ID: 1147161846

View in Genome Browser
Species Human (GRCh38)
Location 17:38573027-38573049
Sequence CCCGGGACTCGGGTTGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147161838_1147161846 -4 Left 1147161838 17:38573008-38573030 CCGATACGCCGGCCTGGCGCCCG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1147161846 17:38573027-38573049 CCCGGGACTCGGGTTGCAGCAGG 0: 1
1: 0
2: 0
3: 26
4: 104
1147161835_1147161846 6 Left 1147161835 17:38572998-38573020 CCGCGGTCACCCGATACGCCGGC 0: 1
1: 0
2: 0
3: 2
4: 10
Right 1147161846 17:38573027-38573049 CCCGGGACTCGGGTTGCAGCAGG 0: 1
1: 0
2: 0
3: 26
4: 104
1147161837_1147161846 -3 Left 1147161837 17:38573007-38573029 CCCGATACGCCGGCCTGGCGCCC 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1147161846 17:38573027-38573049 CCCGGGACTCGGGTTGCAGCAGG 0: 1
1: 0
2: 0
3: 26
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147161846 Original CRISPR CCCGGGACTCGGGTTGCAGC AGG Intronic
900431824 1:2606349-2606371 CCCAGGACTCGAGTGGGAGCTGG - Exonic
900865444 1:5265759-5265781 CCAAGGACTCGGGGTGCAGTGGG - Intergenic
902349968 1:15847394-15847416 CCGGGGCCTGGGGTTGCCGCTGG + Intergenic
907513439 1:54979130-54979152 CCAGGGATTCAGGTTGAAGCAGG + Intergenic
907634395 1:56118743-56118765 CCAGGGACTGAGGTTGCAGCGGG + Intergenic
910387964 1:86705077-86705099 CCCAGGCCTCTGGCTGCAGCAGG - Intronic
922958503 1:229625665-229625687 CCCGGGACTCGGGAGGCCGAGGG + Intronic
923673861 1:236064395-236064417 CCCGGGACTCTTGTGGCTGCGGG - Intronic
924267815 1:242300748-242300770 AGCGGGACAAGGGTTGCAGCGGG + Intronic
1067410504 10:46060358-46060380 ACCGGGACTGGGGATCCAGCTGG + Intergenic
1068736151 10:60415463-60415485 CTGGACACTCGGGTTGCAGCAGG - Intronic
1070287218 10:75092836-75092858 CCTGGGGCTTGGGTTCCAGCAGG - Intergenic
1070768971 10:79071244-79071266 CCCGGTTCCCAGGTTGCAGCAGG - Intronic
1072976726 10:100065352-100065374 CCCGGGTCTCGGGTTCCACCTGG + Exonic
1075443632 10:122498875-122498897 CCAGGGACTGGGGAGGCAGCAGG - Intronic
1076143189 10:128095948-128095970 CCTGGCACTCTGGTTACAGCTGG - Intergenic
1076792014 10:132781851-132781873 CCAGGAACACGGGCTGCAGCAGG - Exonic
1076948343 10:133666087-133666109 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
1076949332 10:133669397-133669419 ACCGGGACTCGGGTTGCCGTCGG + Intronic
1076950316 10:133672696-133672718 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
1076951301 10:133675995-133676017 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
1076952291 10:133679305-133679327 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
1076953279 10:133682615-133682637 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
1076955247 10:133742266-133742288 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
1076956237 10:133745576-133745598 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
1076957225 10:133748885-133748907 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
1076958214 10:133752195-133752217 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
1076959198 10:133755494-133755516 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
1076960187 10:133758804-133758826 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
1077348361 11:2075637-2075659 CCCGGGTCTCAGCTTGCAGACGG - Intergenic
1083691262 11:64410209-64410231 CCCAGGACGTGGGCTGCAGCTGG - Intergenic
1083901773 11:65646799-65646821 CCCGGGGCGCGGGTCGCCGCCGG + Exonic
1086495367 11:87399065-87399087 CTTGGGACTGGGGTTGGAGCTGG + Intergenic
1090670072 11:128939926-128939948 GCCGGGACTCAGGTTGCACACGG + Intronic
1096498284 12:52051094-52051116 CACCGGACTCGGGTCCCAGCTGG - Intronic
1102026352 12:109715950-109715972 CCCTGGACTAGGGGTGCAGCAGG - Intronic
1103602403 12:122062681-122062703 CCCGAGACCTGGGTTCCAGCAGG + Intergenic
1104866987 12:131961526-131961548 CCCGGGGCTGGGGGCGCAGCGGG + Exonic
1104885536 12:132104894-132104916 CCCGGGGCTGGGGGCGCAGCGGG + Exonic
1106303986 13:28494624-28494646 CCTGGGACACTAGTTGCAGCGGG - Intronic
1106606218 13:31231686-31231708 CCTGGGACTTGGTTTACAGCAGG + Intronic
1110741933 13:79007905-79007927 TCCAGGACTCCAGTTGCAGCTGG + Intergenic
1116835793 14:49768195-49768217 CCCGGGACTCGGGGCACTGCAGG - Exonic
1117156927 14:52950943-52950965 CCCGGGACTCGCGCGGCAACAGG + Exonic
1121047223 14:90796919-90796941 CCTGGGAGTCAGGTTGCAACGGG - Intronic
1202923324 14_KI270724v1_random:3918-3940 ACGGGGACTCGGGTTGCCGTCGG - Intergenic
1124648109 15:31454162-31454184 CCGGGGTCTCGGGTGGCGGCCGG - Intergenic
1125180895 15:36880282-36880304 CCCGGGATTTGGGTAGCAGGTGG + Intergenic
1127382874 15:58444840-58444862 CCCAGGACCCGGGTCACAGCAGG - Intronic
1129377629 15:75144158-75144180 CCAGGCACTCTGGCTGCAGCAGG + Intergenic
1132856700 16:2048164-2048186 CTCCGGAGTCGGGTTGCAGTGGG - Intronic
1132942307 16:2514300-2514322 CCCGGGCCTCGTGTGACAGCGGG + Intronic
1133341996 16:5042681-5042703 CCCGGGACCGGGTTTTCAGCTGG + Intronic
1135407069 16:22206350-22206372 AGCGGGACTCGGGTGGCTGCAGG - Exonic
1135517529 16:23148592-23148614 CCAGGGGCTCGGGGTGCAGTGGG + Intronic
1141206583 16:81937852-81937874 TCTGGGACTCGGGTGGCATCGGG - Exonic
1143548590 17:7614814-7614836 CCCGGGACTGAGGCAGCAGCGGG - Exonic
1145063274 17:19745348-19745370 CTTAGGACTCGGGTTGCGGCGGG - Exonic
1146576851 17:34001571-34001593 CCTGGGAGTCGGCTTGTAGCCGG + Intronic
1147155874 17:38544292-38544314 GCCGGGAGTGGGGTTGCTGCTGG - Intronic
1147161846 17:38573027-38573049 CCCGGGACTCGGGTTGCAGCAGG + Intronic
1148451095 17:47778314-47778336 CCCGGGGCTCTCGGTGCAGCAGG + Intergenic
1150737661 17:67754176-67754198 CCAGGGGCTGGGGCTGCAGCGGG + Intergenic
1153688100 18:7566864-7566886 CCGGCGACTCCGGGTGCAGCTGG + Exonic
1154303306 18:13213396-13213418 CCCGGGACTGGGGATGCTTCGGG + Intergenic
1157596168 18:48865130-48865152 CCCGGGACTCGGCAGGCTGCGGG + Intergenic
1158508649 18:58069884-58069906 GCCGGGAATGGGATTGCAGCAGG - Intronic
1160720745 19:595968-595990 CCCGGGACTCAGGCTCCAGCAGG + Intronic
1163003092 19:14381354-14381376 CCCGGAACTGGCGGTGCAGCTGG - Intronic
1163063603 19:14776909-14776931 CCCGGAACTGGCGGTGCAGCTGG + Exonic
1165258255 19:34592890-34592912 CCCAGGACTCGGGATGCTGGAGG - Intergenic
1165731372 19:38147892-38147914 CCCGGGACTATGGTTCCAGAGGG + Intronic
1166378821 19:42344000-42344022 CCCGGGACCCGGAATGCAGTTGG + Exonic
1168400231 19:56081306-56081328 CCAGGCACTGGGGATGCAGCGGG - Intergenic
926329070 2:11810083-11810105 CCCTAGACTCTGGTTGCACCAGG + Intronic
930022248 2:47008514-47008536 CCCGGGAGTGGGCTTGCATCAGG + Intronic
934736502 2:96692312-96692334 CCAGGGACAAGGCTTGCAGCTGG - Intergenic
938062010 2:128261811-128261833 CCCGGGCCTCGGGCTTCAGGGGG - Intronic
1172934475 20:38609860-38609882 CCTGGCCCTGGGGTTGCAGCCGG - Intronic
1176103132 20:63373566-63373588 CCAGTGTCTCGGGGTGCAGCCGG + Intronic
1180211486 21:46297592-46297614 CCCGGGTCAGGGGCTGCAGCCGG - Exonic
1180962905 22:19770344-19770366 CCAGGGCCTGGGGGTGCAGCTGG + Intronic
1181064557 22:20299380-20299402 GCCGGGCCTCGGGTTGGGGCGGG + Intergenic
1181085193 22:20436590-20436612 CCCTGGACTCGGCTTGCCCCGGG + Intronic
1182863233 22:33579568-33579590 CCCTGGGCTGGGGCTGCAGCAGG - Intronic
1184465830 22:44668617-44668639 CCAGGGACTCGGGGCGCTGCAGG - Intronic
1184636845 22:45839449-45839471 ACAGGGACACTGGTTGCAGCTGG - Intronic
1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG + Intronic
1185275708 22:49949476-49949498 CCCAGGACACGGTGTGCAGCTGG + Intergenic
950095654 3:10328753-10328775 CCCGGAAAGCGGGTGGCAGCGGG + Exonic
955768936 3:62371157-62371179 CTCAGGACTCGGGTCGCGGCTGG - Intronic
961350786 3:126300615-126300637 CCTGGGGCTCTGGTTGCAGGAGG - Intergenic
961458190 3:127034480-127034502 CCCGGGGCCCGGTTGGCAGCTGG + Exonic
968516169 4:1016527-1016549 CCTGGGGCTGGGGTTGCAGAAGG + Intronic
968755127 4:2411826-2411848 TCCAGGGCTCGGGTGGCAGCGGG - Intronic
982069546 4:151683341-151683363 CCCAGGAGTCAGGGTGCAGCGGG - Intronic
984824993 4:183916171-183916193 CCCGGGCCAGGGGTGGCAGCCGG + Intronic
985451797 4:190066891-190066913 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
985452785 4:190070183-190070205 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
985453771 4:190073476-190073498 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
985454760 4:190076769-190076791 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
985455750 4:190080066-190080088 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
985456733 4:190083360-190083382 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
985457720 4:190086656-190086678 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
985458708 4:190089953-190089975 ACCGGGACTCGGGTTGCCGTCGG + Intergenic
986566370 5:9119039-9119061 CCTGGGAGTGGGGTTGCTGCAGG + Exonic
989229799 5:39073870-39073892 TCCGGGCCTCGGGCTGCTGCGGG - Intronic
1005577708 6:27205511-27205533 CCCAGGACGCAGGTGGCAGCGGG - Intergenic
1005826294 6:29633205-29633227 CCCGGGGCTCGGGTTGTGGGAGG - Intronic
1007932121 6:45700749-45700771 CCGGGCACTCCTGTTGCAGCAGG + Intergenic
1013308409 6:108871384-108871406 CACGGGACTCGGGTTGCGGGGGG - Intronic
1014968872 6:127790808-127790830 CCAGGCACTCTGGCTGCAGCAGG + Intronic
1017805398 6:157941319-157941341 CCTGGGACTCCGTTGGCAGCTGG + Intronic
1023294309 7:38699192-38699214 CCCGGGGCATGGGTGGCAGCCGG + Intergenic
1023627619 7:42132005-42132027 CCTGGGACTAGGGTTGGAGAAGG + Intronic
1034397308 7:150836878-150836900 CCAGAGACTCTGGGTGCAGCTGG + Intronic
1036480083 8:9131789-9131811 CACAGGACTGAGGTTGCAGCTGG + Intergenic
1041103282 8:54417909-54417931 GCTGGGACACAGGTTGCAGCTGG - Intergenic
1048275928 8:133065915-133065937 CCCGGGTCTGGGTTTCCAGCGGG + Intronic
1048301574 8:133255090-133255112 CCAGTGACTAGGTTTGCAGCAGG + Intronic
1049038749 8:140097063-140097085 CCCAGGTCTCAGGTTGCAGGTGG + Intronic
1049324472 8:142014889-142014911 CCCGGGACTCTGGCAGCAGCAGG - Intergenic
1049354337 8:142180118-142180140 CCTGGGACTCGGGCAGCAGGAGG + Intergenic
1049765321 8:144352694-144352716 CGCGGGCCTGGGGTTCCAGCGGG + Intronic
1049918541 9:342157-342179 CCATGGACTGGGGTGGCAGCGGG - Intronic
1053381288 9:37651186-37651208 CCCGGGACTGGTGGTGCAGGCGG - Intronic
1061037565 9:128122109-128122131 CCCGGGCCTCTGGATCCAGCAGG + Intronic
1061851341 9:133417868-133417890 CCGGGGTCTCGGGTGGCCGCCGG - Exonic
1061866073 9:133492411-133492433 GCAGGGACTCGGGGGGCAGCGGG - Intergenic
1062553921 9:137105453-137105475 CCAGGGCCTCTGGTTGCTGCCGG + Intronic
1196465613 X:115969042-115969064 CGCGGGAGTCGCGTTGCCGCAGG - Intergenic