCCGGCTTGG - Intergenic
900176794 1:1294665-1294687 GGGCTGCCCAGGGGCTGGGCAGG + Intronic
900243733 1:1628474-1628496 CAGCGGCCCTGGGGAGGGGTGGG - Exonic
900339164 1:2179729-2179751 CAGCAGCCCTGGGCCCGGGGTGG - Intronic
900391876 1:2437114-2437136 GTGTTGCCCTGGGGCCCAGTGGG + Intronic
900436974 1:2635422-2635444 CAGCAGCCCTGGGGCCAGGGTGG + Intergenic
900577259 1:3389488-3389510 GAGGTCCCCTGGGGCCAGGAGGG - Intronic
900635481 1:3662808-3662830 GGTCTGTCCTGGGGCCTGGTGGG - Intronic
900720387 1:4172179-4172201 GAGCTGCCCTGGTTGGGGGTAGG - Intergenic
900935936 1:5766419-5766441 GGGCTGCCCTGGGGAGGGTTGGG - Intergenic
900988417 1:6086520-6086542 GAGCAGCCCGGGACCCGGGTGGG + Intronic
901055055 1:6445471-6445493 GTGCTGGGCTGGGGCAGGGTAGG + Intronic
901453232 1:9348845-9348867 GAGCAGCCATGGGACGGGGTGGG - Intronic
901623140 1:10605225-10605247 GAGCTGCCCTGGTGGTCGGTCGG + Intronic
901854747 1:12037564-12037586 GAGCTTCCCTGCTGCTGGGTGGG + Intergenic
902448650 1:16483604-16483626 GACCTGGCCTGGGGCAGGATAGG + Intergenic
902468031 1:16630260-16630282 GACCTGCCCTGGGGCAGGATAGG + Intergenic
902506128 1:16939756-16939778 GACCTGGCCTGGGGCAGGATAGG - Intronic
902513522 1:16978507-16978529 GATCAGCCCTGGAGCTGGGTTGG - Intronic
902874323 1:19331789-19331811 GTCCTGAACTGGGGCCGGGTGGG + Intergenic
902941742 1:19805044-19805066 GAGCTCCCCTGGGGAGGGATTGG + Intergenic
902974403 1:20078550-20078572 GAGCTGCCCTTGTGGCTGGTGGG - Intronic
903415963 1:23183301-23183323 GGGCTGCCCTGGGGCCAGAGAGG - Intergenic
904034617 1:27551976-27551998 GGGCTGGCAGGGGGCCGGGTGGG + Exonic
905036036 1:34918850-34918872 CAGATCCCCTGGGGCAGGGTGGG - Intronic
905665411 1:39760624-39760646 GAGCTGGGGTGGGGCTGGGTGGG - Intronic
905746855 1:40425450-40425472 GAGCTGACCTAGGGCCGTGGTGG + Intergenic
906638070 1:47423445-47423467 GAGGGGCCCTGGGGTGGGGTAGG + Intergenic
906657534 1:47559446-47559468 GAGCTGCCCTTGGGCAGTGGGGG + Intergenic
906690712 1:47791139-47791161 GAGCTGGGCTGGGTCGGGGTTGG + Intronic
907364220 1:53946149-53946171 GAGCTGAGCTGGGGGAGGGTAGG - Exonic
909783974 1:79586405-79586427 GCACGGCCCTGGGGCAGGGTCGG + Intergenic
910232244 1:84998230-84998252 GAGTTGCCCTGCGCCCGCGTCGG + Intergenic
911039309 1:93579407-93579429 GCCCTGCCCTGGGGCTGGGTGGG + Intronic
912456645 1:109802663-109802685 CAGCTGCCCTGGAGCCCAGTGGG + Intergenic
915901999 1:159854405-159854427 GAGGGCCCCGGGGGCCGGGTGGG - Exonic
916647232 1:166797765-166797787 GACCTGCACAGGGGCCGGGTGGG + Intergenic
916651725 1:166839767-166839789 CAGGTGCGCTGGGGCCGGGAGGG + Intronic
917479934 1:175403302-175403324 GAGGTGCCCTGGGGACTGTTCGG - Exonic
917944523 1:179955046-179955068 GGGCAGCCCTGGGGCCGGTCGGG + Exonic
920506954 1:206521916-206521938 GAGCAGGCCTGGGGCCGAGAGGG + Intronic
920517834 1:206599683-206599705 CAGGTGCCCTGGGGCCAGCTGGG + Intronic
922160861 1:223078349-223078371 TAGCTGCCCTGGGGAGGGGATGG + Intergenic
922573430 1:226646844-226646866 GAGCTGCCCTTGGTTCAGGTGGG - Intronic
923916498 1:238511703-238511725 GAGTAACCCTGGGGCAGGGTTGG + Intergenic
924268992 1:242312775-242312797 ATGCTGCCTTGGGGCAGGGTGGG + Intronic
1062829845 10:598230-598252 GAGCTGCCCTTGGGGTGGGGAGG - Intronic
1064727638 10:18297652-18297674 GAGCAGCCCTGGGCTCAGGTTGG - Intronic
1065530593 10:26666040-26666062 CAGCGCCCCTGGGGCAGGGTGGG - Intergenic
1066715916 10:38285995-38286017 ATGCTGCCTTGGGGCGGGGTGGG - Intergenic
1067768695 10:49108460-49108482 GAGCCGCCCTGGAGCAGGGCAGG + Intronic
1069426388 10:68292121-68292143 GAGCTGACCTGGGGGTGGGCTGG + Exonic
1069903165 10:71717384-71717406 GAGCTGCTCTGGGAACAGGTGGG + Intronic
1070810076 10:79293217-79293239 CTGCTCCCCTGGGGCCTGGTTGG + Intronic
1070890294 10:79937954-79937976 GGGCTCCCCTGGGGCCCAGTTGG + Exonic
1072861172 10:99006942-99006964 GAGCTGGCCTGGGGCTAGGTGGG + Intronic
1073566942 10:104543129-104543151 AAGCTGCCCAGGGGCCAGGTAGG + Intergenic
1074188321 10:111115449-111115471 GAGCTGCCCTGGAGCAGGACTGG + Intergenic
1074427770 10:113367377-113367399 GTGCTGTCCAGGTGCCGGGTTGG + Intergenic
1075810804 10:125223337-125223359 GAGTTGCTCTGGGGCAAGGTAGG + Intergenic
1075975126 10:126687916-126687938 GTGCTTCCCTGGGGGCGGGGTGG - Intergenic
1076418196 10:130307588-130307610 CTGCTGCCCTGGGGGCGTGTGGG - Intergenic
1076586594 10:131552729-131552751 GAGGTGCACTGGGGCAGGGGAGG - Intergenic
1076701428 10:132275233-132275255 GAGTAGCCATGGGGCCTGGTGGG - Intronic
1076887990 10:133271315-133271337 AGGCTGCACTGGGGCCGGGCTGG + Intronic
1077089768 11:773132-773154 CAGCTGCCCCGGCTCCGGGTTGG - Intronic
1077180136 11:1208570-1208592 CAGGGGCCCTGGGGCCAGGTGGG + Intergenic
1077315690 11:1918462-1918484 ACAGTGCCCTGGGGCCGGGTCGG - Intergenic
1077413463 11:2414014-2414036 GAGCTGCCAGGGGGTGGGGTGGG - Intronic
1077895116 11:6448358-6448380 TATCTGCCCTGGGGCTGGGAAGG - Intergenic
1078142089 11:8700055-8700077 GAGCTGGCCTGGGGGGGGGCAGG + Intronic
1079077997 11:17395565-17395587 GAGCCGGCCTGGGGCTGGGTGGG + Intronic
1079296905 11:19241949-19241971 GAGCCGGCCTGGGGCTGGGCAGG - Intergenic
1081534213 11:43985551-43985573 GTGCTGTCCTGGGGCCTGGTGGG - Intergenic
1081906647 11:46674565-46674587 GACCTGCACTGGGGCAGGGGTGG - Intronic
1083307085 11:61766795-61766817 GAGCTGCCCTGGAGTCTGGCTGG - Intronic
1083610692 11:64002851-64002873 CAGCTGCCTTGGGGTGGGGTGGG - Intronic
1083912634 11:65719235-65719257 GAGCTGCAGTGGGGGCGGGGTGG - Exonic
1083926773 11:65812068-65812090 GAGCTCTCCTGGGAACGGGTTGG + Intergenic
1084087177 11:66860016-66860038 CAGCTGCGCTGCGGCCGGGGCGG - Exonic
1084474482 11:69381052-69381074 GCCCTGCCCTGGGGCCGGCCTGG + Intergenic
1084746212 11:71171635-71171657 GATCTGCCCTGGGTATGGGTGGG - Intronic
1084758014 11:71251547-71251569 GAGCTGCCCGGCCGCCGGGGAGG + Intronic
1085054806 11:73397388-73397410 ATGCGGCCCTTGGGCCGGGTTGG - Exonic
1085689980 11:78656812-78656834 GAGCTGGACTGGGGCAGGCTGGG - Exonic
1088816201 11:113422718-113422740 GAGCTCCCTTGGGCCCGGGGTGG + Intronic
1088912374 11:114201369-114201391 GAGCAACCCTGGGCCCGGCTTGG - Intronic
1089286441 11:117410897-117410919 GAGCCTCCCTGGGGGCTGGTTGG + Intronic
1089786861 11:120913775-120913797 GAGCTTCCCAGAGGCCTGGTGGG + Intronic
1091353638 11:134916958-134916980 GAGCAGCTCTGGGGCCTGGGAGG + Intergenic
1091650308 12:2304420-2304442 GATCTGCCTCGGTGCCGGGTTGG - Intronic
1092185796 12:6477702-6477724 GGGCTGCCATGGGGCCGGTGGGG - Intergenic
1092206672 12:6618739-6618761 CAGCAGCCCTGGGGCAGGGATGG - Intergenic
1093756962 12:22863299-22863321 GAGCTACCCTGTGGCCAGGGAGG + Intergenic
1094458212 12:30662874-30662896 GAGATGGCCTGGGGCAGGGAAGG - Intronic
1094703906 12:32896722-32896744 GGGCTGCCATGGGGCCGGTGGGG + Exonic
1095965431 12:47864091-47864113 GTTCTGTCCTAGGGCCGGGTGGG + Intronic
1096714667 12:53483826-53483848 CACCCGCCCTGGGGCTGGGTAGG + Intronic
1100913415 12:99390826-99390848 GGACTGCCCTGGGGCCAGCTTGG + Intronic
1101167408 12:102052625-102052647 GAGCTGACCTGGTGCTGGGGTGG - Intronic
1102039386 12:109791036-109791058 GTGCTGCCCTGGGCCAGGTTTGG - Intronic
1103272586 12:119686366-119686388 AATCTGCCCTGGGGACGGGAGGG + Exonic
1103411033 12:120711170-120711192 GGGCTGCCATGGGGCCAGGGCGG - Intronic
1103949832 12:124544635-124544657 GACCTACCCTGGGCCCGGGCGGG - Intronic
1104001633 12:124863970-124863992 GAGCGGGCCCGGGGCGGGGTCGG + Intronic
1104373868 12:128247350-128247372 GCGCTGCCCTGGGGCAGTGAGGG + Intergenic
1104801630 12:131558652-131558674 CAGCTACCCTGGGGCCAGGGAGG - Intergenic
1104846240 12:131848567-131848589 GGGCTGCCCAGGGGCGGGGCGGG - Intronic
1104858529 12:131913002-131913024 GAGCTGGCCTGGGGCTGGCAGGG + Intronic
1106036980 13:26051987-26052009 GAGCTGGTCTGGCGCCGGGCGGG - Intergenic
1108431702 13:50360136-50360158 GTGCTGCCCTTGGGCTGGGCTGG - Intronic
1108594884 13:51940877-51940899 GAGCTGCTCTGGGGCCAAGATGG + Intronic
1112431953 13:99358057-99358079 GAGCTGTCCTGGGGAAGGGATGG + Intronic
1113668661 13:112159998-112160020 GAGCTGCTCTGTGGCCAGGGTGG - Intergenic
1113857248 13:113454187-113454209 GAGCTGACCGAGGGCCGGATGGG - Intergenic
1113857271 13:113454336-113454358 GAACTGTCCTGGGGTGGGGTCGG - Intergenic
1115145846 14:30224808-30224830 GAGGTGCTCTGGGGCCAAGTAGG - Intergenic
1115770673 14:36662051-36662073 GTGCGGAACTGGGGCCGGGTTGG + Exonic
1116864897 14:50024079-50024101 GAGCTGAGCTGGGGCAGTGTGGG - Intergenic
1118729968 14:68659224-68659246 GTGAGGCCCTGGGGCCGGCTGGG + Intronic
1118854524 14:69611077-69611099 AAGCTGCCCGGGGGGTGGGTGGG - Intergenic
1121050664 14:90816940-90816962 GCGGTTCCCTGGGGCCCGGTTGG + Intergenic
1121511166 14:94514519-94514541 GAGCAGGGCTGGGGTCGGGTGGG + Intronic
1122548920 14:102539593-102539615 GAGCTGCTCAGGGGCCACGTAGG - Intergenic
1122660360 14:103290797-103290819 GTGCTGCCCGGGGGCCGGGGTGG + Intergenic
1122805022 14:104252223-104252245 CAGCTGCCCTGGGGCCTGCTGGG + Intergenic
1122848219 14:104512402-104512424 GAGATGCCCTGGGGAGTGGTGGG + Intronic
1122943439 14:104993868-104993890 GTACTGCCCTGTGGCCTGGTAGG + Intronic
1123035352 14:105469694-105469716 GGGCTGCCCTGGGCCAGGCTGGG + Intronic
1123059774 14:105589268-105589290 GAGCTGCCCTGGGGTGGGCTGGG - Intergenic
1123084748 14:105712259-105712281 GAGCTGCCCTGGGCTGGGCTGGG - Intergenic
1123683003 15:22775921-22775943 GAGGGGACCTGGGGCTGGGTTGG + Intronic
1123763034 15:23447044-23447066 GAGGGGGCCTGGGGCTGGGTTGG + Intronic
1123945626 15:25237507-25237529 GGGCGGCCCTGGGGTCGTGTGGG + Intergenic
1124334753 15:28848445-28848467 GAGGGGACCTGGGGCTGGGTTGG + Intergenic
1126738088 15:51751715-51751737 GAGCGCCCCGGGGGGCGGGTGGG + Intronic
1126781115 15:52139835-52139857 GTGTTGCCCCGGGGCAGGGTTGG - Intronic
1127900735 15:63339052-63339074 CAGCTTCTGTGGGGCCGGGTGGG + Intronic
1129742869 15:77998433-77998455 CAGGTGGCCTGGGGCAGGGTGGG + Intronic
1129842602 15:78753013-78753035 CAGGTGGCCTGGGGCAGGGTGGG - Intergenic
1130868030 15:87948794-87948816 TTGCTGCCCTGGGACCAGGTTGG + Intronic
1131376687 15:91930233-91930255 GAGCTGACCTGTGGCAGGGAGGG - Intronic
1132554416 16:566286-566308 TAGCTGCCCCGAGGCAGGGTCGG - Intergenic
1132597826 16:761372-761394 GAGCTGGGCTGGGGCCGTGGAGG - Intronic
1132779528 16:1614844-1614866 GGGCTGCCCTGCGGCGGGGACGG - Exonic
1133038939 16:3049706-3049728 CAGCTTCCCTGGGCCCTGGTGGG - Intronic
1133304927 16:4802707-4802729 GAGCCGGCCTGGGGGCGGGGTGG - Exonic
1134163869 16:11915271-11915293 GCGCGGCCCTGGGGCCCGGTCGG - Intronic
1134231969 16:12436573-12436595 GAGCTCCCCTGGTGCCTGGAAGG + Intronic
1135401971 16:22172174-22172196 GTGCAGCCCTGGGGCTGGGCAGG + Intronic
1135822989 16:25701263-25701285 GAGATGCCTTGGGCCCAGGTTGG + Intronic
1135952746 16:26930589-26930611 GAGGTGCCTTGAGGCAGGGTAGG - Intergenic
1136188239 16:28600698-28600720 GCGGTGCCCTGGGGCCGGGGAGG + Intergenic
1136190711 16:28613692-28613714 GCGGTGCCCTGGGGCCGGGGAGG + Intronic
1137237325 16:46626388-46626410 GTGCTGACCAGGGGCCGGGCCGG - Intergenic
1137988442 16:53130412-53130434 GAGCTGACCAGTGGCGGGGTCGG - Intronic
1138124916 16:54430743-54430765 GAGCTGCCTTTGTGCCCGGTGGG - Intergenic
1138134849 16:54512642-54512664 AAGCTGCCCAGGAGCCGGGCCGG + Intergenic
1138172396 16:54865195-54865217 GTACTGCCATGGGGCAGGGTGGG - Intergenic
1138347923 16:56331326-56331348 AAGGTGCTCTGGGGCCTGGTTGG + Intronic
1138441260 16:57036444-57036466 TAGCTGCCCTGGAGCACGGTGGG + Intronic
1138563122 16:57813899-57813921 GATCTACCCTGGCACCGGGTAGG + Intronic
1139364537 16:66425808-66425830 GGGCTTCCCTGGGGCCAGGCAGG - Intergenic
1139421808 16:66853678-66853700 CAGCTGCCCTGGGGACAGGAAGG + Exonic
1139491778 16:67289815-67289837 GAGATGCCCTGGGGCAGAGCTGG - Intronic
1139692493 16:68650146-68650168 GGCCTGCCCAGGGGCCCGGTGGG - Intronic
1139732804 16:68961346-68961368 GAGCTGCCATGTGGCGGGGCAGG - Intronic
1139806086 16:69566268-69566290 CCGCTGCCCTCGGGCCGGGCTGG + Exonic
1139923274 16:70472677-70472699 GTGCTGCTCTGGGGCAGGGGAGG - Intronic
1141569978 16:84928467-84928489 GAGCTGCGATGGGCCAGGGTGGG - Intergenic
1141644569 16:85360352-85360374 CCCCTGCCCTGCGGCCGGGTGGG + Intergenic
1141675308 16:85514429-85514451 GAGCTGCCCTGGGGTGGGGGGGG - Intergenic
1141701299 16:85643438-85643460 GAGCTTCTCTGGGGCAGGGCAGG - Intronic
1141891621 16:86930176-86930198 GAGCAGCCCTGGGCCAGGGACGG + Intergenic
1142105574 16:88300688-88300710 GAGCTCCCCAGGGGCTGGGTGGG - Intergenic
1142848828 17:2694670-2694692 GAGGCTCCCGGGGGCCGGGTGGG - Intronic
1143866706 17:9928807-9928829 GACCTGGGCTGGGGCTGGGTGGG + Intronic
1144781712 17:17811658-17811680 GAGATGACCAGGGGCCGGGATGG + Intronic
1144855057 17:18262933-18262955 GAGGGGCCCTGGGGAGGGGTGGG + Intronic
1145241325 17:21242438-21242460 GAGATGCCTTGGGGCTGGGGTGG - Exonic
1145265249 17:21376790-21376812 GAGCTGCCCTGAGGCGGTGGCGG + Exonic
1145269576 17:21397534-21397556 GAGCTGGCCTGGGGACGGGAAGG + Intronic
1145286044 17:21506591-21506613 TTGCTGGCCGGGGGCCGGGTAGG + Intergenic
1145391562 17:22459700-22459722 TTGCTGGCCGGGGGCCGGGTAGG - Intergenic
1147160967 17:38569255-38569277 GAGCTGCCCTGGGGCCGGGTTGG + Intronic
1147327162 17:39675045-39675067 TGGCTCCCCTGGGCCCGGGTGGG - Intronic
1147420258 17:40318908-40318930 GAGCCGGCCGGGGGCCGGGCCGG + Intronic
1147747271 17:42702508-42702530 GTGCTGCCGTGGGGCCTGGGAGG + Exonic
1147931601 17:43984577-43984599 CAGCTGGCCAGTGGCCGGGTAGG + Intronic
1148200061 17:45744223-45744245 GAGCTGATCAGGGGCCTGGTAGG - Intergenic
1148243320 17:46014012-46014034 CAGCTCCCCTGGGGCAGGGTTGG + Intronic
1149554034 17:57560369-57560391 GAGGAGCCCTGGAGCGGGGTTGG + Intronic
1150075465 17:62188301-62188323 AAGCTGCCCTGGGTCAGGCTCGG + Intergenic
1150294899 17:64002355-64002377 GAGGTCTCCTGGGGCCAGGTGGG + Exonic
1150327394 17:64268144-64268166 GAGTAGCCCTGGGCCAGGGTAGG + Intergenic
1151232246 17:72693426-72693448 CAGCTGCCTTGATGCCGGGTAGG + Intronic
1151419982 17:73990855-73990877 GAGGTGCCCAGGGGGCAGGTGGG - Intergenic
1151511462 17:74563101-74563123 GCCCTGCTCTGGGGCCGGGTGGG + Intergenic
1151529489 17:74695439-74695461 GTGCTGCACTGGTGCAGGGTTGG - Intronic
1151718888 17:75844726-75844748 AAGCTGACCTGGGCCCGGGGGGG + Intergenic
1152068694 17:78124854-78124876 GGTCTGCCCTGGGGCTGGGGCGG - Intronic
1152206189 17:78975960-78975982 GAGCTGCCTTCGGGCAAGGTAGG - Exonic
1152562644 17:81086215-81086237 GAGCTGCTATGGGGTTGGGTGGG + Intronic
1152609905 17:81310300-81310322 CAGCTGCGCAGGGGCCGGGGCGG + Intergenic
1152745453 17:82036696-82036718 GAGCTGCCCTGTGGGCTGGACGG - Intronic
1152925742 17:83086998-83087020 GAGCTGCCTTGGGGTCCTGTGGG + Intronic
1153714962 18:7838758-7838780 GAGCTCCCCTAGGCCCAGGTAGG + Intronic
1153769890 18:8407126-8407148 GGCCTGCCCTGGTGCCGGGGAGG + Intergenic
1153774287 18:8439168-8439190 AAGCTGCCCTGGGGCATGCTGGG - Intergenic
1153969431 18:10212045-10212067 GAGCTGGCATGGAGACGGGTTGG - Intergenic
1154217188 18:12423761-12423783 GAGCTGCCCAGGTACCGGTTCGG - Intronic
1156431779 18:37082461-37082483 GAAATTCCCTGGGGCCGGGCGGG - Intronic
1157623119 18:49027305-49027327 GAGCTGGGCTGGGGCTGGATTGG + Intergenic
1157709670 18:49841559-49841581 GAGCAGCCCTGAGGCTGGGCAGG + Intronic
1157752935 18:50194726-50194748 GAGGCGCCCCGGGGCCGGGGTGG - Intronic
1158440083 18:57467794-57467816 GAGCTGCCCGGAGTCCGGGAAGG - Intronic
1158560231 18:58507298-58507320 CAGCTGCCCTGGGGTAGGGATGG + Intronic
1160864621 19:1251230-1251252 GGGCTGCCCTGGGGTCGTGGGGG + Intronic
1160865900 19:1255785-1255807 GACCTGCCCAGGGGCTGGGGGGG + Intronic
1161041427 19:2112757-2112779 GGGCTGCCCTGGGACCTGGGTGG + Intronic
1161221560 19:3120381-3120403 GGGCTGCTCTGGGGACTGGTGGG - Intronic
1161427651 19:4212719-4212741 GGGCTGGGCTGGGGCTGGGTCGG + Intronic
1161766783 19:6212838-6212860 CAGGAGCCCTGGGGCCGGGCTGG - Intergenic
1161816052 19:6500882-6500904 GAGCTGCACTGGGGCAGAGAGGG + Intronic
1161831098 19:6605123-6605145 GAGCTACCCAGGGGCCAGGCAGG - Intergenic
1162394027 19:10405605-10405627 GAGCTGCGGTGGGGCCCGGCAGG + Intronic
1162411764 19:10510447-10510469 GATGGGCCCTGGGGCCGGGTTGG - Intergenic
1162479698 19:10921171-10921193 GGACTGCCCAGGGGCCGGGAAGG + Intronic
1162765908 19:12919301-12919323 CAGCTGGCCAGGGGCGGGGTCGG - Intergenic
1162925836 19:13930157-13930179 GAGCTGGTCGCGGGCCGGGTGGG + Intronic
1163714173 19:18864380-18864402 GAGATGCCCTAGGGGCGGGGAGG - Intronic
1164599149 19:29549361-29549383 GAGCTCCCCTGGGGCAGCATGGG - Intronic
1165459565 19:35936595-35936617 GGGCAGCCCCAGGGCCGGGTGGG - Intronic
1165805442 19:38578021-38578043 CAGCAGCCCTGGCGGCGGGTTGG - Exonic
1166128236 19:40729425-40729447 GGGCAGCCCTGGGGCAGGGATGG + Intronic
1166253387 19:41586159-41586181 CAGCTGCCCTGGTGCTGGGTAGG - Intronic
1166423051 19:42653244-42653266 GAGCTGCCCAGGGACCCTGTAGG - Intronic
1166730805 19:45058007-45058029 GGTGTGCCCTGGGGCGGGGTAGG - Intronic
1166740692 19:45113147-45113169 GAGCTCCCAGAGGGCCGGGTGGG - Intronic
1167243989 19:48363186-48363208 GAGCTGCCCTGGCGCCTCCTGGG - Intronic
1167277012 19:48545004-48545026 GAGCTGGGCTGGGGCTGGGCTGG - Intergenic
1167304070 19:48696786-48696808 GAGCTGCCCGGGGCACGGGGCGG + Intronic
1167359654 19:49023411-49023433 GAGCTGCCCGGGGCCGGGGCAGG - Intronic
1167361477 19:49032674-49032696 GAGCTGCCCGGGGCCGGGGCAGG + Intronic
1167362177 19:49036111-49036133 GAGCTGCCCGGGGCCAGGGCAGG - Intronic
1167363906 19:49044747-49044769 GAGCTGCCCGGGGCCCGGGCAGG + Intronic
1167364591 19:49048180-49048202 GAGCTGCCCGGGGCCGGGGCAGG - Intronic
1167365877 19:49054816-49054838 GAGCTGCCCGGGGCCCGGGCAGG - Intronic
1167418822 19:49390887-49390909 GACCTGCCCGAGGGCCCGGTGGG + Exonic
1167466914 19:49654873-49654895 GAGCTGGCCTGGGGAGAGGTGGG + Intronic
1167744035 19:51340603-51340625 GAGCTGAGCTGGAGCCGGGACGG - Exonic
1168102108 19:54146780-54146802 GTGCTGCCCTGAGGGCAGGTGGG + Intronic
1168155384 19:54471382-54471404 GAGCTGCGGTGCAGCCGGGTCGG + Intronic
925166410 2:1718640-1718662 GTGCTGCCCTGTGGCAGGTTTGG - Intronic
925385539 2:3459461-3459483 GAGCTGCCCTGGGGGGAGGGTGG - Intronic
925913576 2:8588595-8588617 GGGCTGCTCTGGGGCAGGGAGGG - Intergenic
926740048 2:16103136-16103158 GGGCTGCTCTGGGGCCGAGGTGG + Intergenic
928201280 2:29249251-29249273 GAGTTGCCCTGGGCAGGGGTAGG + Intronic
928323185 2:30300149-30300171 GAGCTGGGCTGGGGCCGGGAGGG - Intronic
929532443 2:42761564-42761586 GAGCTGCCCTGAGCCCAGGTGGG + Intergenic
932824076 2:74924582-74924604 CAGCGGGCCTGGGGCAGGGTTGG - Intergenic
933001157 2:76925266-76925288 GAACTGCCCAGGGAGCGGGTTGG + Intronic
933791784 2:85888952-85888974 GAGCGGCGCTGGGGGCGGGTGGG - Exonic
933980166 2:87542874-87542896 CAGCTGCCCTGGGGGCAGGGAGG + Intergenic
934553531 2:95276138-95276160 GCGCTGCCCAGGGCCCGGGTAGG + Intronic
934885967 2:98025295-98025317 CAGCTTCCCTGGGGTGGGGTGGG - Intergenic
934913629 2:98280469-98280491 GTGCTGCCCTGGGGTCAGGGAGG + Intronic
935592913 2:104857130-104857152 GAGCGGCCCAGGTGCAGGGTCGG - Exonic
936313661 2:111407917-111407939 CAGCTGCCCTGGGGGCAGGGAGG - Intergenic
936574779 2:113643975-113643997 GAGCTTCCCTGGGACGGGGTGGG - Intergenic
937093570 2:119222486-119222508 GTGTTGCCCTGGGGCAAGGTGGG + Intergenic
937286735 2:120758703-120758725 GAGCTGCCCTTGGGCCTCCTTGG + Intronic
937956261 2:127423205-127423227 GGGCGGGGCTGGGGCCGGGTTGG + Intronic
939623942 2:144453352-144453374 GACCTGCCCTGGGTCCAAGTGGG - Intronic
942222115 2:173780507-173780529 GGGCTGCCCGGGGGAGGGGTGGG + Intergenic
944373388 2:199011867-199011889 GAGCTGCCTTGGAACTGGGTGGG + Intergenic
945327263 2:208496763-208496785 GAGCTCCACTGTGGCCAGGTGGG + Intronic
946191870 2:218011717-218011739 GAGCTGCAATGGGGACGGGCAGG - Intergenic
946253204 2:218425939-218425961 GAGGTGACCTGGGGCGGGGAAGG + Intronic
947165719 2:227259843-227259865 GAGCTCCTCTGGGCCCTGGTGGG - Exonic
947651024 2:231786404-231786426 GAGCTGCACGGGCGACGGGTCGG + Intronic
948040918 2:234900845-234900867 GAGCTGCCCAGGGCGAGGGTGGG - Intergenic
948460398 2:238127470-238127492 GAGGTGTTCTGGGGCAGGGTGGG + Intronic
948606394 2:239138631-239138653 GTGGTGCCCTGGGCCTGGGTGGG - Intronic
948608803 2:239154117-239154139 GAACTGCTCTGGGGCCTGATGGG + Intronic
948873389 2:240815177-240815199 GAGCTGCTGTGGGGCTGGGGTGG - Intronic
1168785742 20:538685-538707 GAGCTGAGCTGGGGTGGGGTGGG + Intronic
1169059562 20:2652127-2652149 GAGCCTCCCCGGCGCCGGGTGGG - Exonic
1169488418 20:6052441-6052463 GCGCTGCGCTGGGGCCCGGGTGG - Exonic
1171194443 20:23186525-23186547 GAGCTGCCCTGGGTCCTGTGAGG + Intergenic
1172621148 20:36319507-36319529 GAGCTGCCCTGGGCTAGGCTAGG - Intronic
1174468019 20:50731950-50731972 GAGCTGCCCCGGGGTCTGGACGG + Intronic
1174738654 20:52990442-52990464 TAGCTGCCTTGGGGTGGGGTGGG + Intronic
1175264633 20:57695279-57695301 CAGCAGCTCTGGGGCTGGGTTGG - Intronic
1175402156 20:58707027-58707049 GGGCTAGCGTGGGGCCGGGTGGG + Intronic
1175806793 20:61834067-61834089 TGGCTGTCCTGGGGCCAGGTGGG + Intronic
1175820662 20:61907191-61907213 GAGCTGACCTGGTGCCCGGGGGG - Intronic
1175944147 20:62551005-62551027 GGGCACCCCTGGGGCCGGGCTGG - Exonic
1175992627 20:62797024-62797046 GGGCTGCCCTGGGGACTGGAGGG - Intronic
1176102175 20:63369611-63369633 GAGAGGCCCTGGGTCCGGGTGGG - Intronic
1176222265 20:63975307-63975329 GTCGTGCCCTGGGGCTGGGTGGG - Exonic
1176252895 20:64134050-64134072 GAGCTGCCTTGGGGGAGGGCCGG - Intergenic
1179780128 21:43694231-43694253 GAGCTGCCATGGAGCCGGTCAGG - Exonic
1179802615 21:43818032-43818054 GGGCTGCCCCGGGCCTGGGTGGG + Intergenic
1179928324 21:44550602-44550624 GAGCTGTGCTGAGGCTGGGTGGG + Exonic
1179939356 21:44628117-44628139 GAGCTGTGCTGAGGCTGGGTGGG - Exonic
1180179139 21:46110159-46110181 CCGCTGCCATGGGGCCGGGCCGG - Intronic
1180258566 21:46650871-46650893 GGGCTGCCCAGTGGCCGGATTGG + Intronic
1181011072 22:20040912-20040934 GTGCAGCCCTGGGGCCAGCTGGG + Intronic
1181275825 22:21686981-21687003 GAGCTGCACTGCGACCTGGTGGG + Exonic
1182060198 22:27391741-27391763 GTGCTGCTCTGGGGGCGGGGGGG + Intergenic
1182103712 22:27674343-27674365 GACCTTACCTGGGGCTGGGTGGG - Intergenic
1183339689 22:37273322-37273344 GCGCTGCCCTGGGGTGGGGTTGG + Intergenic
1183489445 22:38108833-38108855 GGGCTGCCCTGGGGCTGTGTGGG + Intronic
1183650826 22:39152459-39152481 GAGCGGGCCCGGGGCCGGGCCGG + Exonic
1183654440 22:39176639-39176661 GAGCTTCCCTGGGGAACGGTAGG - Intergenic
1183674536 22:39292117-39292139 GAGCTGCCGTGTGGCGGGGTGGG + Intergenic
1183687063 22:39367282-39367304 GCCCTGCCCTGGGGCCTGGGAGG - Intronic
1183709261 22:39492781-39492803 GAGCTTCCTCTGGGCCGGGTGGG + Intergenic
1184475019 22:44715629-44715651 GATCTGCCAGGGGGCGGGGTGGG + Intronic
1184497237 22:44849066-44849088 TAGCTGCCCTGGCGCAGGGGTGG + Intronic
1184561121 22:45263492-45263514 CAGCTCCCCTGGGGCCTGGGCGG + Intergenic
1184601826 22:45548513-45548535 GGGCTGCACTGGGGCCCGGGAGG - Intronic
1184948144 22:47818725-47818747 GAGCTGCACTGCGGCCAGGTGGG + Intergenic
1185035723 22:48475766-48475788 GGGCTGCCCTGGGCCTGTGTCGG - Intergenic
1185044923 22:48523988-48524010 AACCTGCCCCGGGGCCGGGCTGG + Intronic
1185223360 22:49640069-49640091 GTGCTGCCATGGGGACGGGTAGG + Intronic
1185223374 22:49640102-49640124 GGGCTGCCCTGGGGACGGGTCGG + Intronic
1185223388 22:49640135-49640157 GGGCTGCCGTGGGGACAGGTTGG + Intronic
1185379590 22:50502313-50502335 GAGCTGCCCAGGGGTCTGGCAGG + Intergenic
1185418391 22:50721834-50721856 GGGCTTCCCTGAGGCCGGGCTGG - Intergenic
1185425394 22:50766901-50766923 GAGCTTCCCTGGGACGGGGTGGG + Intergenic
950493925 3:13322455-13322477 GAGCCGCCCTGGGGCCCTGCTGG - Intronic
950669694 3:14518615-14518637 GAGCTGGCCTGGGGCGGTCTGGG - Intronic
952899422 3:38099761-38099783 GAGCAGACCGGGGGCGGGGTGGG + Intronic
953919562 3:46942698-46942720 GAGCTGCCCTGAGTTGGGGTGGG - Intronic
954301632 3:49703552-49703574 GAGCAGTTCTGGGGCCAGGTGGG + Intronic
955449241 3:59049788-59049810 GAGCTGACCAGGGGCCGGAGGGG - Intronic
957121299 3:76097283-76097305 GATCTGCACTGGGAACGGGTTGG - Intronic
959755175 3:109888720-109888742 GAGCTGCACTGAGACCTGGTGGG - Intergenic
960964867 3:123097750-123097772 GTGATGCCCTGGGGACAGGTAGG - Intronic
961358272 3:126352296-126352318 GAGGTGCCCAGGGCCCAGGTGGG - Exonic
961750444 3:129091080-129091102 GTGCTGACCAGGGGCCGGGCCGG - Exonic
964257579 3:154794600-154794622 GAGCAGCCCTTGGGCAGGGCAGG + Intergenic
968045901 3:195623868-195623890 GCTCAGCCCTGGGGGCGGGTGGG + Intergenic
968601734 4:1512951-1512973 GAGCTGTCCTGGGGCCCTGCTGG - Intergenic
968864586 4:3199846-3199868 GAGCAGCACCAGGGCCGGGTGGG - Exonic
969379136 4:6782876-6782898 GAGCAGCCCCTCGGCCGGGTGGG + Intronic
969641619 4:8402183-8402205 GCAAGGCCCTGGGGCCGGGTGGG + Intronic
969668309 4:8574981-8575003 GAGCAGCCAAGGGGCCCGGTTGG + Intronic
972045928 4:34664396-34664418 TACCTGCCCTGGTGCCGGGCTGG - Intergenic
975118621 4:70705354-70705376 GAGCTCCGCGGGGGCCGGGCCGG - Intronic
985573417 5:662675-662697 GAGCCGCGCTGGGGCCAGGGAGG + Exonic
985640335 5:1060688-1060710 CAGCTGCCCTTGTGCCCGGTCGG - Intronic
986059174 5:4171725-4171747 TAGGTGCCCTGGGGCCAGTTGGG + Intergenic
986393604 5:7306455-7306477 GAGGGGACCTGGGGCTGGGTTGG + Intergenic
987999353 5:25330118-25330140 GAGCTGGCCTGGGGCAGAGCCGG + Intergenic
988437613 5:31194150-31194172 GATCCGCCGTGGGGCTGGGTGGG + Intronic
990042376 5:51389935-51389957 GAGTGGCTCTGGGGCCGGGCAGG + Intronic
990355165 5:54959986-54960008 GAACTGGCCTGGGGGCTGGTGGG - Intergenic
993544936 5:89200177-89200199 GATCTGGCCTGGGGCTGGGTGGG + Intergenic
993666749 5:90707871-90707893 AAGCTGCCCTGGGGAGTGGTAGG + Intronic
994171247 5:96662135-96662157 GAGCAGTGCTGGGGCCGGGGCGG + Intronic
995395968 5:111687228-111687250 GGGCAGCGCTGGGGCAGGGTGGG + Intronic
999188861 5:149731694-149731716 CAGCTGTCATGGGACCGGGTGGG + Intronic
999260994 5:150238929-150238951 CAGGTGGCCAGGGGCCGGGTGGG + Intronic
1001839969 5:174867085-174867107 GCCCTGCCATGGGGCTGGGTGGG + Intergenic
1001984287 5:176060902-176060924 GAGCAGCGGTGGGGGCGGGTGGG + Intronic
1002074573 5:176700488-176700510 GAGCTGCGCTGGGGTGGGGGTGG + Intergenic
1002088834 5:176792799-176792821 GAGCTGCCCTGGGGATGGCCAGG + Intergenic
1002103325 5:176868115-176868137 GGGCAGCCCTGGGGGCGGGAGGG - Exonic
1002233189 5:177783163-177783185 GAGCAGCGGTGGGGGCGGGTGGG - Intronic
1002262790 5:178006618-178006640 GAGCAGCGGTGGGGGCGGGTGGG + Intronic
1002476330 5:179468675-179468697 GAGCTGAGCTGGGGCAGGGGTGG - Intergenic
1002685781 5:181008305-181008327 GAGCTGACCTGGAGCTTGGTTGG + Intergenic
1005666308 6:28060756-28060778 AAGCTGCCCAGTGGCTGGGTTGG + Intergenic
1005942504 6:30571368-30571390 GCGCAGCCCGGGGGCGGGGTTGG + Exonic
1006152998 6:31999203-31999225 GAGCTGCCCTGGGCCAGGGGAGG + Intronic
1006159306 6:32031940-32031962 GAGCTGCCCTGGGCCAGGGGAGG + Intronic
1006379478 6:33689176-33689198 GACCTGCTCTGGGGCCGTGGTGG + Intronic
1006472142 6:34235421-34235443 GCGCGGGCCTGGGGCCGGCTCGG - Intergenic
1006582352 6:35084263-35084285 GTGGGGTCCTGGGGCCGGGTGGG + Intronic
1006718563 6:36135693-36135715 GCTCTGACCTGGGGCTGGGTGGG + Intronic
1007165704 6:39827571-39827593 GAGGTGCCCCCGGGCCTGGTAGG + Intronic
1008678047 6:53842687-53842709 AACCTGCCCTGGGGAAGGGTTGG + Intronic
1010503743 6:76631817-76631839 AAGCTGCCTTGGGGCCGGGGCGG - Intergenic
1011662836 6:89609033-89609055 GAGAGGGCCTGGGGCCAGGTTGG - Intronic
1013104955 6:107019230-107019252 AAACTGCCCTGGGGGCAGGTTGG + Intergenic
1014778068 6:125533538-125533560 GAGGTGGCCTGGGGCAGGGGTGG - Intergenic
1017146493 6:151240184-151240206 GAGGCGCCCGAGGGCCGGGTGGG + Intronic
1017720869 6:157242281-157242303 AAGCTGCCCTGGGGCAGCATGGG - Intergenic
1017978013 6:159375118-159375140 GAGCAACCCTGGGGCCAGGCTGG - Intergenic
1018031717 6:159846412-159846434 GAGCTGGCCTGGGCCTGTGTGGG - Intergenic
1019028951 6:168994298-168994320 GACCTGCCCTGTGTGCGGGTTGG - Intergenic
1019128027 6:169854217-169854239 GGGCTGCCCTGGGCCCATGTTGG + Intergenic
1019177496 6:170167658-170167680 GAGGTGCCCTGAGGTCAGGTGGG + Intergenic
1019476431 7:1246835-1246857 GCCCTGCCCTGGGGTCGGGGAGG - Intergenic
1019479007 7:1257476-1257498 GAGGTGCCCAGGAGCCGGCTCGG + Intergenic
1020088439 7:5323988-5324010 GAGCGGCCCTGGGACCAGGGAGG - Intronic
1020243006 7:6410061-6410083 GGTCAGCCCTGGGGCCGCGTGGG - Intronic
1020262230 7:6536892-6536914 GAGCTGCGCCGGGGCTGGGGTGG + Intronic
1022528710 7:31053772-31053794 GAGCGGCCCTGGGGAGGAGTTGG + Intronic
1023828822 7:44027861-44027883 GGGCCGCCCCGGGGCAGGGTGGG - Intergenic
1023864332 7:44231773-44231795 CAGCAGCCCTGGAGCAGGGTGGG - Intronic
1024262026 7:47580534-47580556 GAGGTGCACTGGGTCCTGGTGGG - Intronic
1024333144 7:48176745-48176767 GATCTACCCTGGGGCTAGGTAGG + Intronic
1026524390 7:71141622-71141644 GAGCAGCCCTGGGCCATGGTAGG + Intronic
1026840604 7:73668265-73668287 GAGCTGGCCTGGGGCGGGTGGGG + Intronic
1027237735 7:76307837-76307859 TAGCTCCCCTGGGGCCTGGAGGG + Intergenic
1027288335 7:76673692-76673714 GAGCTACCTGGGGGCCAGGTAGG - Intergenic
1027559129 7:79705121-79705143 ATGCTGCCCTGGGGCATGGTAGG - Intergenic
1029739121 7:102482118-102482140 GGGCCGCCCCGGGGCAGGGTGGG - Intergenic
1029757122 7:102581297-102581319 GGGCCGCCCCGGGGCAGGGTGGG - Exonic
1030045409 7:105490753-105490775 GAGATTTCCTGGGGCTGGGTAGG - Intronic
1031986493 7:128167453-128167475 GCGCTGCCCTGGCGAGGGGTGGG + Intergenic
1032076916 7:128840436-128840458 GCACTGCCCTCGGGCTGGGTCGG + Intronic
1032082476 7:128866601-128866623 GGGCTGACTTGGGGGCGGGTGGG - Intronic
1032095756 7:128937903-128937925 CAGCTGCCCAGGGGCGGGGGCGG + Intronic
1032264853 7:130363520-130363542 CTGCTGTCCTGGGGCAGGGTTGG + Intronic
1035276743 7:157752452-157752474 GAGCTCCCCTGGGGTCGAGCTGG + Intronic
1035633586 8:1127083-1127105 GAGCTGTGCTGGGACAGGGTGGG - Intergenic
1036645918 8:10611440-10611462 GCACTGCCCGGGGGCCAGGTGGG - Exonic
1036784889 8:11679619-11679641 TGGCTGCCCTGGGGTCGGGCAGG - Intronic
1038884045 8:31643231-31643253 AAGCTGCCCTGGGGGCGTGATGG + Intronic
1039558743 8:38496097-38496119 GACCTGCCCTGGGGCCGGTGAGG + Intergenic
1041433032 8:57805724-57805746 CCACTGCCCTGGGGCGGGGTGGG - Intergenic
1042877125 8:73449645-73449667 TGTCTGCCCTGGGGCTGGGTGGG + Intronic
1046836085 8:118803149-118803171 GAGCTGCCCTGGAGCAAAGTGGG + Intergenic
1047251094 8:123182601-123182623 GCCCTGCCCTCGGGCCGGGAGGG - Exonic
1049660025 8:143815734-143815756 GGGCTGCGCGGCGGCCGGGTGGG - Intergenic
1049673727 8:143880612-143880634 GAGCAGCCCAGGGGCAGCGTGGG - Intergenic
1053249256 9:36560708-36560730 GAGCAGCCCTGAGGGCTGGTGGG + Intergenic
1056803252 9:89708621-89708643 GAGCTGGCCTGGGGTCGGGTGGG - Intergenic
1056969579 9:91191182-91191204 GAGCTGCCCAGGGGCTGGGAGGG - Intergenic
1057211497 9:93203229-93203251 GAGGCCCCCTGGGGCCTGGTGGG + Intronic
1057794060 9:98143189-98143211 GGGCTGCCCTGGGGCAGAGGGGG + Intronic
1060147895 9:121268081-121268103 GAGCCGCCCTCGGGGCGGGGCGG - Intronic
1061516118 9:131091475-131091497 GAGGTGCCCTGGGGCCTGCAGGG + Intronic
1061881698 9:133572186-133572208 CAGAGGCCCTGGGGCGGGGTGGG - Intronic
1061897740 9:133657232-133657254 GCGCTGCCATGGGCCCGGGTGGG + Intronic
1062018953 9:134307272-134307294 GATCTGCCCTGGGGCCCTGGTGG + Intergenic
1062031893 9:134365544-134365566 GGGCTGCACTGGGGCCTGGGTGG + Intronic
1062187702 9:135227448-135227470 CAGATGCTCTGGGGCCGAGTAGG - Intergenic
1062351911 9:136143563-136143585 GAGCTGGCCGGGGGCCGGGGTGG + Intergenic
1062357280 9:136170850-136170872 GAGCTGCCCTGGGGCCAGTGTGG - Intergenic
1062432663 9:136532955-136532977 CGGCAGCCCTGGGGCCAGGTGGG - Intronic
1062539771 9:137036373-137036395 GAGCTGCCCTGGGGCCCCCAGGG - Exonic
1062689619 9:137834532-137834554 GAGATGGCCAGGGGCCGGGGCGG - Intronic
1185619063 X:1442421-1442443 GAGCTCACCTGGGACAGGGTCGG - Intronic
1186484722 X:9925197-9925219 GAGCTGCCCAGGGCCTGGGAAGG + Intronic
1192225908 X:69227654-69227676 GGGCTGCCCTGTGGCTGGGTTGG + Intergenic
1192510445 X:71717907-71717929 GTGGTGCTCTGGGGCCGGGAAGG - Exonic
1192510783 X:71719358-71719380 GTGGTGCTCTGGGGCCGGGAAGG + Intergenic
1192515914 X:71762195-71762217 GTGGTGCTCTGGGGCCGGGAAGG - Intergenic
1192516252 X:71763646-71763668 GTGGTGCTCTGGGGCCGGGAAGG + Exonic
1193807883 X:86015839-86015861 GAGGTGACTTGGGGCCGGGCGGG + Intronic
1196248497 X:113429165-113429187 AACCTGCCCTGGGCCAGGGTGGG + Intergenic
1197123114 X:122914441-122914463 GGGCTGGCTTGGTGCCGGGTGGG + Intergenic