HTGT WGE

Individual CRISPR Summary

ID: 1147161159

 View in Genome Browser
Species Human (GRCh38)
Location 17:38570098-38570120
Sequence CTCAGACACATCCTCTGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 172}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147161154_1147161159 25 Left 1147161154 17:38570050-38570072 CCACAGCGCCCCGCAACACACAG 0: 1
1: 0
2: 2
3: 26
4: 335
Right 1147161159 17:38570098-38570120 CTCAGACACATCCTCTGATAAGG 0: 1
1: 0
2: 0
3: 18
4: 172
1147161158_1147161159 15 Left 1147161158 17:38570060-38570082 CCGCAACACACAGGCTCACGCAC 0: 1
1: 1
2: 1
3: 77
4: 1130
Right 1147161159 17:38570098-38570120 CTCAGACACATCCTCTGATAAGG 0: 1
1: 0
2: 0
3: 18
4: 172
1147161152_1147161159 29 Left 1147161152 17:38570046-38570068 CCACCCACAGCGCCCCGCAACAC 0: 1
1: 0
2: 0
3: 20
4: 281
Right 1147161159 17:38570098-38570120 CTCAGACACATCCTCTGATAAGG 0: 1
1: 0
2: 0
3: 18
4: 172
1147161153_1147161159 26 Left 1147161153 17:38570049-38570071 CCCACAGCGCCCCGCAACACACA 0: 1
1: 0
2: 6
3: 20
4: 202
Right 1147161159 17:38570098-38570120 CTCAGACACATCCTCTGATAAGG 0: 1
1: 0
2: 0
3: 18
4: 172
1147161157_1147161159 16 Left 1147161157 17:38570059-38570081 CCCGCAACACACAGGCTCACGCA 0: 1
1: 0
2: 2
3: 33
4: 467
Right 1147161159 17:38570098-38570120 CTCAGACACATCCTCTGATAAGG 0: 1
1: 0
2: 0
3: 18
4: 172
1147161156_1147161159 17 Left 1147161156 17:38570058-38570080 CCCCGCAACACACAGGCTCACGC 0: 1
1: 0
2: 2
3: 14
4: 175
Right 1147161159 17:38570098-38570120 CTCAGACACATCCTCTGATAAGG 0: 1
1: 0
2: 0
3: 18
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147161159 Original CRISPR CTCAGACACATCCTCTGATA AGG Intronic