ID: 1147165589

View in Genome Browser
Species Human (GRCh38)
Location 17:38591520-38591542
Sequence CTTTAGTAACAGAAGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 265}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147165589_1147165595 22 Left 1147165589 17:38591520-38591542 CCTCTCTGCTTCTGTTACTAAAG 0: 1
1: 0
2: 1
3: 28
4: 265
Right 1147165595 17:38591565-38591587 GCCCACACAGCACATGTGCCAGG 0: 1
1: 0
2: 3
3: 18
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147165589 Original CRISPR CTTTAGTAACAGAAGCAGAG AGG (reversed) Intronic
902560646 1:17275138-17275160 TAATAGTAACAGAAGAAGAGTGG + Intronic
905194450 1:36264264-36264286 GTTTAGCCACAGAACCAGAGTGG - Intronic
905994694 1:42371404-42371426 CTCTAGTAGCAGAACCAGAGAGG + Intergenic
906086473 1:43139439-43139461 CTTAGGTAGCCGAAGCAGAGAGG - Intergenic
906855536 1:49300479-49300501 ATTTAGTAACAAAACCAAAGGGG + Intronic
907803331 1:57793507-57793529 CCTCAGTACCAGCAGCAGAGAGG - Intronic
908606288 1:65800454-65800476 CTTTAGTAACTGAATAAGTGAGG + Intronic
909603292 1:77482917-77482939 CTTTGGTATCAGAAGCTTAGTGG - Intronic
910133545 1:83938471-83938493 CGTAAGTAACATAAGCCGAGAGG + Intronic
910374958 1:86558505-86558527 CTTTATTAACAGCATAAGAGTGG - Intronic
911468369 1:98283705-98283727 CTTATTTACCAGAAGCAGAGAGG + Intergenic
911569620 1:99507599-99507621 CTTCAGCAACAGAGGGAGAGGGG - Intergenic
913267290 1:117057443-117057465 CTTCGGTTACAGAAGCAGACTGG - Intergenic
913536449 1:119777615-119777637 CTCTAGTAATAGAAACAGTGTGG + Intergenic
916024615 1:160822999-160823021 CTCTGGTTAGAGAAGCAGAGAGG - Intronic
916402683 1:164466169-164466191 CTTGAGTAACAGGAGGAGGGAGG - Intergenic
918067643 1:181112319-181112341 CTGAAGAAACAGAAGCAGACAGG - Intergenic
918450275 1:184650857-184650879 TTTCTGTAAAAGAAGCAGAGTGG + Intergenic
919668851 1:200320264-200320286 TTTTAGTAACTCAAGCAAAGTGG + Intergenic
922656753 1:227391458-227391480 ATTGGGTAACAGAAGCAAAGAGG + Intergenic
923119061 1:230973775-230973797 CTTTGGTAAGAAGAGCAGAGGGG + Intronic
924931100 1:248733101-248733123 CTAAAGGAACAGAAGCTGAGAGG + Intronic
1064076222 10:12270926-12270948 CTTAAGAAGCAGAAGTAGAGAGG - Intergenic
1064560103 10:16587523-16587545 CTTCAGTAACAAAACCAGAAAGG - Intergenic
1065747221 10:28853518-28853540 CTTCAGGACCAGAAGCAGGGTGG + Intronic
1066224090 10:33365491-33365513 CGTCAGTAGCAGAAGCAGAGAGG + Intergenic
1066304802 10:34130083-34130105 CGTGAGTTACAGAAGTAGAGCGG - Intronic
1067840600 10:49674867-49674889 CTATAGTAACAAAAACAGCGTGG + Intergenic
1068491951 10:57735550-57735572 CTTTTGTAACAGATACAGAGGGG + Intergenic
1070209952 10:74306740-74306762 CTCTAGGAACAGAAGCAAACAGG - Intronic
1070479016 10:76862912-76862934 CATTATTAACAGAAGCAAAATGG - Intergenic
1070678335 10:78431072-78431094 CTGTGGAAAGAGAAGCAGAGAGG - Intergenic
1073110890 10:101062460-101062482 CTTTGGTACAAGAAGCAGTGAGG + Intronic
1076897792 10:133322459-133322481 CTTAGGTAGCCGAAGCAGAGAGG - Intronic
1076907023 10:133367852-133367874 CTTAGGTAGCCGAAGCAGAGAGG - Intronic
1077882714 11:6363768-6363790 CTTTAGTAACCTAGGCACAGAGG - Intergenic
1080689091 11:34540943-34540965 CTTCAGGGGCAGAAGCAGAGAGG - Intergenic
1083133084 11:60645408-60645430 CTATAGTAAAGAAAGCAGAGTGG - Intergenic
1084345132 11:68541972-68541994 TTCTTGTAACAGGAGCAGAGAGG + Intronic
1087751370 11:102011086-102011108 CTTTGGCAAAAGAAGGAGAGTGG - Intergenic
1087812562 11:102623828-102623850 CTTTAGTTTCAGAATCACAGTGG + Intronic
1088766321 11:112982962-112982984 ATTTAGAGAGAGAAGCAGAGAGG + Intronic
1089546513 11:119231075-119231097 CTTGAGGAACAGGAACAGAGAGG - Intronic
1091523150 12:1268522-1268544 CTTTAGGAACAGAGGAAGAGGGG + Intronic
1091798226 12:3309232-3309254 CTTAAGGAACACAAGGAGAGGGG + Intergenic
1092358664 12:7817821-7817843 GTTTACTTACAGCAGCAGAGGGG + Exonic
1093185074 12:16010613-16010635 GTTTATGAACAGAAGGAGAGAGG + Intronic
1094089415 12:26631342-26631364 CTTTAGAAACAAAAACAGAGAGG + Intronic
1095198798 12:39357596-39357618 CTTTAGTAACAAATGCATTGTGG - Intronic
1095509102 12:42929865-42929887 CTTCAGTAACACGAGCAGAGTGG - Intergenic
1097235501 12:57536693-57536715 CCCTAGAAACTGAAGCAGAGAGG + Intronic
1098872321 12:75830542-75830564 CTACAGTAACAGAAGCAGCATGG + Intergenic
1100105926 12:91171900-91171922 CTGTAGTAACAGGAGCATAGTGG + Intronic
1100501980 12:95183166-95183188 CTTTATCAGCAGAAGCATAGTGG - Intronic
1100881904 12:99028466-99028488 CTTTTATAACAGAAGCTAAGTGG - Intronic
1102876977 12:116456613-116456635 CTTCAGTAACATAAGCACAGAGG - Intergenic
1104044821 12:125154307-125154329 CTTTAGCAACAGGCACAGAGGGG - Intergenic
1104803012 12:131567488-131567510 CATTAGAAACAAAAGGAGAGAGG - Intergenic
1106684568 13:32044559-32044581 CTCTAGAGACAGAAGCAGATTGG - Intronic
1109702916 13:66049634-66049656 CATTAGAAACTGAAGCAGACTGG + Intergenic
1110010766 13:70331094-70331116 CTTTAGTAACATATGCAAAGTGG + Intergenic
1110552153 13:76822042-76822064 GTTTAGTGCCTGAAGCAGAGTGG - Intergenic
1111817137 13:93168019-93168041 CTTTAGTAAAAGAAACAAATGGG - Intergenic
1113504775 13:110807830-110807852 CTTTAGTAGCAGAAGAGGAGGGG - Intergenic
1114551529 14:23535208-23535230 CTTTGGTGACAGGATCAGAGGGG + Exonic
1114701243 14:24680678-24680700 CTTTAGCCACAAAGGCAGAGTGG - Intergenic
1115490952 14:33957607-33957629 ATATATGAACAGAAGCAGAGAGG - Intronic
1116177498 14:41491377-41491399 CTATAGTAACAGAAACAGGATGG - Intergenic
1116251749 14:42493430-42493452 GTTTTGTAACAGAAGCAAAATGG + Intergenic
1117531872 14:56667507-56667529 CTTTAGAAATACAAGCAGATGGG + Intronic
1119295411 14:73529003-73529025 CTCTAGAACCAAAAGCAGAGTGG + Intronic
1119299093 14:73557039-73557061 CTCTAGAACCAAAAGCAGAGTGG + Intronic
1121691260 14:95878481-95878503 CTTTACTAACAGAGACACAGAGG - Intergenic
1121771771 14:96550938-96550960 CTTTAGTAGCAGAAACTGAGGGG + Intronic
1124620418 15:31270855-31270877 CATTAGTAACAGAGGCAATGGGG - Intergenic
1125335283 15:38620545-38620567 CTGAAGTGACTGAAGCAGAGCGG - Intergenic
1129987903 15:79934952-79934974 CTTTAGTACAAGAAGCAGGAAGG + Intergenic
1131126015 15:89857670-89857692 TTTTAGTAACAGAAAAATAGAGG - Intronic
1132229645 15:100171887-100171909 CTTAAGTAACACAGGCAGAGAGG - Intronic
1133584334 16:7177848-7177870 CTTTAGTTACAAAAGCAGACAGG + Intronic
1133737083 16:8624062-8624084 CTGAAGAAACAGATGCAGAGAGG + Intronic
1134348396 16:13413324-13413346 CTTTTGTAAGATAAGCAGATGGG + Intergenic
1137788321 16:51154496-51154518 CAATAAAAACAGAAGCAGAGTGG + Intergenic
1137845968 16:51688502-51688524 CTTTAGTTCAAGAAACAGAGGGG + Intergenic
1138178138 16:54921924-54921946 CTATATTAACAGAATTAGAGGGG - Intergenic
1138582030 16:57947933-57947955 TTTCACTAACAGAAGCAAAGTGG + Intronic
1138895010 16:61193322-61193344 CTGAAATAACAGTAGCAGAGAGG - Intergenic
1139346506 16:66307192-66307214 CTTGAGCATCAGAAACAGAGTGG + Intergenic
1139743123 16:69052612-69052634 CCTTTGGAACAGAAGCTGAGGGG - Intronic
1140916513 16:79498632-79498654 ATATAGGAACAGAAACAGAGAGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1145283226 17:21483682-21483704 TTGTACTCACAGAAGCAGAGAGG + Intergenic
1147165589 17:38591520-38591542 CTTTAGTAACAGAAGCAGAGAGG - Intronic
1148484473 17:47981930-47981952 CTTTATCACCAGAAGCAAAGGGG - Intergenic
1150180871 17:63119712-63119734 TTTTATTAACAGTAGCAAAGAGG + Intronic
1150934307 17:69618523-69618545 CTTCAGTACCAGAAGCTGAAAGG - Intergenic
1150975503 17:70081699-70081721 CTTGTGCAACAGAAGCACAGGGG + Intronic
1152092120 17:78252814-78252836 CTTCAGGAGCAGAAGCAGACTGG - Intergenic
1152182073 17:78828707-78828729 CTTCAGTAACAGATGGAGAATGG + Intronic
1152248056 17:79196176-79196198 CTGGAGAAACAGCAGCAGAGTGG + Intronic
1203160163 17_GL000205v2_random:41956-41978 TTTTAATAACAAAAACAGAGGGG + Intergenic
1153408244 18:4764739-4764761 CTATAGTAACAAAAGCAGCATGG - Intergenic
1153575449 18:6515549-6515571 CTATAGTAACAGAAACAGTATGG - Intronic
1155439525 18:25847334-25847356 CTTCAGTGACACAAGCAGTGGGG - Intergenic
1155974216 18:32110569-32110591 CTATACTAACAGAAGTTGAGAGG - Intronic
1156057157 18:33020535-33020557 CTTTAAAAACAAAAGCAAAGTGG - Intronic
1156750473 18:40447403-40447425 CTTTACCAACTGAAGCAGAATGG - Intergenic
1157146680 18:45170292-45170314 CATTAGAGACAGAAGCAGAAGGG + Intergenic
1158645844 18:59246346-59246368 CTTTTATAAAAGAAGCAGAAGGG - Intergenic
1162279677 19:9685482-9685504 CTTGACTCACAGAAGCAAAGAGG - Intergenic
1163949388 19:20569916-20569938 CTGTAATAACAAAAACAGAGGGG - Intronic
1163968688 19:20771987-20772009 CTGTAATAACAAAAACAGAGGGG + Intronic
1164296032 19:23910900-23910922 TTTTAATAACAGAGGCAAAGTGG + Intergenic
1164820126 19:31243602-31243624 CTCAAATAGCAGAAGCAGAGGGG + Intergenic
1165200747 19:34142403-34142425 CGTGAATAACAGCAGCAGAGGGG + Intergenic
1166329774 19:42071099-42071121 CTCTAGTCACAGGAGCAGAGAGG + Intronic
1166443546 19:42838032-42838054 CTTGAGAAACAGAAGCTGAACGG - Intronic
1166463237 19:43008694-43008716 CTTGAGAAACAGAAGCTGAATGG - Intronic
1166469381 19:43065252-43065274 CTTGAGAAACAGAAGCTGAACGG - Intronic
1166480511 19:43168790-43168812 CTTGAGAAACAGAAGCTGAATGG - Intronic
1167408800 19:49332859-49332881 GGTTAGAAACAGAAGCTGAGGGG + Intergenic
925428123 2:3768341-3768363 AGTTAGTAATAGTAGCAGAGTGG - Intronic
925803374 2:7624714-7624736 CTTTAGACAGAGAAGCAGAGGGG - Intergenic
926327056 2:11794209-11794231 CTCTAGTAAGAAAACCAGAGAGG - Intronic
927712712 2:25335784-25335806 CATTTGAAACAGAAGCAGAGAGG + Intronic
929746419 2:44664130-44664152 GTTTATTAAAAGCAGCAGAGTGG + Intronic
930678865 2:54233985-54234007 CATTAGTAACTGAAGAAAAGTGG + Intronic
930798833 2:55421263-55421285 CTCCTGTAACTGAAGCAGAGAGG - Intergenic
931252079 2:60541062-60541084 CTTCAAGAACAGGAGCAGAGGGG - Intronic
935374883 2:102385917-102385939 CTTAAGCTACAAAAGCAGAGAGG + Intronic
936836840 2:116719930-116719952 CTGTAATAACAAAAGCGGAGGGG - Intergenic
936876494 2:117195958-117195980 AATTAGTAACAGAAGCGGGGAGG + Intergenic
937274161 2:120673495-120673517 CTTCAGTGACAGGAGCAGCGTGG - Intergenic
938282892 2:130078710-130078732 CCACAGTAACAGAAGCAGCGTGG + Intronic
938333525 2:130467278-130467300 CCACAGTAACAGAAGCAGCGTGG + Intronic
938356288 2:130653393-130653415 CCACAGTAACAGAAGCAGCGTGG - Intronic
938476730 2:131622449-131622471 CCACAGTAACAGAAGCAGCGTGG - Intergenic
939588887 2:144039289-144039311 CTTTAATAAAAGGAGCAGGGGGG - Intronic
942593149 2:177567570-177567592 CTTTGGTAACAGTAGCAGGGAGG - Intergenic
942620795 2:177843437-177843459 CTTTAGTCACAGGAACAGGGAGG + Intronic
943198529 2:184788219-184788241 CTATAGTAACAAAAACAGCGTGG - Intronic
944095592 2:195963989-195964011 CTTTAGTAACCAAAGCAGCATGG - Intronic
946771668 2:223094887-223094909 GTTTAGTATCAGAACCTGAGTGG - Intronic
947787784 2:232839669-232839691 CTTAAGCAAAAGAAGCTGAGAGG + Intronic
948672916 2:239579942-239579964 CTTTAGTAAAAGCAGCAAATAGG - Intronic
1169308474 20:4515368-4515390 CACTATTAACAGAAGCAGACAGG - Intergenic
1170158635 20:13290847-13290869 CTATAGTAACTGAGGCATAGAGG + Intronic
1170168381 20:13384480-13384502 CTTTAGAGACAGAAGCATGGGGG + Intergenic
1170953863 20:20960836-20960858 CTATAGTAATCGAAGCAGCGTGG + Intergenic
1173122983 20:40310669-40310691 CTTTACTAAAAGAAGCTGTGAGG - Intergenic
1174311825 20:49662087-49662109 TGTTAGAATCAGAAGCAGAGAGG - Intronic
1174691243 20:52508337-52508359 CTATAGTAACAAAAGCAGCATGG + Intergenic
1174698632 20:52585497-52585519 CTTTATTTACAAAAGCACAGTGG - Intergenic
1175558859 20:59899578-59899600 ATGTAGTAATAGAAGCAGAAAGG + Intronic
1175731889 20:61359670-61359692 CTTTAGCAAGAAAGGCAGAGAGG + Intronic
1176074713 20:63243213-63243235 GTTTAGGATCAGCAGCAGAGTGG + Intronic
1176359025 21:5977680-5977702 CTTTAGTAACCGAAACAGCATGG - Intergenic
1177252650 21:18614419-18614441 CTTTAATATCAGCAGGAGAGAGG + Intergenic
1177910426 21:27024471-27024493 CTTTGCTAACAGATGCAGGGAGG + Intergenic
1178086421 21:29116437-29116459 CATTAGTAACAGAATCACATGGG + Intronic
1178260983 21:31099369-31099391 CCTTACTACGAGAAGCAGAGTGG + Intergenic
1179057965 21:37953441-37953463 CTATAGTAACAAAAACAGTGTGG - Intronic
1179764493 21:43560870-43560892 CTTTAGTAACCGAAACAGCATGG + Intronic
1181370818 22:22415367-22415389 CTTTACTAAAATTAGCAGAGTGG + Intergenic
1181955000 22:26581885-26581907 GTTGTGTAACAAAAGCAGAGTGG - Intronic
1181979487 22:26756030-26756052 CTTATTTTACAGAAGCAGAGAGG + Intergenic
1182244037 22:28941007-28941029 GTTTAGTGACAGAAGCAAAAGGG + Intronic
1182452076 22:30427599-30427621 CTTTAGCAATAAAAGAAGAGGGG + Intronic
1184662879 22:45973509-45973531 CTTTGGGGCCAGAAGCAGAGGGG - Intronic
1184857580 22:47154815-47154837 CTTTAGGAGCAGAAGCAGCCTGG + Intronic
952186276 3:30972906-30972928 ACTTAATAATAGAAGCAGAGAGG - Intergenic
952470207 3:33640073-33640095 CTTCAGTAAGGGAAGAAGAGAGG + Intronic
952506581 3:34012068-34012090 TTTTCTTGACAGAAGCAGAGAGG + Intergenic
953151782 3:40331652-40331674 CTTGGGTAACAAATGCAGAGTGG - Intergenic
953463049 3:43096819-43096841 CTTTAGAAACTGAGGCAGACAGG + Intronic
953797165 3:45994829-45994851 CTGTGGTAAGACAAGCAGAGGGG + Intronic
953995501 3:47516476-47516498 CTTTAGTACCAGAAGGCAAGAGG + Intergenic
955587599 3:60498093-60498115 CTTTAGTTACAGAAACAGGCAGG + Intronic
957750793 3:84412621-84412643 CTTTAGTAACAGAAGCTTTAAGG - Intergenic
959510803 3:107209483-107209505 CTTTTGTAACAGATGAAGAAAGG - Intergenic
959582228 3:107993441-107993463 CATTAGTAACAGAAGGGGTGGGG - Intergenic
959739337 3:109698034-109698056 CTTTATTAACTGAAGAAAAGTGG + Intergenic
960208239 3:114929264-114929286 CTGAAAAAACAGAAGCAGAGAGG + Intronic
960941220 3:122936198-122936220 CTCTAGTAACAGTAGCTGTGTGG + Intronic
964250186 3:154706147-154706169 CCTAAGTAACATAAGCAGTGAGG - Intergenic
966292207 3:178372891-178372913 ATATAGTAAAAGAAACAGAGTGG - Intergenic
967210168 3:187161474-187161496 CTAGAGAAACAGAAGCACAGAGG - Intronic
968856047 4:3123348-3123370 CTTTACTTACAGAAACAGACAGG + Intronic
970155256 4:13134840-13134862 CTGGAGTACCAGAAGCAGATGGG + Intergenic
971202378 4:24522534-24522556 CTTTAATAAGAGAAGGGGAGGGG - Intronic
972125617 4:35761168-35761190 CTGTAATGACAGTAGCAGAGGGG - Intergenic
972297200 4:37751351-37751373 ATTCAGGACCAGAAGCAGAGAGG - Intergenic
972332741 4:38078990-38079012 CAGTAGAAACAGAAGCAGAAAGG + Intronic
973842154 4:54873328-54873350 CCTTATTCACAGAAGCAGACTGG - Intergenic
975075751 4:70207032-70207054 TATTAGTAGCAGAAGCAGATTGG - Intergenic
975192740 4:71484548-71484570 CTCTAGTAACAAAAACAGAATGG - Intronic
975716930 4:77214143-77214165 ACTTAGTGCCAGAAGCAGAGAGG - Intronic
978571570 4:110143749-110143771 CTTTAATAATATAAGAAGAGGGG + Intronic
978743051 4:112160666-112160688 CTTTAGTAACCAAAACAGTGTGG + Intronic
980303754 4:131028502-131028524 CTTCAGTTAAATAAGCAGAGGGG - Intergenic
980998396 4:139803643-139803665 CTGGGGTAACAGAAGCACAGTGG - Intronic
982352677 4:154433157-154433179 CTTCAGTTACAGAACCAGAGAGG + Intronic
982352964 4:154436011-154436033 ATTTAGCAAAAGAAGCAGAGAGG - Intronic
982692512 4:158564923-158564945 GTTTAGGAACAGAAGTAGAAAGG - Intronic
983330164 4:166316264-166316286 ATTTAGTGACAGAAGGAGAGAGG - Intergenic
983696465 4:170538659-170538681 CTTTAGTTACAGAAAGACAGGGG - Intergenic
983867865 4:172789759-172789781 CTTTAGAACCAGAATCAGAAAGG + Intronic
984209761 4:176831926-176831948 TTTTAATACCTGAAGCAGAGGGG + Intergenic
984658204 4:182342964-182342986 CTTTAATAAAAGAAGGAGATTGG - Intronic
985720929 5:1488625-1488647 CTTTAATAAAACCAGCAGAGCGG - Intronic
987763790 5:22198899-22198921 ATTTAGTAAAAAAAGCAGATAGG + Intronic
988507495 5:31836626-31836648 CTCTAATGACAAAAGCAGAGAGG + Intronic
990685791 5:58299750-58299772 CTTTAGCAACACAAGCTGATGGG - Intergenic
991898512 5:71431979-71432001 ATTTAGTAAAAAAAGCAGATAGG + Intergenic
993501668 5:88673428-88673450 CATCAGTAACAAAAGCAGTGGGG - Intergenic
994612537 5:102062090-102062112 CTTTAGTAACTGAAGTAGTATGG - Intergenic
994660371 5:102646821-102646843 CTATAGTAACCCAAACAGAGTGG + Intergenic
994871233 5:105352077-105352099 TTATAGGAACAGGAGCAGAGTGG + Intergenic
995651743 5:114377301-114377323 CCTTAGGATCAGAGGCAGAGTGG - Intronic
999516129 5:152303531-152303553 CTTGAGGAATAGAAGCATAGAGG + Intergenic
1000466416 5:161583482-161583504 CTTTAGTAATAGCAGCAGGAGGG + Intronic
1002464993 5:179403813-179403835 CTCTTGTCACAGAAGCTGAGAGG - Intergenic
1004172629 6:13308697-13308719 CCTCTTTAACAGAAGCAGAGAGG - Intronic
1005242545 6:23848675-23848697 GATTAGTATCAGAAACAGAGTGG + Intergenic
1006193318 6:32222573-32222595 CTTTTGGAACAGAAGGAGGGAGG + Exonic
1006699901 6:35963641-35963663 CAAAAGTAACAGAAGCAGAAGGG - Intronic
1007066098 6:38991685-38991707 CCTGAGTAACAGGAGCTGAGTGG - Intronic
1008189848 6:48441154-48441176 CTATAGTAACAAAAGCAGAATGG - Intergenic
1008279096 6:49574072-49574094 CTTTAGGAATAGAGGCCGAGAGG - Intergenic
1009673355 6:66786072-66786094 ATTTAGTAACAGAGGGACAGAGG + Intergenic
1010722096 6:79294649-79294671 CTATAGTAACTGAAACAGAACGG - Intergenic
1010966515 6:82215319-82215341 CCTAAGTCACATAAGCAGAGAGG - Intronic
1011246107 6:85322865-85322887 TTTCAGCAACAGAAGCAGACAGG + Intergenic
1011384573 6:86781287-86781309 CTGTGTTAACAGAAGCATAGCGG - Intergenic
1014286795 6:119508382-119508404 CTTTAGCAACAGATGCACATCGG + Intergenic
1014471753 6:121823821-121823843 CTTAAGTAACACAAGTAGAAAGG + Intergenic
1018901983 6:168056273-168056295 CTTTGGTGACAGACGGAGAGTGG - Exonic
1021508739 7:21412576-21412598 CTTTAGTGATAAAAGAAGAGTGG - Intergenic
1022038736 7:26559038-26559060 CATTAAAAACAGAAGCAGAGTGG - Intergenic
1022960937 7:35425933-35425955 CTTGAGTAACAGAGGCAGCTGGG - Intergenic
1024286208 7:47759904-47759926 ATTTAGAATCAGAAGCACAGGGG - Intronic
1024832499 7:53477949-53477971 CTGGAGTAACTGCAGCAGAGGGG - Intergenic
1025752698 7:64307240-64307262 CTTTAGAAAGAGAGGCAGGGCGG - Intergenic
1027573212 7:79898206-79898228 TTTGAATAACAGAAGCAGAGAGG + Intergenic
1028220341 7:88189587-88189609 CTTAATTAAAAGTAGCAGAGTGG + Intronic
1028610089 7:92700976-92700998 CCTTAGTTACAGAAGAAAAGAGG + Intronic
1028660499 7:93267234-93267256 CTAGAGTAACAGAAGCAGAGAGG - Intronic
1030125844 7:106151829-106151851 CTCCAGTAACAGAAGGAGGGAGG + Intergenic
1030800969 7:113851396-113851418 GTTTAGGAAGAAAAGCAGAGAGG + Intergenic
1032875964 7:136038461-136038483 ATCTAGTAATAGAAGCAGAGAGG + Intergenic
1033500068 7:141938399-141938421 TATTAATAACAGAATCAGAGGGG + Intronic
1033607936 7:142941149-142941171 TTTTTGGAACAGAAGCAGAAAGG + Exonic
1033766724 7:144501280-144501302 CTTTACCAAAAGAAGGAGAGAGG - Intronic
1034278252 7:149833759-149833781 GGTTAGTAAGAGAGGCAGAGTGG - Intergenic
1035024908 7:155818930-155818952 TTTTGGTAGCAGATGCAGAGAGG + Intergenic
1041866042 8:62574535-62574557 CTATAGTAACTGAAACAGCGTGG + Intronic
1043971687 8:86536320-86536342 GTTAAGTAAAAGAAGCAAAGTGG - Intronic
1046881521 8:119314113-119314135 CTGAACTAATAGAAGCAGAGAGG + Intergenic
1048027824 8:130602784-130602806 CTATAGTAGCGGTAGCAGAGGGG - Intergenic
1049191355 8:141289650-141289672 CTGTAGTAAGAGAAGCTAAGAGG + Intronic
1049366887 8:142243550-142243572 CTGAACTCACAGAAGCAGAGAGG + Intronic
1050539309 9:6656529-6656551 CTTTAGTAAAAGAATCTGAGAGG - Intergenic
1050546216 9:6711446-6711468 CTTTATGATCAAAAGCAGAGTGG - Intergenic
1050727560 9:8669192-8669214 CTCTAGTAACAGTACCAGAGTGG - Intronic
1050740716 9:8816791-8816813 CTTTAGGAATAGAAGAAGAAAGG + Intronic
1050940739 9:11453721-11453743 CATTAGCAACATAAGCTGAGTGG + Intergenic
1052347780 9:27427469-27427491 CTAGAGTAACTGGAGCAGAGAGG - Intronic
1053299315 9:36937381-36937403 GGTTAGTAACAGTGGCAGAGGGG - Intronic
1056402414 9:86241121-86241143 CATTAGTAAGAAAAGCAAAGAGG - Intronic
1057606088 9:96498808-96498830 CTTAAGCAATGGAAGCAGAGGGG + Intronic
1059876495 9:118641200-118641222 CTTTAGTATAAAAAGAAGAGGGG - Intergenic
1060448303 9:123712657-123712679 CTGTTATAACAGAAGCAGGGAGG - Intronic
1062246515 9:135570563-135570585 CTTTAGTAACCGAAGTGGGGAGG - Intergenic
1185719568 X:2371267-2371289 CTATGGTAACAGAAGTAGAAGGG - Intronic
1185764270 X:2712175-2712197 CTGAACTCACAGAAGCAGAGTGG + Intronic
1185869019 X:3648284-3648306 CTTTATTAACAGACACATAGGGG + Intronic
1185980448 X:4772907-4772929 CTGTAGTAACAAAAGCGAAGAGG + Intergenic
1186140423 X:6566348-6566370 CTATAGTAACCGAAGCAGAATGG - Intergenic
1186579143 X:10798521-10798543 ATTTAATAACAGAAGCAAAATGG - Intronic
1187713952 X:22082968-22082990 CTGTAGTAACAAAAACAGTGTGG + Intronic
1187962708 X:24581874-24581896 TTATAGTATCAGTAGCAGAGTGG + Intronic
1188122153 X:26320441-26320463 CTTTAGTGTTAGAAGCAGGGAGG - Intergenic
1188536909 X:31207037-31207059 CTTTAGTAACCAAAGTAGATTGG - Intronic
1188975329 X:36666063-36666085 CTATAGTAACAAAAGCAGAATGG - Intergenic
1189080186 X:37962806-37962828 CTTTATTAAAAGAGGAAGAGGGG - Intronic
1189484472 X:41419115-41419137 CTTAAGTAAAAGAAGCAAAAGGG - Intergenic
1189534944 X:41925722-41925744 TTTTAGTCCCCGAAGCAGAGAGG - Intergenic
1192328086 X:70150404-70150426 CTTTAGGAACAGAAATAGTGGGG + Intronic
1192582785 X:72298908-72298930 CTTGAGAAACAGGAGCACAGAGG - Intronic
1194427710 X:93760414-93760436 CAGTAGCAACAGAGGCAGAGCGG + Intergenic
1195419434 X:104657233-104657255 CTATAGTAACAAAAGCAGCATGG + Intronic
1196474170 X:116063392-116063414 CTATGGTAACAAAAGCAGCGTGG - Intergenic
1196829159 X:119762765-119762787 CTTTAGTAATTGAAGGAGGGAGG + Intergenic
1198438133 X:136636696-136636718 GTTTAGGAACAGAACAAGAGGGG - Intergenic
1201935731 Y:19408796-19408818 CTTTAGAAAGAGGAGAAGAGTGG + Intergenic