ID: 1147161027

View in Genome Browser
Species Human (GRCh38)
Location 17:38569481-38569503
Sequence CCTGGCAGGGAGGAGTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 703
Summary {0: 1, 1: 0, 2: 4, 3: 66, 4: 632}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147161016_1147161027 12 Left 1147161016 17:38569446-38569468 CCATGCCAGGGTGTCCTGGGCCA 0: 1
1: 0
2: 0
3: 33
4: 320
Right 1147161027 17:38569481-38569503 CCTGGCAGGGAGGAGTTGGAAGG 0: 1
1: 0
2: 4
3: 66
4: 632
1147161018_1147161027 -2 Left 1147161018 17:38569460-38569482 CCTGGGCCACCTGAATGCTTTCC 0: 1
1: 0
2: 1
3: 18
4: 198
Right 1147161027 17:38569481-38569503 CCTGGCAGGGAGGAGTTGGAAGG 0: 1
1: 0
2: 4
3: 66
4: 632
1147161017_1147161027 7 Left 1147161017 17:38569451-38569473 CCAGGGTGTCCTGGGCCACCTGA 0: 1
1: 1
2: 2
3: 36
4: 329
Right 1147161027 17:38569481-38569503 CCTGGCAGGGAGGAGTTGGAAGG 0: 1
1: 0
2: 4
3: 66
4: 632
1147161020_1147161027 -8 Left 1147161020 17:38569466-38569488 CCACCTGAATGCTTTCCTGGCAG 0: 1
1: 1
2: 2
3: 31
4: 238
Right 1147161027 17:38569481-38569503 CCTGGCAGGGAGGAGTTGGAAGG 0: 1
1: 0
2: 4
3: 66
4: 632
1147161011_1147161027 27 Left 1147161011 17:38569431-38569453 CCTGGGGGAAGAACACCATGCCA 0: 1
1: 0
2: 1
3: 18
4: 123
Right 1147161027 17:38569481-38569503 CCTGGCAGGGAGGAGTTGGAAGG 0: 1
1: 0
2: 4
3: 66
4: 632
1147161010_1147161027 28 Left 1147161010 17:38569430-38569452 CCCTGGGGGAAGAACACCATGCC 0: 1
1: 0
2: 0
3: 16
4: 150
Right 1147161027 17:38569481-38569503 CCTGGCAGGGAGGAGTTGGAAGG 0: 1
1: 0
2: 4
3: 66
4: 632
1147161009_1147161027 29 Left 1147161009 17:38569429-38569451 CCCCTGGGGGAAGAACACCATGC 0: 1
1: 0
2: 2
3: 11
4: 130
Right 1147161027 17:38569481-38569503 CCTGGCAGGGAGGAGTTGGAAGG 0: 1
1: 0
2: 4
3: 66
4: 632

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147161027 Original CRISPR CCTGGCAGGGAGGAGTTGGA AGG Intronic
900389952 1:2429456-2429478 CCTGAGAGTGAGGAGTTGGCGGG + Intronic
900435516 1:2628963-2628985 CCAGGCAGGGAGGGGGTGGGCGG + Intronic
900643532 1:3698491-3698513 CCTGGAAGGGAGGGGCTGGTGGG + Intronic
900661291 1:3785356-3785378 CCGGGTGGAGAGGAGTTGGAGGG - Intronic
900806969 1:4773903-4773925 CCTGGCATGGAGGCATTGGATGG + Intronic
901077928 1:6567014-6567036 ACTGGCAGAGAGGAGTAGGAGGG + Intronic
901387707 1:8921986-8922008 GCAGGCAGGGAGGATTTGGAAGG - Intergenic
901430534 1:9211386-9211408 CCTGGGAGGAAGGGGTGGGAGGG - Intergenic
901606429 1:10462781-10462803 CCTGACAGGGAGGAATAGCAGGG - Intronic
901863531 1:12089540-12089562 CGTGGAAGGGAGGAAATGGAAGG + Intronic
901879244 1:12184559-12184581 CCTGGAGGGGAGGAGGTGGGAGG + Intronic
902211863 1:14910336-14910358 CCTGAGACGGAGGAGTTGGTAGG - Intronic
902605241 1:17565484-17565506 TCAGGCAATGAGGAGTTGGAGGG - Intronic
902640817 1:17765039-17765061 CCAGCCAGAGTGGAGTTGGAAGG + Intronic
902781993 1:18710994-18711016 CCAGGAAGGGAGGAGAAGGAAGG - Intronic
902819649 1:18936198-18936220 GCTGGCAGGGAGGGGCTGGCAGG - Intronic
902890019 1:19436225-19436247 CCAGGCAGGATGGAGTGGGAAGG - Intronic
902936687 1:19769692-19769714 CCTGGCAGAGAGGAGCTGGTGGG + Intronic
902994743 1:20215311-20215333 CTTGCCAGGTAGGAGCTGGAAGG - Intergenic
903576669 1:24343603-24343625 CCTGGCAGCCAGGAGTGGGCTGG + Intronic
903639697 1:24849786-24849808 CTTGGCAGGGGGGACTTTGAGGG + Intergenic
903767982 1:25747026-25747048 CCTTGCAGGGAGGGGATGGATGG - Intronic
904008003 1:27373830-27373852 GATGGCTGGGAGGAGTGGGAAGG - Intronic
904456487 1:30651343-30651365 GCCGGCAGGGAGGAGGTGGTGGG - Intergenic
904456514 1:30651429-30651451 GCAGGCAGGGAGGAGGTGGGCGG - Intergenic
904456531 1:30651477-30651499 GCAGGCAGGGAGGAGGTGGGCGG - Intergenic
904456590 1:30651659-30651681 GCAGGCAGGGAGGAGGTGGGCGG - Intergenic
904470591 1:30733714-30733736 CCTGCCAGGGAGGGGCGGGAGGG + Exonic
904498257 1:30899708-30899730 CCTGTCAGGGAGGAGGGGTAGGG + Intronic
904613516 1:31737788-31737810 CCTGGGAGGGGGGAGCTGCAGGG + Intronic
904659789 1:32075805-32075827 CCTACCAGGGAGGTGTGGGAGGG - Exonic
904704170 1:32377969-32377991 CCCGGCTGGGAGGAGGAGGAAGG - Exonic
905060864 1:35137793-35137815 TCTGGCAGGCAGGAGTGGGGGGG + Intergenic
905396316 1:37668965-37668987 CCATGCTGGGAGGAGATGGATGG - Intergenic
905416238 1:37806702-37806724 GCTGGCAGGGAGGTGGTGGGGGG - Intronic
905538115 1:38739684-38739706 CCTGTCAGGGGGGAGGGGGACGG - Intergenic
905812953 1:40926392-40926414 CCTGGGAGGGAGTGGTGGGATGG - Intergenic
906532976 1:46533908-46533930 CCTGGAGGAGAGGGGTTGGAGGG - Intergenic
907547256 1:55273171-55273193 CCTGGCTGGGAAGGATTGGAAGG + Intergenic
907718080 1:56946328-56946350 CATGGCAGGGAGCAGCTGGAGGG + Intronic
909732505 1:78912323-78912345 CCTGGCCATGATGAGTTGGAAGG + Intronic
910807350 1:91202135-91202157 GCTGCCAGGGATGATTTGGAGGG + Intergenic
910839410 1:91546903-91546925 CCGGGGAGGGAGGAGTAGGTCGG + Intergenic
912449942 1:109762463-109762485 CTGGGCAGGGTGGGGTTGGATGG - Intronic
912544200 1:110439266-110439288 TCTGTCAGGGAGGATATGGAGGG - Intergenic
912551707 1:110489356-110489378 CCTGGCAGGGGAGGGTAGGAAGG + Intergenic
912795419 1:112690108-112690130 CCAGCCAGGGCTGAGTTGGAGGG - Intronic
914433547 1:147640879-147640901 GCTGGCAGGGTGGACTGGGAAGG + Intronic
914510852 1:148330595-148330617 CCCAGCAGGGAGGAGCAGGAAGG - Intergenic
914824969 1:151133450-151133472 ACTGGCCAGGAGGAGTGGGATGG + Exonic
916023976 1:160818403-160818425 GCTGGCAGGGAGGGGTAGCACGG - Intronic
918002800 1:180513323-180513345 CATGTCAGGCAGGAGTTGCATGG + Intergenic
919464179 1:197911409-197911431 CCGGGCAGGCAGGGGTTAGAGGG - Intergenic
920043014 1:203116156-203116178 CCTGGCAGGTGGAAGTTGGCGGG + Intronic
920260705 1:204685855-204685877 CCCGGGAGGAAGGAGTTGGGTGG + Intergenic
920494694 1:206446398-206446420 CCTGGGAGTGAGGAGTTGGGAGG - Intronic
922507166 1:226133300-226133322 CCAGGAAGGGAGGAGGTGGAGGG - Intergenic
922671046 1:227508955-227508977 TCTGGCAGGGAGTAGTGGGCAGG + Intergenic
923128355 1:231053063-231053085 CCTGGGAGGCAGAAGTTGCAGGG - Intergenic
923142743 1:231175041-231175063 ACTGGCAGGGAGCAGTAGCATGG - Intronic
923268560 1:232334924-232334946 TCTGGCGGGGAGGATTGGGATGG - Intergenic
923377817 1:233382545-233382567 CTTGGCAGCGAGGAATTGGGTGG - Exonic
924131037 1:240908583-240908605 CCTGGCAGGGAGGGAGTGGAAGG - Intronic
924163221 1:241255351-241255373 CCTGTCAATGATGAGTTGGAAGG - Intronic
924834762 1:247637126-247637148 CCAGGCAGGGAAGAGTAGGTGGG + Intergenic
1063564475 10:7161002-7161024 CGTGCCAGGGAGGAGATGGCTGG - Exonic
1065359429 10:24875936-24875958 GCTGGCAGCCAGGAGTTCGAGGG - Intronic
1065441184 10:25755258-25755280 CATGGAAGGGAGGAGTAGAAAGG - Intergenic
1065781208 10:29169647-29169669 GCTGCCAGTGAGGACTTGGAAGG - Intergenic
1065916598 10:30358542-30358564 CCTGGAAGAGAGGGGCTGGAAGG - Intronic
1066086823 10:31979322-31979344 CCTGGCAGGAGGGAGGTGGGGGG - Intergenic
1066758890 10:38736732-38736754 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1066962746 10:42236036-42236058 CCTGGCACGGAGCAGCTGGGCGG + Intergenic
1067719518 10:48716801-48716823 CAGTGCAGGGAGGAGTTGCAGGG + Intronic
1069105051 10:64373393-64373415 CCTGGTATAAAGGAGTTGGAAGG - Intergenic
1069111816 10:64456760-64456782 GCTGGCAGGGGGGAGGGGGAGGG - Intergenic
1069124975 10:64619079-64619101 CCTGCCAGGGAGGTGTCAGATGG + Intergenic
1069545612 10:69325908-69325930 CCTGGCAGGCAGAGGTTGCAGGG - Intronic
1069744472 10:70706355-70706377 CCTGGCAGGGAGGGCTCTGAGGG + Intronic
1069951840 10:72024425-72024447 CCTGGCAGGGAAGAGCTGGTGGG - Intergenic
1070089248 10:73268767-73268789 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
1070487192 10:76942382-76942404 TTTGGCAGGGAGTAGGTGGAGGG + Intronic
1070684769 10:78472371-78472393 ACAGGCAGGGAGTGGTTGGAGGG - Intergenic
1070769864 10:79075937-79075959 ACTGGCAGGGAGGATGGGGACGG + Intronic
1071381162 10:85061550-85061572 CCTGGCAGATGGGAGATGGATGG - Intergenic
1071532658 10:86401302-86401324 CCTGGCACGGAGCAGCGGGAAGG - Intergenic
1072010050 10:91294808-91294830 CCTTTCAGGAAGGACTTGGAGGG + Intergenic
1072459425 10:95605584-95605606 ACTGGCAGGGAGGAGCTGGGGGG + Intergenic
1072518251 10:96208025-96208047 CCTTGCAGGGTGGAGAGGGATGG + Intronic
1073116226 10:101093413-101093435 CCTGTCTGGGAGGCTTTGGACGG + Intronic
1073431642 10:103491140-103491162 CCTGCCAGGGAGGAGTTGCTGGG + Intergenic
1073522790 10:104150286-104150308 CCTGGCAGGGAGTGGATGTATGG - Intronic
1074691311 10:116007157-116007179 CCTTGGAGGTAGGAGTTAGAGGG + Intergenic
1075046500 10:119150348-119150370 CCTGGCAGGCAGGAGGTGCTGGG + Intronic
1075155916 10:119975629-119975651 CCAGGCTGGGAGAAGATGGAGGG + Intergenic
1075680619 10:124328647-124328669 CCTCTCAGGGAGCAGTGGGATGG + Intergenic
1075918685 10:126191483-126191505 ACTGGGAAGGAGGAGCTGGATGG + Intronic
1076247091 10:128955722-128955744 CCTGGGGGCTAGGAGTTGGAGGG + Intergenic
1076698173 10:132257032-132257054 CCTGGCCAGGAGCAGATGGATGG + Intronic
1077426659 11:2482988-2483010 CCAGGCAGGGAGGAATGGGAGGG + Intronic
1077477103 11:2795701-2795723 AATGGCAGGGAAGAGTTGGCGGG - Intronic
1077521673 11:3039454-3039476 CTTGGCAGGTGGGAGATGGAGGG - Intronic
1077638602 11:3861021-3861043 CCTGGAAAGGAGGGGTTGGGTGG + Intronic
1078083250 11:8218756-8218778 GGTGGCAGGGAGAAGCTGGAGGG - Intergenic
1078744291 11:14096555-14096577 ACTGGCAGGGAGCAGTGGGTGGG - Intronic
1079103695 11:17557377-17557399 TCAGGCTGGGAGGGGTTGGAGGG + Intronic
1079638547 11:22775488-22775510 CCTGGCATGGAGGAATTGGTCGG + Intronic
1080248171 11:30203138-30203160 CCTGGGAGGGAGGTGATGGTAGG + Intergenic
1080527834 11:33144898-33144920 CCCGGGAGGGAGAAGTTGCAGGG + Intronic
1081752150 11:45518828-45518850 CCTAGCAGGGAGGGGCAGGAAGG - Intergenic
1082812864 11:57489170-57489192 CCTGGAAGGCAGGTGCTGGATGG + Intronic
1083738779 11:64696760-64696782 CCTGGGAAGGTGGAGTGGGAGGG - Intronic
1084382311 11:68820747-68820769 CCTGGAAGGAGGGAGTGGGACGG - Intronic
1084407001 11:68979932-68979954 CTTGGCAGGGACGAGGTGGGAGG + Intergenic
1084474494 11:69381086-69381108 ACTGGCAGTGAGGCGTAGGAAGG + Intergenic
1084659883 11:70540461-70540483 GCGGGCAGGGAGGAGGTGGTAGG - Intronic
1084793543 11:71489898-71489920 CCTGGTATGGAGGAGATGGGTGG + Intronic
1085205110 11:74726990-74727012 CCTGCCAGGGAGGAGTGGACAGG - Intronic
1085283686 11:75346539-75346561 GCGGGCAGAGAGGAGTGGGAGGG - Intronic
1085386438 11:76160821-76160843 CCTGGGAGGGAGGACAAGGAGGG - Intergenic
1085406909 11:76268830-76268852 CCTGGCACAGAGGAGATGGGTGG - Intergenic
1087285260 11:96258474-96258496 CCTGGCACAGAGGAGCTGGGAGG + Intronic
1087657706 11:100945304-100945326 ACTCTCAGGGATGAGTTGGAGGG - Intronic
1088032522 11:105268568-105268590 GCTGGGAGGGAGGAGTGTGAGGG - Intergenic
1088127850 11:106449997-106450019 ACTGGTGGGGAGGAGTGGGAAGG - Intergenic
1088601867 11:111486971-111486993 CCTGTCAGGGAGGAGGCGGGGGG - Intronic
1089327044 11:117664422-117664444 CATGGCAGGGAGGTGTCAGAGGG - Intronic
1089776272 11:120838860-120838882 CCTGGGAGGCAGAGGTTGGAAGG - Intronic
1090890139 11:130916145-130916167 GCTGGAAGGGGCGAGTTGGAGGG - Exonic
1091283965 11:134397790-134397812 CCTGGCAGAGAGGAGCAGGCAGG - Intronic
1091636363 12:2199917-2199939 CCTGGGAGTGAGGAGCTGGGAGG - Intronic
1091962870 12:4713428-4713450 GCTGGGTGGGAGGAGGTGGAGGG - Intronic
1092044673 12:5422463-5422485 AATGGAAGGGAGGAATTGGAGGG + Intergenic
1092405816 12:8221651-8221673 CCAGGCAGGGAGCAGATGCAGGG - Exonic
1092572467 12:9739958-9739980 GCTTGCAGGGAGGTGTGGGAGGG - Intergenic
1092818512 12:12331703-12331725 TCTGACAGGGAGGAGGAGGAGGG + Intronic
1093015448 12:14150338-14150360 GCCGGCAGAGAGGAGTAGGAAGG - Intergenic
1093141566 12:15516064-15516086 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
1093172841 12:15878497-15878519 ACTTGGAGGGAGGAGTGGGAGGG + Intronic
1093295343 12:17383270-17383292 CCTGAGAGGGATGAGTTTGAGGG - Intergenic
1093851006 12:24038286-24038308 CCTGGGAGGGATGAGTTTGCAGG - Intergenic
1093930854 12:24953960-24953982 CGTGGAAGGGAGGAGTTTCAAGG - Intergenic
1095957075 12:47813156-47813178 CCAGGCAAGGGGGAGCTGGAGGG - Intronic
1096676097 12:53226980-53227002 GCTTGCAGTGGGGAGTTGGAGGG - Intronic
1096724927 12:53553892-53553914 CCTGACAGGTAGGAGCTGGATGG - Intronic
1097144636 12:56931741-56931763 CCTTGCATGAAGGAGCTGGAAGG - Intronic
1098481762 12:70969890-70969912 CCTGTCAGGGAGGAGTGGGAGGG + Intergenic
1099076925 12:78121405-78121427 ACTGTCAGGGAGCAGTTGGTTGG - Intronic
1099291639 12:80783293-80783315 TCTGGCGGGCAGGAGTTGGGGGG + Intergenic
1099978180 12:89568480-89568502 CCTGCCAGGGAGGAGGCTGAGGG - Intergenic
1100843511 12:98636893-98636915 CCTGGCAGGGAGGGACAGGAAGG - Intronic
1102679847 12:114684015-114684037 CAGGGCAGGGAGGATTTAGAGGG + Intronic
1103173362 12:118841596-118841618 CCTGGCAGAGACGACATGGATGG + Intergenic
1103699924 12:122843801-122843823 CCTTGCAGAAGGGAGTTGGAGGG - Intronic
1104207446 12:126653479-126653501 CCTGGGAGGCAGAAGTTGCAGGG - Intergenic
1104471228 12:129031506-129031528 CATGGCACGGAGGACTGGGAAGG - Intergenic
1104769764 12:131354049-131354071 CCAGGGAGGGAGCAGCTGGAAGG + Intergenic
1104789249 12:131471620-131471642 CCTGGGATGGAGGACGTGGATGG + Intergenic
1105014195 12:132776259-132776281 CAGGGCAGGAAGGAGCTGGAGGG - Intronic
1106164758 13:27233917-27233939 CCTGGGAGGCAGAAGTTGCAGGG + Intergenic
1106594651 13:31125847-31125869 CCAGGCAGGAGGGAGTGGGAAGG + Intergenic
1108208327 13:48113405-48113427 CCAGGCAGGATGGAGTGGGAAGG + Intergenic
1109353457 13:61211087-61211109 TCTGGCAGGCAGGAGTGGGGGGG - Intergenic
1109936163 13:69287481-69287503 GCAGGCAGCGAGGAGTGGGAAGG - Intergenic
1111208390 13:85042827-85042849 CCTGGCACAGAGGAGATGGTTGG - Intergenic
1111360038 13:87163952-87163974 TTTGGCAGGAAGGAATTGGATGG + Intergenic
1111678726 13:91418036-91418058 CCAGGCAGGATGGAGTTGGAAGG - Intronic
1112267479 13:97938252-97938274 GATGGCAGGGAGGGGCTGGAGGG + Intergenic
1112823721 13:103366676-103366698 TCAGACAGGGAGTAGTTGGAGGG + Intergenic
1113286214 13:108851939-108851961 CCTGGCGTGGAGGAGGTGGGAGG - Intronic
1113416918 13:110136078-110136100 CCCAGCCGGGAGGAGTAGGATGG - Intergenic
1113805730 13:113109302-113109324 CCTGGGCGGCAGGAGTGGGAGGG - Intronic
1113821466 13:113216783-113216805 CCTGCCAGCAAGGAGTTGGCAGG + Intronic
1113831685 13:113300408-113300430 CCTGGGAGGCAGGGGTTGCAGGG + Intronic
1113912759 13:113852001-113852023 CCCGGCAGGGACGACTTGGAGGG + Intronic
1114066046 14:19060481-19060503 CCTGGCAGTGCAGTGTTGGATGG + Intergenic
1114096222 14:19339544-19339566 CCTGGCAGTGCAGTGTTGGATGG - Intergenic
1115311710 14:31984925-31984947 TCTGGCAAGGAGGAGTGGGGTGG + Intergenic
1115724058 14:36193916-36193938 TATGGCAGGGAGGAGTTCAAGGG + Intergenic
1116185827 14:41599848-41599870 TCTGGCAGGCAGGAGTGGGGGGG + Intergenic
1116192645 14:41680035-41680057 CAGGGGAGGGAAGAGTTGGAAGG + Intronic
1116536626 14:46039921-46039943 CTTGACAGGGAAGAGTGGGAGGG - Intergenic
1117479038 14:56125035-56125057 CTTTGCAGAGTGGAGTTGGAAGG + Intronic
1118128411 14:62935613-62935635 CTTGGCAGGCAGGGGTGGGAAGG - Intronic
1118351036 14:64972469-64972491 CCGGGCAGGAAGGGGTTGGGAGG - Intronic
1118367839 14:65110713-65110735 CCTGACTGGAAGGAGTTGAAGGG - Intergenic
1118389834 14:65287042-65287064 CCTGGCGGGGAGGGTTGGGAGGG - Intergenic
1119014164 14:71031806-71031828 CTTGGCAGCGAGGAGAGGGATGG + Intronic
1119148004 14:72333782-72333804 TCTGGCAGGGAGGGGATGGAGGG - Intronic
1119321121 14:73731080-73731102 CCTAGCAGGGAGAAGTAGGAGGG - Intronic
1119380677 14:74226250-74226272 CCTGGTAGGGTGGGGGTGGAGGG - Intergenic
1119424646 14:74527726-74527748 CCTGGCTGGGAGGCATGGGAGGG - Intronic
1119769510 14:77211646-77211668 CCTGGGAGTGAGCAGTAGGATGG + Intronic
1121030818 14:90657198-90657220 CTTGGCAGCGAGGAGAGGGATGG + Exonic
1121711743 14:96043713-96043735 CCAGGGAGGGAGAAGTGGGAGGG - Intronic
1122314386 14:100817244-100817266 CCTGGCAGGGCGAAGTGGGCAGG + Intergenic
1122416248 14:101550991-101551013 CCTGGCAGGCAGAAGTAGCAGGG - Intergenic
1122772151 14:104102310-104102332 CCTGGCATGGTGGAGCTGAAGGG - Intronic
1123024729 14:105419425-105419447 CCTGGAAGGGAGGTGTGGGGTGG + Intronic
1202929611 14_KI270725v1_random:26303-26325 CCTGGCACGGAGCAGCTGGGCGG - Intergenic
1123422686 15:20144920-20144942 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1123442320 15:20301429-20301451 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1123531912 15:21151460-21151482 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1123704993 15:22944816-22944838 CCTGGCAGGGTGTGGCTGGAGGG + Intronic
1123705833 15:22950674-22950696 CCTGGGTGGGAGGAGCAGGACGG - Intronic
1124055506 15:26237898-26237920 CCTTCCAGAGAGGACTTGGAAGG - Intergenic
1124690163 15:31815190-31815212 CCTGGCAGGGGGTGTTTGGAGGG - Intronic
1125299247 15:38237081-38237103 CCGGACAGGAAGGAGTTGGAAGG + Intergenic
1125506674 15:40271440-40271462 CATGCCAGGGAGGAAGTGGAAGG + Intronic
1126724965 15:51622698-51622720 CATGGCAGGGACGAGGCGGAGGG - Intronic
1126986230 15:54312818-54312840 CCTGACAGAGAGGAATGGGAGGG - Intronic
1127527787 15:59810944-59810966 CCTGGGAGGTAGAAGTTGCAGGG + Intergenic
1127805261 15:62513346-62513368 CCTGGCAGGCAGGTGTTGGGAGG - Intronic
1128219000 15:65954548-65954570 GCTGGGTGGGAGGAGATGGATGG + Intronic
1129062924 15:72874724-72874746 GTAGGCAGGGAGGAGTGGGAAGG - Intergenic
1129283626 15:74506030-74506052 CAGGGCAGGGAGCAGTGGGACGG - Intergenic
1129612129 15:77069755-77069777 CGTGGGAGGGAGGAGCTGAATGG + Intronic
1129920935 15:79318588-79318610 CCTGGCAGGGAGCACTAGGGAGG + Intronic
1130821623 15:87502146-87502168 CCTGGCCTGGAGGAGGTGGAGGG - Intergenic
1132292712 15:100714464-100714486 CCTGGTAGGAAGGAGGTGGCAGG + Intergenic
1132617439 16:848742-848764 CTGGGCAGGGAGAAGGTGGACGG - Intergenic
1132706478 16:1245737-1245759 GCTGGCAGGGAGGGGCTGCACGG - Intergenic
1132931175 16:2459963-2459985 CCTGGGAGGCAGGAGTGGGCGGG + Intergenic
1132989606 16:2786007-2786029 CCTGGGAGGCAGGTGTTGGTGGG + Intronic
1134038861 16:11052618-11052640 CCTGGCAGGGAGGACATGGAAGG - Intronic
1135052727 16:19205513-19205535 CCTGGGAGGCAGGGGTTGCAGGG - Intronic
1135354384 16:21757320-21757342 CCTGACAGGGAGGACAAGGAAGG - Intronic
1135452875 16:22573460-22573482 CCTGACAGGGAGGACAAGGAAGG - Intergenic
1135468950 16:22712212-22712234 CCTTGAAGGGTGGAGCTGGAAGG + Intergenic
1136190086 16:28610318-28610340 CCTGGCAGGGTGGAGTTCAGGGG - Intronic
1136718897 16:32304121-32304143 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1136723918 16:32342477-32342499 CCTGGCATGGAGCAGCTGGGTGG + Intergenic
1136773019 16:32857837-32857859 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1136837270 16:33510385-33510407 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1136842246 16:33548521-33548543 CCTGGCATGGAGCAGCTGGGTGG + Intergenic
1136862060 16:33710421-33710443 CCTGGCACGGAGCAGCTGGGCGG - Intergenic
1136897596 16:34003682-34003704 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1137346366 16:47665722-47665744 GGTGGCAGGGATGAGGTGGAGGG + Intronic
1137738040 16:50739586-50739608 CCATGAAGGGAGGATTTGGAAGG + Intergenic
1138580724 16:57939130-57939152 GCTGGCAGGGAGAGGCTGGAAGG + Intronic
1138580727 16:57939144-57939166 GCTGGAAGGAAGGAGTTGGCTGG + Intronic
1138715870 16:59021509-59021531 CCCAGCAGGGAGGGGCTGGAGGG + Intergenic
1139062253 16:63266588-63266610 CTTGGGAGGGAGGAGAGGGAAGG - Intergenic
1139081127 16:63522650-63522672 CCAGGCAGGAAGGAGCGGGATGG + Intergenic
1139336984 16:66239602-66239624 TCTGACAAGGAGGAGTTGGCTGG - Intergenic
1139347068 16:66310775-66310797 CAGGGCAGGGAAGGGTTGGAAGG + Intergenic
1139364308 16:66424383-66424405 CATGGCATGGAGATGTTGGAAGG - Intergenic
1139639808 16:68282996-68283018 CCTGTCTGGGAGGAATTGGAAGG + Intronic
1140480329 16:75258955-75258977 CCTGGGAAGGAGGAGGAGGAGGG + Intronic
1141453412 16:84120835-84120857 CCAGGCAGGAGGGAGTGGGATGG + Intergenic
1141614692 16:85203457-85203479 CCCCTCAGGGAGGGGTTGGATGG + Intergenic
1141627194 16:85267416-85267438 CCTGGCATGGAGGGGCTGGCAGG + Intergenic
1142254679 16:89007990-89008012 CCTGGCAAAGATGAGGTGGATGG - Intergenic
1203002513 16_KI270728v1_random:175288-175310 CCTGGCATGGAGCAGCTGGGTGG - Intergenic
1203007534 16_KI270728v1_random:213650-213672 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1203075444 16_KI270728v1_random:1119947-1119969 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1203123554 16_KI270728v1_random:1558604-1558626 CCTGGCATGGAGCAGCTGGGTGG - Intergenic
1203134118 16_KI270728v1_random:1711694-1711716 CCTGGCATGGAGCAGCTGGGTGG - Intergenic
1203147446 16_KI270728v1_random:1810664-1810686 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1203152411 16_KI270728v1_random:1848818-1848840 CCTGGCATGGAGCAGCTGGGTGG + Intergenic
1142591583 17:1008528-1008550 CCTTGTGGGGAGGAGTGGGAAGG - Intronic
1142792174 17:2275744-2275766 CCTGGCAACGTGGATTTGGAGGG + Intronic
1142986923 17:3700997-3701019 CCTGTGAGGGAGGAGAAGGAGGG - Intergenic
1144174152 17:12688504-12688526 GATGGAAGGGAGGAGATGGAAGG - Intronic
1144459386 17:15445948-15445970 GAGGGCAGGGAGGAGATGGAAGG - Intronic
1145111036 17:20161868-20161890 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
1145890081 17:28408000-28408022 AGTGGTAGGGAGGAGTTGGAAGG - Intergenic
1146631771 17:34475173-34475195 CCTAGCAGGGAGTTCTTGGAGGG - Intergenic
1146661950 17:34670766-34670788 GCAGGCTGGGAGAAGTTGGAAGG - Intergenic
1147161027 17:38569481-38569503 CCTGGCAGGGAGGAGTTGGAAGG + Intronic
1147311054 17:39596483-39596505 CCTGAAAGGGAGGATGTGGAGGG - Intergenic
1147794585 17:43033438-43033460 CCTAGGAGGGAGGAGGGGGAAGG + Intergenic
1148018106 17:44536733-44536755 CCTGGGAGGAAGGAATTGAATGG - Intergenic
1148181983 17:45612743-45612765 CATGGCAGGGAGGGGATGGCGGG + Intergenic
1148266876 17:46232957-46232979 CATGGCAGGGAGGGGATGGCGGG - Intergenic
1148615628 17:48997998-48998020 CCGGGAAGAGAGGAGTTGGCGGG - Intronic
1149324959 17:55520626-55520648 CCAGGTAGGGCGGAGTGGGACGG + Intergenic
1150216727 17:63475560-63475582 CTGGGCAGGGAGGAGTTGTGAGG + Intergenic
1150727907 17:67666523-67666545 CCTGGCAGGAAGGAGGTACAAGG - Intronic
1150973788 17:70060799-70060821 CCTCCCAGGGTGGAATTGGATGG - Intronic
1151328202 17:73391617-73391639 CCTGGCAGGGTGGAGGGGGAAGG + Intronic
1151635710 17:75346418-75346440 CCTGGGAGGCAGAAGTTGCAGGG + Intronic
1151835761 17:76581683-76581705 CCTGAGAGGGAGGGGCTGGAAGG - Intronic
1152113345 17:78369650-78369672 CCTGGCAGGGAAGGGAAGGAAGG - Intergenic
1152141989 17:78541901-78541923 CGTGGCAGGGAGGGGAGGGATGG + Intronic
1152237153 17:79144539-79144561 CCTGGGTGAGAGGAGTTGGTGGG + Intronic
1152245989 17:79184794-79184816 CCTGGCAGTGGGGAGATGGCTGG + Intronic
1152307051 17:79527221-79527243 CCTGGCAGGGAAGAGGTGGCAGG - Intergenic
1152342286 17:79731740-79731762 TCTGTCAGGGAGGTGTTGGGTGG - Intronic
1152595253 17:81234657-81234679 CCTGCCAGGGTGGAGGTAGACGG - Intronic
1153368226 18:4284052-4284074 CCTGGTACTGAGGAGGTGGAGGG + Intronic
1153985645 18:10348627-10348649 CCTGGGAGTGAGGAGTGGGAAGG + Intergenic
1154219051 18:12436105-12436127 TGTTGCAGGGAGGAGTGGGAAGG - Intergenic
1154219337 18:12438396-12438418 TGTTGCAGGGAGGAGTGGGAAGG + Intergenic
1154415802 18:14174624-14174646 CCTGGCACGGAGCAGCTGGGAGG + Intergenic
1154952472 18:21223760-21223782 CCTGGTAGGATGGAGTGGGACGG - Intergenic
1155574774 18:27232504-27232526 TCTGGCAGGCAGGAGTGGGGGGG - Intergenic
1156048660 18:32906020-32906042 GGTGGGAGGGAGGAGTAGGAAGG - Intergenic
1157173963 18:45433867-45433889 CCTGGAAGGGGGAAGATGGATGG + Intronic
1157310070 18:46546129-46546151 CCTGGCTGGGAGGAGTTTTAGGG + Intronic
1157622322 18:49023786-49023808 CCAGGCATGGAGGAGGAGGAAGG - Intergenic
1157709892 18:49842990-49843012 CTCAGCAGGGAGGAGCTGGAGGG + Intronic
1157915902 18:51663697-51663719 GGTGGCAGGGTGGAGATGGATGG - Intergenic
1158120479 18:54042958-54042980 CCTCGCAGGGAGGTGTCTGAGGG - Intergenic
1158564756 18:58545391-58545413 CCTGGTAGGGATTAGCTGGAAGG + Intronic
1159139151 18:64371384-64371406 TCTGGCAGTAATGAGTTGGATGG + Intergenic
1160523830 18:79524149-79524171 CGTGGCGGGAAGGAGTTGGGGGG + Intronic
1160907897 19:1460382-1460404 CGAGGCTGGGATGAGTTGGAAGG - Intronic
1161253712 19:3294958-3294980 CCTGGCCGGGTGGAGTAGGGTGG + Intronic
1161316166 19:3618683-3618705 CCTGGGAGGGATGAGTGGGGCGG - Intronic
1161514581 19:4689512-4689534 TCTGGCTGGGAGCTGTTGGACGG + Intronic
1162030331 19:7914502-7914524 CCTGGCAGGGCGAGGTGGGAAGG + Intergenic
1162320204 19:9967148-9967170 CCTGGGAGGGGGGACTTGGGGGG - Intronic
1162345729 19:10116989-10117011 CCTGGCAGGGGCGGGTTGGGGGG + Exonic
1162777395 19:12988045-12988067 CCTGGCAGGGAGGAATGTGGGGG + Intergenic
1163168540 19:15514593-15514615 CCTGGGAGGCAGAAGTTGCAGGG + Intronic
1163297709 19:16422880-16422902 CCTGGGAGGCAGAAGTTGCAGGG + Intronic
1163957252 19:20655034-20655056 CCTGGGAGGCAGCAGTTGTAGGG + Intronic
1164459913 19:28437805-28437827 CCTGGGTGGGAGGGGTTGGGCGG + Intergenic
1165039791 19:33060916-33060938 CCAGGCAGGGAGGCATTGGGAGG - Intronic
1165042770 19:33080895-33080917 CCTCGCAGGGAACAGTTGGGTGG + Exonic
1165068303 19:33241393-33241415 CCTGGCTGGGAGGAGGTGGGTGG + Intergenic
1165073604 19:33269110-33269132 CCTGGGAGGGAGCAGGAGGAAGG - Intergenic
1165433251 19:35784150-35784172 CCTGGGTGGGAGGAGCGGGAGGG - Exonic
1165731272 19:38147135-38147157 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
1165993093 19:39826987-39827009 CCTGGCAGGGAGGGGGTGGGAGG + Exonic
1166100110 19:40566587-40566609 CCTGGGATGGGGGAGTGGGAGGG + Intronic
1166225538 19:41392793-41392815 GCTGGTAGGGAGGAGCTGGGGGG + Intronic
1166339543 19:42129442-42129464 CCGGGGAGGGAGGAGTGGGAGGG - Intronic
1166701725 19:44886065-44886087 CCTGGCAGGGAGAAGCTGGCTGG + Intronic
1166737810 19:45096640-45096662 CCTGGCTGGGAGGAGTTTAGAGG + Intronic
1166762889 19:45235668-45235690 TCTGCCAGGGAGGAAGTGGAGGG - Intronic
1166963692 19:46515180-46515202 CCTGGCTCGGAGGAGAGGGAGGG - Intronic
1167249112 19:48391370-48391392 CCTGGCAGGGCTGAGCGGGAGGG + Exonic
1167409628 19:49337252-49337274 CCCAGCAGGGAGGAGAGGGAAGG + Intronic
1167739673 19:51316939-51316961 CCTGGGAGGTAGGGGGTGGAGGG - Intronic
1168136757 19:54356966-54356988 CCTGGGAGGGAGGAATCAGAAGG + Exonic
1168238018 19:55075840-55075862 CCTGGGAGGGAGCAGGAGGAGGG + Intronic
1168290246 19:55354089-55354111 CCTGGCTGGGAGGGGCGGGACGG - Exonic
1168469326 19:56627959-56627981 CCAGGCAGGGAGGAGCAGAAGGG - Intergenic
925004491 2:430521-430543 CCCTGCAGGCAGGAGTGGGAGGG + Intergenic
925920985 2:8637659-8637681 ACTGGCAGGGAGGATCTGGGCGG - Intergenic
926958403 2:18327797-18327819 CCTTGCAGGGAGGAATTATAAGG - Intronic
927412885 2:22846722-22846744 CCTGGTAGGGAGGAGCAAGAAGG - Intergenic
927420772 2:22928240-22928262 CCGGGCAGGGAGGCATTTGAAGG - Intergenic
927805828 2:26145718-26145740 CCTGGCTGTGAGGGGTGGGAAGG - Intergenic
927963788 2:27257042-27257064 GGTGGGAGGGAGGAGCTGGAGGG + Intronic
928429513 2:31205922-31205944 GCTGGGAGGCAGGAGTTGGCAGG - Intronic
928443383 2:31312063-31312085 CTAGGAAGGGAGGAGATGGAGGG - Intergenic
929216202 2:39416169-39416191 GCTGGGAGGGTGGAGTTGGGAGG + Intronic
929468080 2:42163998-42164020 AATGGCAGGGATGAGTTGGGGGG - Intergenic
930206787 2:48595019-48595041 CCTGGCGGGGAGGATTTGAGGGG + Intronic
930484104 2:51990653-51990675 CCTGGCTGGGAGTAGTGGGAGGG + Intergenic
930750364 2:54928556-54928578 CCAGGAAGGGAGGTGTTGGGAGG - Intronic
931041566 2:58306036-58306058 CATGGGAGGGAGGGGTTGGAAGG + Intergenic
932305945 2:70704437-70704459 TCTTTCAGGGAGGAGCTGGAAGG - Exonic
932457374 2:71858182-71858204 CCTGGAAGGTGGGAGGTGGAGGG - Intergenic
932569197 2:72929022-72929044 CATGGAAAGGAGGATTTGGAGGG + Intronic
934322217 2:91981072-91981094 CCTGGCATGGAGTAGCTGGGCGG - Intergenic
934460505 2:94211863-94211885 CCTGGCACGGAGCAGCTGGGTGG - Intergenic
935244582 2:101207122-101207144 CCTGGGAGGCAGCAGTTGCAGGG - Intronic
935253150 2:101283154-101283176 GCTGCCAGGTAGAAGTTGGAAGG - Intronic
936255807 2:110909775-110909797 CATGGCGGGGAGGGATTGGATGG + Intronic
936472481 2:112811490-112811512 CCTGGCAGGGAAGAGAAGGGAGG + Intergenic
937032967 2:118756150-118756172 GCAGGGTGGGAGGAGTTGGAAGG - Intergenic
937331437 2:121032780-121032802 CCTGGGGGGGAGGAGATGGGGGG - Intergenic
937344322 2:121114979-121115001 CCTGGGAGGCAGAAGTTGCAGGG - Intergenic
937638062 2:124179233-124179255 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
938097968 2:128475614-128475636 CTTGGCAGGGAGCAGGAGGAGGG + Intergenic
938114891 2:128596256-128596278 CCTGGCAGGAAGAATCTGGAGGG + Intergenic
938380015 2:130831427-130831449 CCAGGCTGGGAGAAGGTGGAAGG - Intergenic
940140806 2:150488582-150488604 GCTTGCGGGGAAGAGTTGGAGGG - Intronic
940201434 2:151155645-151155667 ACTTGCAGGGAAGTGTTGGAAGG + Intergenic
940277376 2:151953391-151953413 CAGGGAAGGGAGGAGTTGGAGGG - Intronic
941037027 2:160579967-160579989 CCTTGCAGGGAGGTGTTTAAAGG + Intergenic
941157707 2:161999532-161999554 CCTGGCAAGGAGAAGTGGGAAGG + Intronic
941526283 2:166610572-166610594 CCAGGCAGGCAGTAGATGGAAGG + Intergenic
942729807 2:179051758-179051780 TCTGGCAGGCAGGAGTGGGGGGG + Intergenic
943377925 2:187103709-187103731 CTGGGCAGGTAGGAGTTGGGGGG + Intergenic
943645249 2:190403146-190403168 CCTTGCGGGGAGGAAATGGAAGG - Intergenic
943692083 2:190880174-190880196 CATGGGAGGGTGGAGGTGGAGGG - Intergenic
944218187 2:197276197-197276219 CCTGGGAGGTAGAAGTTGCAGGG + Intronic
945065190 2:205942263-205942285 GCTGGCATGGATGAGTAGGATGG - Intergenic
945290818 2:208125543-208125565 CCTGGAAGAGAGCAGTTTGATGG + Intergenic
945976258 2:216273562-216273584 CCTGGCAGAGAGTGGGTGGAAGG - Intronic
946014283 2:216591563-216591585 CATGGGAGGGAGCAGTGGGAAGG - Intergenic
946812690 2:223542977-223542999 GCTGGCAGGGCTGAGTAGGAAGG - Intergenic
947301054 2:228689044-228689066 CCAGGCAGTGGGGAGTTGGGAGG + Intergenic
947515593 2:230801267-230801289 TCTTTCAGGGAGGAGTAGGAAGG - Intronic
947543084 2:230991768-230991790 CCTGGCAGGGTGGAGCTGGCAGG - Intergenic
947672990 2:231952205-231952227 CCTGGGAGGCAGAAGTTGCAGGG + Intergenic
947795394 2:232891000-232891022 GCTGACAGGGAGGAGCTGGTGGG - Intronic
948035912 2:234858172-234858194 TCCGGCAGGGAGGGGTTGGGAGG - Intergenic
948049613 2:234969656-234969678 CCTGGCAGGCTGGACTTGGAGGG + Intronic
948256813 2:236574384-236574406 CCTGGTAGGAATGAGGTGGAGGG + Intronic
948279781 2:236738140-236738162 GATGGCAGGGAGGGGTGGGAAGG - Intergenic
948695742 2:239732274-239732296 CCTGGCAGGGAGGAGGCTGGAGG - Intergenic
948791015 2:240376888-240376910 GCTGGCAGGGAGGAGGTGTGGGG - Intergenic
948893427 2:240917627-240917649 CCAGGCAAGGAGGACTTGGGTGG + Intergenic
949027249 2:241772033-241772055 CCTGGCAGTGTGGAGGTGTAGGG + Intergenic
1168751890 20:288404-288426 GCTGGCAGGGATGAGTGGGGAGG + Intronic
1169266623 20:4171061-4171083 CCAGGCAGGGAAGAGGAGGAGGG - Intronic
1169815479 20:9651702-9651724 CCTGGGAGGAAGTAGTTGGCAGG + Intronic
1169869550 20:10236389-10236411 ACTGGCAGGGTGGAGCAGGAGGG + Intronic
1169933527 20:10858646-10858668 CATAGCAGAGAGGAGCTGGAAGG + Intergenic
1170693225 20:18633952-18633974 CCTGGCAGTGATAAGTTGGAAGG + Intronic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1171373757 20:24678066-24678088 CCTGGCAGGGTGTTGTTGGGAGG - Intergenic
1171870860 20:30523539-30523561 CCCGGGAGGCAGGGGTTGGAGGG + Intergenic
1172028048 20:31962877-31962899 GCTGGCAGGGAGGGGTGGGCAGG - Intergenic
1172231820 20:33341811-33341833 CCTGGCAGGGAGAAAGTGCAGGG + Intergenic
1172617792 20:36300595-36300617 CCTGGCATGGAGGAGGTGCCTGG - Intergenic
1172619728 20:36311030-36311052 CCTGGCCTGGAGGAGTTGCCAGG - Intronic
1172874739 20:38157220-38157242 GCTGGCAGGGAGGAGGGGGCTGG - Intronic
1172879871 20:38192905-38192927 CCAGGCAGGGAGGAGAGAGAAGG - Intergenic
1172929590 20:38576061-38576083 CCTGGCAGGGATCTGTTGGCTGG - Exonic
1173662284 20:44742945-44742967 CCTGGCTGGGAGGACTTGGCAGG + Intergenic
1174920041 20:54692161-54692183 CCTGCCAGGGAGGGGTTGAGGGG - Intergenic
1175258365 20:57660150-57660172 CCAGGGAGGGAGCAGTTGGGAGG + Intronic
1175264153 20:57692495-57692517 CCTGGCAGGGAGGGGCTTCAGGG - Intronic
1175271041 20:57734419-57734441 GGGGGCAGGGAGGAGTAGGATGG - Intergenic
1175423030 20:58847656-58847678 CTTTGCAGGGAGGAGGTGGGTGG - Intronic
1175531823 20:59678791-59678813 CCTGGCTGGGAGCACCTGGAGGG + Intronic
1175563522 20:59953859-59953881 CATGGCAGGCAGAAGCTGGAAGG - Intergenic
1175895528 20:62334110-62334132 GCTGGCAGGGAGGGGTGGGCAGG - Intronic
1175995814 20:62811948-62811970 CCTGGTGGGGAGGAGCTGGCTGG - Intronic
1175998074 20:62820211-62820233 CATGGCAGGGAGAAGGGGGATGG + Intronic
1176249554 20:64113930-64113952 CCTGGCAGGCAGGACATGGCAGG - Intergenic
1176591633 21:8654902-8654924 CCTGGCACGGAGCAGCTGGGTGG - Intergenic
1176857538 21:13984680-13984702 CCTGGCACGGAGCAGCTGGGAGG - Intergenic
1178250769 21:31001220-31001242 CCTGGGAGGTAGAAGTTGCAGGG + Intergenic
1178707925 21:34889845-34889867 CCCGGCAGGGAGGGCGTGGAGGG - Intronic
1178812917 21:35899795-35899817 CCTGTCAGGGGAGAGTTGGGAGG + Intronic
1179319561 21:40277072-40277094 TCTGGCCTGGAGGAGTTGGGTGG + Intronic
1179722747 21:43324744-43324766 CCTGGCAGGGAGGAGCTGAAGGG + Intergenic
1180069005 21:45426821-45426843 TCTGGGAGGGAGGCCTTGGAGGG + Intronic
1180158587 21:45989334-45989356 CCTGCCAGGGAGGGGCTGGGTGG + Intronic
1180274481 22:10632014-10632036 CCTGGCACGGAGCAGCTGGGTGG - Intergenic
1180484526 22:15783073-15783095 CCTGGCAGTGCAGTGTTGGATGG + Intergenic
1180548970 22:16526991-16527013 CCTGGCACGGAGCAGCTGGGCGG - Intergenic
1180695923 22:17751613-17751635 CCAGGCAGAGAGGAGGTGGCAGG + Intronic
1181084019 22:20430977-20430999 CCAGGGAGGGAGGAGGTGGAAGG - Intronic
1181392429 22:22593464-22593486 CAGGGCAGGGAGGGGCTGGAAGG + Intergenic
1181429603 22:22870907-22870929 CAGGGCAGGGAGGAGCTGTAAGG + Intronic
1181645069 22:24226531-24226553 CCTGGTAGGGGGAAGTTGGAGGG - Intronic
1182020978 22:27081200-27081222 CTTTGCAGGGAGGAGTAGCAGGG - Intergenic
1182368142 22:29792403-29792425 CCTGGCAGGTAGCAGATGAAGGG - Intronic
1182685532 22:32119964-32119986 CCTGGCACGGAGCAACTGGATGG + Intergenic
1183005067 22:34894578-34894600 CCAGCCAGTGAGGACTTGGAGGG - Intergenic
1183281105 22:36933166-36933188 CTGGGCAGGGAGGGGTTGAAAGG + Intronic
1183341993 22:37286633-37286655 GCTGGCAGAGAGGAGAAGGAAGG + Intronic
1183608058 22:38878476-38878498 CCTGGATGGGAGGAGTGGCAGGG + Intergenic
1183637028 22:39070371-39070393 CCTGGGAAGGAGGAGGAGGAAGG - Intronic
1183688178 22:39374041-39374063 CCTGGCTGAGGGGTGTTGGAAGG + Intronic
1183860633 22:40667451-40667473 CCTGGCAGGGAGCAGTCCAAAGG - Intergenic
1184021854 22:41826396-41826418 CCTGGCAGGGCAGAGAAGGAAGG + Intergenic
1184342555 22:43893902-43893924 CCAGGCAGGGAGGAGTAGGGAGG + Intergenic
1184974478 22:48051383-48051405 CCTGGGAGGCAGAAGTTGCAGGG + Intergenic
1185379372 22:50500817-50500839 CTTGGCAGGGAGGGGTCAGAGGG + Intergenic
949932054 3:9086442-9086464 CCTGGTAGGTAGGGGTTGCAGGG + Intronic
950430268 3:12946898-12946920 TCTGCCAGGGAGGAGTGGGTAGG - Intronic
950659939 3:14460992-14461014 TCCAGCAAGGAGGAGTTGGAGGG + Intronic
951315834 3:21189191-21189213 TCTGGCAGGCAGGAGTGGGGGGG + Intergenic
951961337 3:28325391-28325413 CCTGGGAGGGTGGATATGGATGG + Intronic
952900680 3:38109790-38109812 CCTGGCAGGCAGGAGATGGCAGG + Intronic
954245745 3:49330093-49330115 CCTGGGAGGGAGAGGTTGCAGGG + Intronic
954374641 3:50187920-50187942 CCTGGTAAGGAGGCGTTGGGGGG - Exonic
954618139 3:51980728-51980750 CCTTGGATGGAAGAGTTGGATGG + Intronic
955059191 3:55481923-55481945 CCAGGGAGGGAGGAGATGGGAGG + Intronic
956057061 3:65311117-65311139 CCAGGCAGGAAGGAGATGGAAGG - Intergenic
957275541 3:78086293-78086315 CCAGGCAGGAAGGAGCAGGATGG - Intergenic
959419224 3:106111564-106111586 CCTGTCCGGGAGGAGGTGGGGGG - Intergenic
960011002 3:112834675-112834697 CCTGGCAGGCAGCACTTGGCTGG + Intronic
961564124 3:127751279-127751301 CCTTGCTGGGAGGAGCTGCAGGG - Intronic
961616650 3:128188082-128188104 CCTGGCATTGATGGGTTGGAGGG + Intronic
961629972 3:128289414-128289436 CCTGGCAGGAGGCAGATGGAGGG + Intronic
962440440 3:135409531-135409553 CCTGGCCAGGAGGAGTGGGGTGG + Intergenic
963079211 3:141375722-141375744 CAAGGCAGGGATGAGTTGAAAGG + Intronic
963350136 3:144141287-144141309 CCTGGCAGGATGGGGTAGGATGG + Intergenic
965757668 3:172041172-172041194 CCTGGGAGGGAAGAGGGGGAGGG - Intronic
966473606 3:180319813-180319835 CTGGGCAAGGAGGAGTGGGAAGG + Intergenic
966834360 3:184037999-184038021 CCTGGTGGGGAGGAGAAGGAGGG - Exonic
967194279 3:187012988-187013010 GCTGGCAGGGGTGAGGTGGAAGG + Intronic
967278075 3:187795882-187795904 CCTGGCAGAGAGGTGGTGGCCGG - Intergenic
967758932 3:193202286-193202308 CCTGGGAAGGAGAAGATGGAAGG + Intergenic
968645140 4:1736832-1736854 CCTGGGAGGCAGGGGTTGCAGGG + Intronic
968706356 4:2080228-2080250 GCTGGCAAGGAGGAGGTGGCTGG + Intronic
968958551 4:3731058-3731080 GCTGGCAGAGAGGAGCTGGGGGG + Intergenic
969308125 4:6336935-6336957 ACAGGCAGGGAGGGGTTGGAGGG - Intronic
969369870 4:6724747-6724769 CCTAGCAGGGAGCAGCTCGAGGG + Intergenic
969448697 4:7260375-7260397 CCTGGGAGGGGGGAGGTGGGAGG - Intronic
969513185 4:7631388-7631410 CCAGGCAGGGAGGGGGTGGGAGG + Intronic
969599470 4:8167397-8167419 CCTGGCAGGCAGGGGTGTGATGG - Intergenic
969760310 4:9176316-9176338 CCAGGCAGGGAGCAGATGCAGGG + Exonic
970246654 4:14071318-14071340 CCTGGAAGTGAGGAGATTGATGG + Intergenic
971151821 4:24041279-24041301 CCCAGCAGGGAGGAGTTGGAGGG - Intergenic
972321409 4:37976802-37976824 CCTGGCAGGCAGGAGCTAAATGG + Intronic
973755221 4:54067455-54067477 GTTGGCAGGGCGGAGGTGGAGGG - Intronic
975416067 4:74106050-74106072 ACAGGGAGGGAGGAGTGGGAAGG - Intergenic
976532804 4:86174460-86174482 CCTGTCAGGGGGGTGGTGGAAGG + Intronic
978561935 4:110042688-110042710 CCTGGCAGGGATGGGTGGGTGGG + Intergenic
982430187 4:155314082-155314104 CATGGGAGGGACCAGTTGGAAGG + Intergenic
983546529 4:168970635-168970657 CCTTGCAGGGAAGGGTGGGAGGG - Intronic
983890479 4:173024976-173024998 GCTGGGAGGGAGGGGTTGGCTGG - Intronic
984014458 4:174409014-174409036 CCTGGCAGGCAGGTGTTGCCAGG - Intergenic
985008180 4:185555471-185555493 CCTGGCGGGGAAGAGTGGGAAGG - Intergenic
985541105 5:488160-488182 GCTGGGAGGAAGGAGGTGGAGGG + Intronic
985548550 5:521917-521939 GCTGGCAGAGAGGGGATGGAGGG + Intronic
986192522 5:5510248-5510270 CCTGCCAGGGTGGAGGGGGAAGG - Intergenic
986659269 5:10044526-10044548 GCTGGCAAGGAGGTGTTTGAGGG - Intergenic
987088824 5:14492839-14492861 CCTGGCAGGCAGCAGAGGGAGGG + Intronic
987355476 5:17059880-17059902 GGTGGCATGGAGGAGGTGGATGG + Intergenic
988350266 5:30095687-30095709 CCTGTCAGGGAGGAGGAGGAGGG - Intergenic
988503110 5:31799632-31799654 CCCAGCAGGGAAGAGTGGGAAGG + Exonic
989181547 5:38582363-38582385 TCAGGCAGAAAGGAGTTGGAAGG + Intronic
989195239 5:38709845-38709867 GCTGGAAGAGAGGAGCTGGAAGG - Intergenic
990636792 5:57736984-57737006 GCTGGTAGGGAGGTGGTGGACGG - Intergenic
992056738 5:72997754-72997776 CAGGGCAGAGAGGGGTTGGAGGG - Intronic
994546917 5:101178347-101178369 CCTGACATGGAGTAGCTGGAGGG + Intergenic
995530888 5:113090993-113091015 CGTGGGAGGGAGGAGATGGAGGG + Intronic
997235356 5:132269301-132269323 GGTGGGAGGGAGGAGTTGGAGGG - Intronic
997257144 5:132437820-132437842 GCGGGCAGGGAGGAGTGGGGTGG + Intronic
997350134 5:133225095-133225117 GCTGGCTGGGAGGTGTTGGGTGG - Intronic
997375186 5:133392629-133392651 CCTGACAGGGAAGAGATGAAAGG + Intronic
998189686 5:140012634-140012656 GCTGGAAGGTAGGAGTTGGTAGG - Intronic
998526336 5:142846483-142846505 TCTGGCAAAGAGGATTTGGATGG + Intronic
999300719 5:150488563-150488585 CATTGAATGGAGGAGTTGGAAGG + Intronic
999742378 5:154566129-154566151 GCTGGGTGGGAGGAGCTGGACGG - Intergenic
1000072963 5:157758188-157758210 CCTGGGAGGCAGAAGTTGCAGGG - Exonic
1001278226 5:170366386-170366408 CCTGGAAGGGAGAAGCTGGCTGG + Intronic
1001775415 5:174325899-174325921 CCAGGGAGAGATGAGTTGGAGGG + Intergenic
1002134793 5:177100886-177100908 GCTGGCAGGGAGGGGGTGCAGGG - Intergenic
1002421240 5:179150182-179150204 CCAGGCAGGGAGGAGGCAGAGGG - Intronic
1002603867 5:180370586-180370608 CCTGGATGGGAAGAGGTGGAGGG + Intergenic
1004320524 6:14628242-14628264 GCTGGCAGGAAAGAGGTGGAGGG - Intergenic
1005494714 6:26378181-26378203 CCTAGCAGGCAGCAGTTGAAAGG - Exonic
1005499207 6:26415076-26415098 CCTAGCAGGCAGCAGTTGAAAGG - Exonic
1005503899 6:26453284-26453306 CCTAGCAGGCAGCAGTTGAAAGG - Exonic
1006499546 6:34449088-34449110 CCTGGCTGGGGGGAGGTGCATGG + Intergenic
1006683758 6:35815303-35815325 ACTGACAGGTAGGATTTGGATGG - Intronic
1007375233 6:41451887-41451909 ACTGGCAGGGAGAAGTGGGAAGG - Intergenic
1007663919 6:43503324-43503346 CCAGGATGGGAGGAGGTGGAGGG + Intronic
1007699351 6:43757610-43757632 CCTGGCTGGCTGGAGTGGGATGG + Intergenic
1007725582 6:43913827-43913849 CCTGGCAGTGGGCAGCTGGAGGG + Intergenic
1008598609 6:53066332-53066354 CCTGGCGGAGTGGGGTTGGAGGG + Intronic
1008739512 6:54588525-54588547 GCAGGCAGTGAGGAGTTAGATGG - Intergenic
1010613869 6:77989835-77989857 GATGGCAGGGAGCAGTAGGAAGG + Intergenic
1012373786 6:98537170-98537192 CCTGGGAGGCAGAAGTTGCAGGG + Intergenic
1013780513 6:113723647-113723669 CCTGTCAGAGAGGTTTTGGAAGG + Intergenic
1014035739 6:116765356-116765378 CCTGGGAGGGAGGAGGTTGCGGG - Intronic
1015688778 6:135896822-135896844 GCTGGAAGGAAGGAGCTGGAAGG - Intronic
1016019081 6:139216857-139216879 ACTTGCAGGGAAGAGTTGGAGGG + Intergenic
1016100917 6:140099041-140099063 CCTGAATGGGAGGAGTAGGACGG + Intergenic
1016429604 6:143968864-143968886 ACTGGGGGGCAGGAGTTGGAGGG + Intronic
1016739750 6:147514335-147514357 CCAGTGAGGGAGGAGATGGAAGG + Intronic
1017165750 6:151407043-151407065 CTTGGCAGGGATGAGGTGGGAGG + Intronic
1017467786 6:154710749-154710771 TGTGGCAGGGCAGAGTTGGAGGG + Intergenic
1017770955 6:157644233-157644255 CCTGGCAGGGGGGATGTGGGTGG + Intronic
1018427199 6:163694219-163694241 CCTCACAGGGAGGAGGTGGCTGG + Intergenic
1018676197 6:166224168-166224190 CCGGGCGGGGAGGAGGTGCAGGG + Intergenic
1018762992 6:166906972-166906994 GCTGGCATTGAGGAGTTGGTGGG - Intronic
1018876482 6:167826746-167826768 CCAGGGAGGGAGGTGTCGGAGGG - Intergenic
1018939890 6:168302038-168302060 CTGGGCAGTGAGGAGCTGGATGG - Intronic
1019295501 7:271991-272013 CCCTGCAGGGAGGAGTGGGGAGG + Intergenic
1019567689 7:1692668-1692690 CCTGGCTGGGTGGAGTGGGAAGG + Intronic
1019715883 7:2539164-2539186 CCCGGCAGGTAGGAGGTGGCAGG - Exonic
1019779381 7:2930504-2930526 CCTGGCGGGGAGGGGGTGGTGGG + Intronic
1020775042 7:12442641-12442663 CCTGACAAGGATTAGTTGGAAGG + Intergenic
1020818353 7:12935141-12935163 TCTGGGATGGAGGAGTTGGGTGG + Intergenic
1021222380 7:17989092-17989114 CAAGGCAGGGAAGAGCTGGAAGG + Intergenic
1022021468 7:26403448-26403470 CCTGGGAGGCAGAAGTTGCAGGG - Intergenic
1022100789 7:27167951-27167973 AATGGCAGGGAGGAGTTGAAGGG + Intronic
1022178525 7:27895636-27895658 CCTGGCAAGGAGGATTTGCTGGG - Intronic
1023167707 7:37359184-37359206 CCTGCAAGGAAGGAGTAGGAAGG - Intronic
1024170343 7:46778419-46778441 AATGGGAGGGAAGAGTTGGAAGG + Intergenic
1024953628 7:54892345-54892367 CCTGGGATGGAGGAGATGGAGGG - Intergenic
1026530556 7:71193624-71193646 TATGGCAGGAAGGAGTTGGCCGG - Intronic
1027201897 7:76069251-76069273 CCTGGAAGGCAGGAGCTAGAGGG - Intergenic
1027509554 7:79062732-79062754 GATGACAGGGAGGAGGTGGAAGG - Intronic
1027560433 7:79721864-79721886 ACTGGACGAGAGGAGTTGGAGGG + Intergenic
1027880837 7:83833856-83833878 TCTGGCAGGCAGGAGTGGGGGGG + Intergenic
1027981947 7:85235846-85235868 CATGGCAGGTTGGAGTTGAAGGG + Intergenic
1029258426 7:99285113-99285135 TCAGGCGGGGAGCAGTTGGAGGG - Intergenic
1029421101 7:100472294-100472316 CCTGGCAGGGTGGGGCTTGAGGG + Intronic
1030651271 7:112118793-112118815 CATGGCAGGGGTGAGCTGGAGGG - Intronic
1030727911 7:112947857-112947879 CCTGGGAGGCAAGAGTGGGAGGG + Intergenic
1032288713 7:130566655-130566677 CCTGGGAGGGAGGGGTCTGAGGG + Intronic
1032291239 7:130591377-130591399 CCTGTCTGGGAGGAGGTGGGGGG + Intronic
1032364790 7:131288611-131288633 TCTGGCAACGAGGAGTGGGAAGG + Intronic
1033453462 7:141481886-141481908 CCGGGCAGGGGTGAGTAGGATGG + Intergenic
1034345577 7:150383563-150383585 CATGGCAGGGAGGCATTGGCTGG + Intronic
1034730472 7:153382704-153382726 CCTGTCAGGGAGAATTTGGGAGG - Intergenic
1035122229 7:156578471-156578493 CCTGCCAGGGAGGAAAAGGAGGG + Intergenic
1035158732 7:156935456-156935478 GCCTGCAGGGAGGAGGTGGAAGG + Intergenic
1035704428 8:1664316-1664338 CCTGGGAAGCAGGAGTAGGACGG - Intronic
1035727180 8:1831900-1831922 CATGGCCGGGTGGAGTTGGATGG + Intronic
1035759073 8:2055956-2055978 CCTGGGAAGGAGGCGGTGGAGGG - Intronic
1035852422 8:2933766-2933788 CCTGGCAGGGAGTGGGTTGACGG + Intergenic
1036263934 8:7260063-7260085 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036265230 8:7267685-7267707 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036266531 8:7275307-7275329 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036267837 8:7282929-7282951 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036269141 8:7290551-7290573 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036297451 8:7548882-7548904 CCAGGCAGGGAGCAGATGCAGGG - Intergenic
1036298755 8:7556529-7556551 CCAGGCAGGGAGCAGATGCAGGG - Intergenic
1036300060 8:7564179-7564201 CCAGGCAGGGAGCAGATGCAGGG - Intergenic
1036301364 8:7571824-7571846 CCAGGCAGGGAGCAGATGCAGGG - Intergenic
1036302661 8:7579473-7579495 CCAGGCAGGGAGCAGATGCAGGG - Intergenic
1036315974 8:7718602-7718624 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036317281 8:7726250-7726272 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036318589 8:7733898-7733920 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036319898 8:7741545-7741567 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036321205 8:7749193-7749215 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036322514 8:7756841-7756863 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036323822 8:7764489-7764511 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036325124 8:7772137-7772159 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036352218 8:8019817-8019839 CCAGGCAGGGAGCAGATGCAGGG - Intergenic
1036353517 8:8027465-8027487 CCAGGCAGGGAGCAGATGCAGGG - Intergenic
1036846205 8:12172590-12172612 CCAGGCAGGGAGCAGATGCAGGG - Intergenic
1036867571 8:12414909-12414931 CCAGGCAGGGAGCAGATGCAGGG - Intergenic
1036979693 8:13456532-13456554 CCTGGGAGGCAGGAGTTGCAGGG - Intronic
1037654205 8:20868896-20868918 CATGGCAGGGAGGGAGTGGAGGG - Intergenic
1037712391 8:21365307-21365329 CTTGGAAGGGTGGAGGTGGATGG - Intergenic
1037912070 8:22749463-22749485 CCAGGGAGGGAGGAGATGCAGGG - Intronic
1038243845 8:25835396-25835418 GCTGCCAGGGAGGAGTTGTAAGG + Intergenic
1038367744 8:26953708-26953730 ACTGGCAGGGAGAACTTGGAAGG + Intergenic
1038515825 8:28187050-28187072 CCTGGGAGTGAGGAGATGGTGGG - Intronic
1038542996 8:28404465-28404487 CCTGGGAGGGAAGATCTGGAGGG - Intronic
1039755595 8:40518788-40518810 CCTGGCAGGGAGGAGAGGGCTGG - Intergenic
1040444284 8:47477925-47477947 GCTGGGAAGGAGGAATTGGAGGG + Intronic
1041106933 8:54453704-54453726 GCTGCCAGGGAGGGGTTGGGGGG + Intergenic
1041701974 8:60800496-60800518 TCTGACTGGGAGGTGTTGGAGGG - Exonic
1047749216 8:127867253-127867275 CCTGGGAGGGTGGAGGAGGAGGG + Intergenic
1047856865 8:128920118-128920140 TCTGGCGGGCAGGAGTTGGGGGG - Intergenic
1048182258 8:132206247-132206269 CCTGGCAGGGCAGAATTAGAGGG - Intronic
1048961156 8:139579440-139579462 CCTGGCAGGGGGTAGTGGAAGGG - Intergenic
1049067637 8:140330001-140330023 CCTGGGAGGCAGAAGTTGCAGGG + Intronic
1049199736 8:141334185-141334207 CCTGGCAGGGTGGAGGGGAACGG + Intergenic
1049241187 8:141538109-141538131 AGTGGCAGGGAGGAGCTGGGTGG + Intergenic
1049363603 8:142225863-142225885 TCTGGGATGGAGGAGTTGGCAGG + Intronic
1049365017 8:142232908-142232930 CCTGGAAGGGAGGAGCTGCCTGG + Intronic
1049420018 8:142512301-142512323 CCTGGCAGGCAGCAGTCTGAAGG + Intronic
1049431315 8:142566592-142566614 CCTGGCAGGAAGGAGGCGGCAGG + Intergenic
1049614175 8:143569064-143569086 CCTGGGAGGGAGAAACTGGAGGG + Intronic
1049757549 8:144317445-144317467 CCTGGCAGGGAGGTGGGGGTGGG + Exonic
1049778388 8:144416534-144416556 GCTGGCAGGGCGGAGCTGGCGGG + Intronic
1049910457 9:261144-261166 CCTGGCAGACAGGAGTAGGAGGG + Intronic
1050092416 9:2028263-2028285 TCTGGTAGGGTGGAGTTGGTGGG + Intronic
1051356816 9:16246980-16247002 CAAGGCAGGGAGGAGTTGTGGGG - Intronic
1051382509 9:16472537-16472559 CCAGTCTGGAAGGAGTTGGAAGG - Intronic
1052162834 9:25288388-25288410 TCTGGCAGGCAGGAGTAGGGGGG - Intergenic
1052176731 9:25472103-25472125 CCTGGCTGGGAGGACCTGGCTGG + Intergenic
1052192484 9:25676183-25676205 TCTGGCAGGCAGGAGTGGGGGGG - Intergenic
1052434859 9:28413489-28413511 ACTGAGAGGGAGAAGTTGGAGGG - Intronic
1052885334 9:33641353-33641375 CCTGGCAGAGAGCAGTTGCTGGG + Intergenic
1053122032 9:35554938-35554960 CCTGGCTGGCAGGAATTGAATGG - Intronic
1053142429 9:35690103-35690125 GCTGGCAGGGAAGAGGGGGATGG - Exonic
1053143617 9:35697481-35697503 GCTGGCAGGGTGGAGTGGGCTGG + Exonic
1053691003 9:40587560-40587582 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1054273802 9:63049931-63049953 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1054302263 9:63388531-63388553 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1054401038 9:64715037-64715059 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1054434644 9:65199351-65199373 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1054495745 9:65822330-65822352 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1055363120 9:75516543-75516565 GGTGGCAGGGAGGAGATGGGGGG - Intergenic
1057231797 9:93325688-93325710 CCTCGCAGGAAGGAGCTGGGAGG + Intronic
1057282365 9:93722032-93722054 CCTGGGAGTGAAGAGGTGGAGGG + Intergenic
1057453417 9:95186349-95186371 CCTGGCATTGAGGAGGTAGAAGG - Intronic
1057558464 9:96108286-96108308 CCTTCCAGGGAGGAGTAGGATGG - Exonic
1057761772 9:97880523-97880545 CTTGGCAGGCAGAAGTGGGAAGG - Intergenic
1058182647 9:101816629-101816651 CTTGCCAGCAAGGAGTTGGATGG + Intergenic
1058802171 9:108555229-108555251 CCTGGCTGGTGGGAGTGGGAGGG + Intergenic
1058975890 9:110125365-110125387 CCTGGCTGGCCGGAGCTGGAGGG - Intronic
1059204937 9:112455735-112455757 ACTGGCAGGGAAGAGGTGAAGGG - Intronic
1059863012 9:118485814-118485836 TCTGGCAGGCAGGAGTGGGGGGG + Intergenic
1060224061 9:121780753-121780775 CCAGGCAGGGAGCAGCAGGACGG + Intronic
1060307836 9:122432558-122432580 CATGGCTGGGAGGCCTTGGAAGG + Intergenic
1060380296 9:123163969-123163991 CATGGGAGGCAGGAGTTGGAAGG + Intronic
1061159351 9:128884208-128884230 CCTTGCCTGTAGGAGTTGGAGGG + Intronic
1061912974 9:133734703-133734725 CCGGGCAGGGAGGATGGGGAGGG + Intronic
1061945221 9:133904947-133904969 CCTGGCAGGGAGGGGATGCAGGG + Intronic
1062307006 9:135913291-135913313 CCTTCTGGGGAGGAGTTGGATGG + Intergenic
1062348791 9:136128650-136128672 CCTCGCAGGGAGGAGCTCGGGGG + Intergenic
1062472273 9:136711911-136711933 CCTGGGGGGGCTGAGTTGGACGG - Intergenic
1062681530 9:137784676-137784698 CCTGGCAGGGGGGTGAGGGAGGG + Intronic
1203621660 Un_KI270749v1:133666-133688 CCTGGCACGGAGCAGCTGGGCGG - Intergenic
1187018701 X:15357388-15357410 CCTGGCAGGGAGTAGGGGCAGGG - Intronic
1187885634 X:23886301-23886323 CCGGGGAGGTGGGAGTTGGAAGG + Intronic
1189438036 X:41010058-41010080 CCTGGCAGGGTGTTGTAGGAAGG - Intergenic
1189845100 X:45128668-45128690 CCTAGCAGGGAGAACTTGGGTGG + Intergenic
1190035679 X:47021124-47021146 ACTGGCAGGGAGAAGAAGGAGGG - Intronic
1190521420 X:51281734-51281756 CCTGTCAGGGAGGAGTCAGCAGG + Intergenic
1190764484 X:53464702-53464724 CCTGGGAGGTGGGAGTTGCAAGG - Intergenic
1193637355 X:83968967-83968989 CCTGGCAGGGTGGGGGTGGGTGG - Intergenic
1193892433 X:87066695-87066717 TGTGGAAGGGAGGAGTTGGTGGG - Intergenic
1196525839 X:116726480-116726502 TCTGGCAGGCAGGAGTGGGGGGG + Intergenic
1196815804 X:119664903-119664925 CCTGGCAGGGAGGAGAGGTGGGG - Intronic
1196833203 X:119792057-119792079 CCTGGCTGGGAGGTGTGGGAAGG + Intergenic
1199482422 X:148312071-148312093 CCCGGCTGGTAGGAGTGGGAGGG - Intergenic
1199721440 X:150545546-150545568 CCTTGGAGGGTGGAGTGGGAGGG - Intergenic
1200058008 X:153471567-153471589 CAAGGCAGGAAGGAGTTGGAGGG + Intronic
1200836475 Y:7737188-7737210 CCTGGCAGGGCTGAGTTGAGGGG + Intergenic
1202583938 Y:26405712-26405734 CCTGGCATGGAGCAGCTGGGCGG + Intergenic