ID: 1147164231

View in Genome Browser
Species Human (GRCh38)
Location 17:38585007-38585029
Sequence CCCTCTCTGTGGAGATAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 190}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147164220_1147164231 17 Left 1147164220 17:38584967-38584989 CCAGCCCCAAACTCAAGATCTGG 0: 1
1: 0
2: 1
3: 17
4: 182
Right 1147164231 17:38585007-38585029 CCCTCTCTGTGGAGATAAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 190
1147164224_1147164231 11 Left 1147164224 17:38584973-38584995 CCAAACTCAAGATCTGGAAATCA 0: 1
1: 0
2: 0
3: 25
4: 268
Right 1147164231 17:38585007-38585029 CCCTCTCTGTGGAGATAAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 190
1147164218_1147164231 19 Left 1147164218 17:38584965-38584987 CCCCAGCCCCAAACTCAAGATCT 0: 1
1: 0
2: 2
3: 34
4: 348
Right 1147164231 17:38585007-38585029 CCCTCTCTGTGGAGATAAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 190
1147164219_1147164231 18 Left 1147164219 17:38584966-38584988 CCCAGCCCCAAACTCAAGATCTG 0: 1
1: 1
2: 2
3: 21
4: 236
Right 1147164231 17:38585007-38585029 CCCTCTCTGTGGAGATAAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 190
1147164217_1147164231 22 Left 1147164217 17:38584962-38584984 CCTCCCCAGCCCCAAACTCAAGA 0: 1
1: 0
2: 4
3: 46
4: 465
Right 1147164231 17:38585007-38585029 CCCTCTCTGTGGAGATAAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 190
1147164222_1147164231 13 Left 1147164222 17:38584971-38584993 CCCCAAACTCAAGATCTGGAAAT 0: 1
1: 0
2: 1
3: 28
4: 306
Right 1147164231 17:38585007-38585029 CCCTCTCTGTGGAGATAAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 190
1147164223_1147164231 12 Left 1147164223 17:38584972-38584994 CCCAAACTCAAGATCTGGAAATC 0: 1
1: 0
2: 0
3: 26
4: 307
Right 1147164231 17:38585007-38585029 CCCTCTCTGTGGAGATAAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147164231 Original CRISPR CCCTCTCTGTGGAGATAAGG AGG Intronic
901447073 1:9315104-9315126 CCCTCTCTGTAGAGGTGAGGAGG + Intronic
902664150 1:17925853-17925875 CCCCCTCTGTGGGGAGAAGACGG - Intergenic
905205424 1:36340479-36340501 GCCTCTCTGAGGACATATGGGGG + Exonic
906462234 1:46043668-46043690 CCCTCGCTTTGCAGATAAAGAGG - Exonic
908408044 1:63834155-63834177 CCCTCTCGGTGGAGCTGAGATGG + Intronic
908959767 1:69682342-69682364 CCCTCTCCTTGGATATAAGCTGG - Intronic
909573309 1:77142783-77142805 CCCCATGTGTGGAGAGAAGGAGG - Intronic
911472635 1:98336995-98337017 CCCACTCTTTTGTGATAAGGTGG - Intergenic
911968997 1:104406806-104406828 CCCTCCCTGTGGTGATGGGGGGG + Intergenic
914876663 1:151517417-151517439 CCATCTCACTGGAGAAAAGGGGG - Intronic
917745327 1:178001125-178001147 CCCTCTCTGGGAAGATCTGGTGG - Intergenic
920007319 1:202842910-202842932 CCCTCTCTGTGGAGTTGACTGGG - Intergenic
923500120 1:234557532-234557554 TCCTCTCTCTGGAGGTAGGGTGG + Intergenic
1063379709 10:5576710-5576732 CCCTCTCAGTGGGGACAAGGAGG + Intergenic
1063829539 10:9935993-9936015 CACTCCCTGTGGAGATAACTGGG - Intergenic
1064187057 10:13171139-13171161 CACTCTCTTTGGAGATATGGAGG + Exonic
1064305915 10:14166393-14166415 CTCTCTCTGTGGAGATACACTGG + Intronic
1067290674 10:44937485-44937507 CCCTCTCTGCTGAGGTAGGGAGG - Intergenic
1068798051 10:61106095-61106117 CCCTCTCTGTGTGGATTTGGGGG - Intergenic
1069420200 10:68240071-68240093 CCCTCTCAGTGGAGGTCAGTAGG - Intergenic
1069596912 10:69678002-69678024 CCCACTCTGGGGAGACAAAGGGG - Intergenic
1069688019 10:70331593-70331615 CCCTCTCTGTCCAGAAGAGGGGG - Intronic
1069729109 10:70599742-70599764 GCCTCTCTGTGGAGGAAACGTGG + Intronic
1070366315 10:75740606-75740628 CTCTCTGTGTAGGGATAAGGGGG - Intronic
1070544941 10:77444926-77444948 CTCTGTCTGGGGAGATAATGTGG - Intronic
1072003952 10:91224165-91224187 CCCTGCCTGGGGAGATAAAGTGG + Intronic
1074823855 10:117200951-117200973 CAGTCCCTATGGAGATAAGGAGG - Intronic
1075397604 10:122139204-122139226 CTCTCTCTGTGAAGGTAAAGTGG + Intronic
1081648809 11:44809297-44809319 ACCTCTCGGTGGAGATAAATGGG - Intronic
1082942544 11:58723010-58723032 CCCTCTATGGTGAGATAAGGAGG - Intronic
1084038684 11:66529356-66529378 ACCTCCCTGTGGAGATGAGCAGG + Intronic
1084419939 11:69055339-69055361 ACCTCTCTGTGAAGGTGAGGCGG + Exonic
1084442126 11:69180583-69180605 CCCTCTGTGTGGAGTTGGGGTGG - Intergenic
1084664471 11:70569146-70569168 CCCTCTCTGTGGGACTGAGGTGG - Intronic
1088138144 11:106582043-106582065 CCCTCTCCTTGCAGAAAAGGTGG - Intergenic
1089414588 11:118276732-118276754 CCATCTCAGGGGAGAAAAGGGGG + Intergenic
1090113605 11:123942668-123942690 CCTTCTCTGTGGGGAGGAGGAGG + Intergenic
1091955404 12:4637356-4637378 CCATCTCTTTGGAGAGAATGTGG - Intronic
1096460074 12:51817461-51817483 CATTCTCAGTGGAGATAAAGTGG - Intergenic
1096616592 12:52836536-52836558 TCCTCTCTGTGGAGGGCAGGAGG - Intergenic
1096771217 12:53937195-53937217 TCCTCTTTGTGGGGAGAAGGTGG - Intergenic
1097175880 12:57142763-57142785 CCCCCTCTGTGGAGAAAGGCTGG + Intronic
1097997748 12:65908059-65908081 CACTCTTTGTGGAGAAAAGAAGG + Intronic
1101658735 12:106747571-106747593 TCCTCTCTGTGGGGATAAACTGG - Exonic
1103578057 12:121893465-121893487 CCAACTCTGTGGTGTTAAGGTGG - Intronic
1103903571 12:124315848-124315870 CTCCCTCTGTGGAGGTGAGGAGG + Exonic
1104149694 12:126070798-126070820 CCCTGACTGTGGAGGAAAGGAGG + Intergenic
1104273809 12:127306414-127306436 CCCTCCCTTGGGAAATAAGGAGG - Intergenic
1107830563 13:44371303-44371325 TCCTCTCTGTGGAGGTCTGGGGG + Intergenic
1111134908 13:84028419-84028441 CCCTTTTTCTGGATATAAGGAGG - Intergenic
1112506417 13:99979061-99979083 CTCTCTCTGTGCATAAAAGGGGG - Intergenic
1118385964 14:65255884-65255906 CACTCTCTGGTGAGATGAGGAGG - Intergenic
1118615083 14:67569584-67569606 CCCTCGTTGTGGAGATTTGGTGG - Intronic
1120179449 14:81328723-81328745 CCCTCCCTGGGGAGGCAAGGGGG + Intronic
1120750593 14:88194104-88194126 GCTTCTCTGAGGAGATTAGGAGG - Intronic
1121052651 14:90829721-90829743 CCCTCACTGTAGAAACAAGGGGG - Intergenic
1122612779 14:102997130-102997152 CCCCCTCCGTGGTGATCAGGAGG - Intronic
1123790194 15:23711933-23711955 CAGTCTCTGAGGAGGTAAGGAGG + Intergenic
1127832556 15:62763682-62763704 ACATCTCTGTGGAGGTAAGCTGG + Exonic
1128220922 15:65967949-65967971 CCCTCACTTTAGAGTTAAGGAGG + Intronic
1129580838 15:76808159-76808181 CCCTTTCTGTGGAGAAACTGGGG - Intronic
1130096870 15:80862582-80862604 CCCTCTCCATGCAGATAAGATGG + Intronic
1130101611 15:80898859-80898881 ACCTCCCTGTGGAGGAAAGGTGG - Intronic
1131409233 15:92192407-92192429 TCCTCTCTGGTGAAATAAGGAGG - Intergenic
1131897294 15:97047710-97047732 TCCTCTCTGTTGAGACAAAGAGG + Intergenic
1132544332 16:526401-526423 CCCCCTCTGTGGAGACAGGCAGG - Intergenic
1139086820 16:63597235-63597257 ACCTCTCTTTGAAAATAAGGAGG - Intergenic
1139194311 16:64900855-64900877 CCATCACTGTGGGGGTAAGGGGG - Intergenic
1140477896 16:75248171-75248193 ACCCCTCGGTGGAGATAAAGTGG - Intronic
1140748716 16:78003965-78003987 CCCTCTCTGTGGGGGTGAGATGG + Intergenic
1141801951 16:86315735-86315757 CCTTCTCTGTAGAGATAAGTTGG + Intergenic
1141805025 16:86336609-86336631 CCCTCTGCGTGGGGATGAGGAGG - Intergenic
1141805061 16:86336759-86336781 CCCTCTGCGTGGGGATGAGGAGG - Intergenic
1141805084 16:86336849-86336871 CCCTCTGCGTGGGGATGAGGAGG - Intergenic
1141805093 16:86336879-86336901 CCCTCTGCGTGGGGATGAGGAGG - Intergenic
1141805102 16:86336909-86336931 CCCTCTGCGTGGGGATGAGGAGG - Intergenic
1141805150 16:86337119-86337141 CCCTCTGCGTGGGGATGAGGAGG - Intergenic
1141805159 16:86337149-86337171 CCCTCTGCGTGGGGATGAGGAGG - Intergenic
1144242069 17:13322431-13322453 CTCTCATTGTGGAGATAAGAGGG - Intergenic
1146005078 17:29155808-29155830 CCATCTCTGAGGAGAGAATGAGG - Intronic
1147164231 17:38585007-38585029 CCCTCTCTGTGGAGATAAGGAGG + Intronic
1147600712 17:41743669-41743691 CCTCCACTGTGGAGAGAAGGGGG - Intergenic
1152279404 17:79376418-79376440 CCCTCTCTCTGCAGATACTGGGG + Intronic
1152621821 17:81368642-81368664 CCTTCTCTGGGGAGACCAGGAGG + Intergenic
1153805893 18:8707501-8707523 CCCCCTCCGTGGAGAAAAGATGG - Intronic
1156481253 18:37437729-37437751 CTCTGGCTGTGGAGATCAGGAGG - Intronic
1162352370 19:10158464-10158486 CCCTCTCTGTGAAGAGGAGGGGG - Intronic
1165119412 19:33549467-33549489 CCCTCTCTGTAGAGCCAAGCGGG + Intergenic
1165827001 19:38711262-38711284 CTCTCTCTGTGCAGATATTGTGG + Intronic
1166327967 19:42062757-42062779 CCATATCTGTGGAGAGAAGGAGG - Exonic
1167047970 19:47062354-47062376 CCCAGTCTGTGGAGATACGTAGG + Intergenic
925760706 2:7181856-7181878 CCCTCCCTGCTGAGATAAGAGGG - Intergenic
928613728 2:33016177-33016199 CCCTCTGTGCAGAGACAAGGAGG + Intronic
931207530 2:60162584-60162606 CACTCCCTCTGGACATAAGGTGG + Intergenic
933780996 2:85801102-85801124 CCCTCTCTCTGGATGGAAGGTGG + Intergenic
934974365 2:98790220-98790242 CCCTCTCTGTGGAAAAGTGGGGG - Intergenic
935276249 2:101477340-101477362 CAGTCTCTGTGGACATAAGCAGG - Intergenic
937544512 2:123000726-123000748 CCTTTTCTTAGGAGATAAGGAGG - Intergenic
939861427 2:147425430-147425452 CCTTCTCTTTGGAGGTCAGGTGG - Intergenic
941938388 2:171005742-171005764 CCCTCTCTGTGGAGGTTATATGG - Intronic
943910413 2:193559293-193559315 CCCTCTCTCTGCAGAGAAAGAGG - Intergenic
945320022 2:208410399-208410421 CCCTCATTGTGGAGATCAGCTGG + Intronic
948514429 2:238494913-238494935 CCCTCTCTGTGAATATGAGGTGG - Intergenic
1169503251 20:6181918-6181940 GCCTCCCAGTGGAGCTAAGGAGG - Intergenic
1173258005 20:41408725-41408747 CCCTCTCTCTGGAGTTATGAGGG - Intronic
1175166419 20:57047594-57047616 CCCTCTCTGTGGACAGGGGGAGG - Intergenic
1175196591 20:57247899-57247921 CCCTATCTCAGGAGATCAGGAGG + Intronic
1175864981 20:62170703-62170725 CCCTTTCTTTGGGGATAGGGCGG + Intronic
1175964712 20:62654775-62654797 TCTTCACTGTGGAGCTAAGGTGG - Intronic
1176387538 21:6146257-6146279 GCCTCTGTGTGGGGATAGGGAGG - Intergenic
1177506174 21:22020390-22020412 GTCTCTCTGTGGCGATATGGAGG + Intergenic
1177933505 21:27315690-27315712 CCCCCACTCTGGAGATAAGTAGG - Intergenic
1179175989 21:39008699-39008721 TCCTCTCTGAGGTGACAAGGTGG - Intergenic
1179728406 21:43353757-43353779 TCCTCTCTGGGGAGAAAAAGGGG - Intergenic
1179735934 21:43391991-43392013 GCCTCTGTGTGGGGATAGGGAGG + Intergenic
1181626749 22:24127308-24127330 CCCTCCCTGTGGAGTTGATGAGG - Intronic
1181674302 22:24441790-24441812 GCTGCTCTGTGGAGACAAGGTGG - Exonic
1182034872 22:27190103-27190125 CCCTCTATATGGAAATAAGTGGG - Intergenic
1182394930 22:30028387-30028409 CTCTCTGTGTGGAGAGAGGGCGG - Intronic
1182458634 22:30468953-30468975 CCCTTTCTGTGGAGAAGAGTCGG + Intronic
1182638622 22:31749696-31749718 TCCTCTCCGAGGAGATAAGTTGG + Intronic
1183253739 22:36747444-36747466 GCCTCTCTGTGGAGACATGAAGG - Intergenic
1183324242 22:37182918-37182940 CCCTCTCTGTGAAGTGAAGACGG - Intronic
1184310332 22:43637161-43637183 GCCTTTCTGGGGAGATAGGGAGG - Intronic
950251385 3:11468568-11468590 CCCTCTCTGTGGGGATCGAGAGG - Intronic
950781982 3:15400018-15400040 CCATCTCTAGGCAGATAAGGGGG - Intronic
951030697 3:17878258-17878280 CCTTGTCTGTGATGATAAGGGGG - Intronic
951351009 3:21606780-21606802 CTCTCTCTGTGGAGGTAATTAGG + Intronic
951356431 3:21672481-21672503 TCCTCTCTGTGGTCATAAGCAGG - Intronic
951845094 3:27076791-27076813 CCCTCTCAGTGGATATAATTGGG + Intergenic
956780726 3:72601088-72601110 TCCTCTCTGTGGAGCCAAGGAGG - Intergenic
957012774 3:75027354-75027376 CCCTCTCTGACTAGGTAAGGAGG - Intergenic
957623936 3:82633563-82633585 CCTTCCCTGTGGAGAAAAAGGGG - Intergenic
958832936 3:99111408-99111430 CTCTCTCTATGGAGAGGAGGAGG + Intergenic
959099488 3:101994096-101994118 CCTTCTCTGTGGAAATGTGGTGG - Intergenic
959157508 3:102684736-102684758 CCTTCTCTGTGGATGTAGGGAGG - Intergenic
963796010 3:149631651-149631673 CCCTCTCTGAGAAGATACAGCGG - Intronic
963956182 3:151256468-151256490 CACTCCCTGTGGAGACAGGGTGG - Intronic
964800815 3:160555396-160555418 CACACCCTGTGCAGATAAGGGGG - Intronic
965980362 3:174682108-174682130 CCCTCTGCCTGGAGAGAAGGGGG + Intronic
966538344 3:181060870-181060892 TCCCCTGTGTGGAGATAAAGAGG + Intergenic
966629386 3:182055580-182055602 CCCTCTCAGTGGAGAGAATTAGG + Intergenic
969365294 4:6690563-6690585 CCATCTCCGTGGTGATAGGGCGG + Intergenic
970067598 4:12116608-12116630 CCCACTCTGTGGAGATAACCTGG - Intergenic
970580682 4:17471575-17471597 CCCTCTCTGGGGAGTGAAGAAGG + Intronic
971695175 4:29892531-29892553 GCTTCTCTGTGAAGATTAGGAGG - Intergenic
972973669 4:44607483-44607505 CACTGTATTTGGAGATAAGGAGG - Intergenic
976145951 4:82043272-82043294 CTCTTACTGTAGAGATAAGGAGG + Intronic
977617314 4:99101051-99101073 CCCTCACTGTGGAGATGGGAAGG - Intergenic
979504873 4:121484860-121484882 CCAGCTCTCTGGAGATGAGGAGG - Intergenic
982853648 4:160352838-160352860 CCCTCTCTGTGCAGATGACATGG - Intergenic
983663654 4:170157724-170157746 CCCTCACTGTGGAGAGATTGAGG - Intergenic
985611886 5:893686-893708 CACCCTCCGTGGACATAAGGAGG - Intronic
985691213 5:1313709-1313731 CCCTCTCAGTGGAAACCAGGCGG - Intergenic
996281966 5:121740920-121740942 CCCTCTCTGAGGAGGTAACATGG + Intergenic
997414614 5:133715855-133715877 CCCACTCTGTGGAGCTGAGTGGG - Intergenic
998094814 5:139391174-139391196 CCCTCTGTGTGGCCAGAAGGTGG - Exonic
1002976300 6:2081333-2081355 CCCTCTCTGTGCAGCTCAGTAGG + Intronic
1003614879 6:7645968-7645990 CTCTCTCTGTGGTCATAAGATGG - Intergenic
1006343043 6:33457447-33457469 GCCCCTCTGTTGAGATATGGAGG + Exonic
1006973196 6:38068591-38068613 CCCTCTCTTGGGACTTAAGGAGG - Intronic
1007285536 6:40744762-40744784 CCTTCTGTGTGCAGACAAGGAGG - Intergenic
1008503074 6:52202407-52202429 CACTTTCTGGGGAGATAATGAGG - Intergenic
1011174964 6:84550170-84550192 GTCACTCTGTGGAAATAAGGAGG - Intergenic
1014391581 6:120872043-120872065 CCAAGTCTGTGGAGGTAAGGGGG - Intergenic
1014630869 6:123788435-123788457 CTCTCTCTGTGAACATAAGCTGG - Intergenic
1017254132 6:152314054-152314076 GCCTCTCTTTGGAGATTAGGAGG - Intronic
1019495719 7:1339544-1339566 CCCTGTCTTTTGAGAGAAGGGGG - Intergenic
1019686405 7:2384424-2384446 CCCTCACTGAGGAGATGGGGAGG - Intergenic
1020111996 7:5452501-5452523 CCCTCTGTGTGGGGACAGGGTGG - Intronic
1021600834 7:22361706-22361728 CTCTCTCTATAGAGAGAAGGGGG - Intergenic
1021770839 7:23999424-23999446 CCCTCTTTCTTGAGATGAGGAGG + Intergenic
1024819420 7:53310167-53310189 CCATCTCTGTGGACATAATTTGG + Intergenic
1025930491 7:65989796-65989818 CCCTATCTCTGGAAATATGGGGG + Intergenic
1025942924 7:66086919-66086941 CCCCCGCTGAGCAGATAAGGCGG - Intronic
1026353942 7:69541036-69541058 CTCTCACGGTGGAGAGAAGGAGG - Intergenic
1026479104 7:70763376-70763398 CCCTCTCCCTGGGGATCAGGTGG + Intronic
1029312807 7:99683301-99683323 CCCTATCAGTGGAGAGAAGTAGG + Intergenic
1029320629 7:99756330-99756352 CCCTATCAGTGGAGAGAAGTAGG + Intergenic
1029457595 7:100678956-100678978 CCCCCACTGTGGAGATAAGAAGG + Exonic
1031095131 7:117408135-117408157 CTCTCTCTGTGGAGGTCAGGGGG + Intronic
1033102232 7:138483924-138483946 CCCTCTCTGTGGAAGTAGAGTGG + Intronic
1033710593 7:143939089-143939111 CCCTCCCTGTGGAGGGAAGTAGG + Intergenic
1034539544 7:151747860-151747882 CACTCTCAGTGGGGCTAAGGGGG + Intronic
1035399166 7:158553581-158553603 GCCTCTGTGTGTAGACAAGGAGG - Intronic
1036593859 8:10194538-10194560 CTCACTCTGTGGAAATGAGGAGG - Intronic
1037316757 8:17606581-17606603 CCATCTCTGGGGAAATACGGAGG - Intronic
1038482267 8:27909824-27909846 CCCTCTCTGAGGAGAGGAAGGGG + Intronic
1042703708 8:71644362-71644384 CCCTCTCTGGAGAGATAGGCTGG + Intergenic
1042785182 8:72537732-72537754 TCCTCTCTGTGGAGGGGAGGGGG + Exonic
1044751388 8:95419588-95419610 TCCTCTCTGTGGAGTTGGGGTGG + Intergenic
1048641142 8:136363232-136363254 TCCTCTCTCTGGAGGTAAGGTGG - Intergenic
1049333888 8:142071747-142071769 CCCTCTCTGCGCAGAGAATGTGG - Intergenic
1049339744 8:142105692-142105714 CCCTATCTGGGGGGACAAGGTGG + Intergenic
1053105794 9:35406640-35406662 CCCTCTCCATGGAGAAACGGTGG + Intergenic
1054970395 9:71079579-71079601 CCCTCTGGTTGGAGATAAGCTGG + Intronic
1055870786 9:80876788-80876810 CCGTCTGAGTGGACATAAGGAGG + Intergenic
1057277479 9:93683731-93683753 CCCCCACTCTGGAGATGAGGAGG - Intergenic
1058155747 9:101512782-101512804 TCCTCTCCGTGGATTTAAGGGGG + Intronic
1059578642 9:115519686-115519708 TCCTCTCTGTAGATATAATGGGG - Intergenic
1060249775 9:121976567-121976589 CCTTCTCTGTGGATTCAAGGAGG + Intronic
1062497879 9:136840140-136840162 TCCTGTCTGTGCAGGTAAGGAGG + Exonic
1194827359 X:98579137-98579159 CCCACTCAGGGGAGAGAAGGGGG + Intergenic
1197757101 X:130003019-130003041 CCCACTCTGCAGAGATGAGGAGG + Intronic
1200236954 X:154472381-154472403 CCCTAGCTGTGGAGAGGAGGAGG + Intronic