ID: 1147161158 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:38570060-38570082 |
| Sequence | GTGCGTGAGCCTGTGTGTTG CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 1210 | |||
| Summary | {0: 1, 1: 1, 2: 1, 3: 77, 4: 1130} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1147161158_1147161159 | 15 | Left | 1147161158 | 17:38570060-38570082 | CCGCAACACACAGGCTCACGCAC | 0: 1 1: 1 2: 1 3: 77 4: 1130 |
||
| Right | 1147161159 | 17:38570098-38570120 | CTCAGACACATCCTCTGATAAGG | 0: 1 1: 0 2: 0 3: 18 4: 172 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1147161158 | Original CRISPR | GTGCGTGAGCCTGTGTGTTG CGG (reversed) | Intronic | ||