ID: 1147161157

View in Genome Browser
Species Human (GRCh38)
Location 17:38570059-38570081
Sequence TGCGTGAGCCTGTGTGTTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 503
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 467}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147161157_1147161159 16 Left 1147161157 17:38570059-38570081 CCCGCAACACACAGGCTCACGCA 0: 1
1: 0
2: 2
3: 33
4: 467
Right 1147161159 17:38570098-38570120 CTCAGACACATCCTCTGATAAGG 0: 1
1: 0
2: 0
3: 18
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147161157 Original CRISPR TGCGTGAGCCTGTGTGTTGC GGG (reversed) Intronic