ID: 1147161152

View in Genome Browser
Species Human (GRCh38)
Location 17:38570046-38570068
Sequence GTGTTGCGGGGCGCTGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 281}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147161152_1147161159 29 Left 1147161152 17:38570046-38570068 CCACCCACAGCGCCCCGCAACAC 0: 1
1: 0
2: 0
3: 20
4: 281
Right 1147161159 17:38570098-38570120 CTCAGACACATCCTCTGATAAGG 0: 1
1: 0
2: 0
3: 18
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147161152 Original CRISPR GTGTTGCGGGGCGCTGTGGG TGG (reversed) Intronic