ID: 1147166087

View in Genome Browser
Species Human (GRCh38)
Location 17:38594149-38594171
Sequence TGCTGTTTGTGCAGGGAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 310}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147166079_1147166087 2 Left 1147166079 17:38594124-38594146 CCTGCAGGCTGAGCCTTGGCCCC 0: 1
1: 0
2: 2
3: 49
4: 362
Right 1147166087 17:38594149-38594171 TGCTGTTTGTGCAGGGAAGCGGG 0: 1
1: 0
2: 0
3: 17
4: 310
1147166078_1147166087 3 Left 1147166078 17:38594123-38594145 CCCTGCAGGCTGAGCCTTGGCCC 0: 1
1: 0
2: 1
3: 24
4: 281
Right 1147166087 17:38594149-38594171 TGCTGTTTGTGCAGGGAAGCGGG 0: 1
1: 0
2: 0
3: 17
4: 310
1147166076_1147166087 6 Left 1147166076 17:38594120-38594142 CCACCCTGCAGGCTGAGCCTTGG 0: 1
1: 0
2: 3
3: 38
4: 345
Right 1147166087 17:38594149-38594171 TGCTGTTTGTGCAGGGAAGCGGG 0: 1
1: 0
2: 0
3: 17
4: 310
1147166070_1147166087 27 Left 1147166070 17:38594099-38594121 CCTGGTTCACTGCCCCTGAGCCC 0: 1
1: 0
2: 4
3: 44
4: 422
Right 1147166087 17:38594149-38594171 TGCTGTTTGTGCAGGGAAGCGGG 0: 1
1: 0
2: 0
3: 17
4: 310
1147166074_1147166087 13 Left 1147166074 17:38594113-38594135 CCTGAGCCCACCCTGCAGGCTGA 0: 1
1: 1
2: 3
3: 54
4: 365
Right 1147166087 17:38594149-38594171 TGCTGTTTGTGCAGGGAAGCGGG 0: 1
1: 0
2: 0
3: 17
4: 310
1147166075_1147166087 7 Left 1147166075 17:38594119-38594141 CCCACCCTGCAGGCTGAGCCTTG 0: 1
1: 0
2: 2
3: 35
4: 285
Right 1147166087 17:38594149-38594171 TGCTGTTTGTGCAGGGAAGCGGG 0: 1
1: 0
2: 0
3: 17
4: 310
1147166073_1147166087 14 Left 1147166073 17:38594112-38594134 CCCTGAGCCCACCCTGCAGGCTG 0: 1
1: 0
2: 5
3: 57
4: 432
Right 1147166087 17:38594149-38594171 TGCTGTTTGTGCAGGGAAGCGGG 0: 1
1: 0
2: 0
3: 17
4: 310
1147166072_1147166087 15 Left 1147166072 17:38594111-38594133 CCCCTGAGCCCACCCTGCAGGCT 0: 1
1: 0
2: 5
3: 74
4: 634
Right 1147166087 17:38594149-38594171 TGCTGTTTGTGCAGGGAAGCGGG 0: 1
1: 0
2: 0
3: 17
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147166087 Original CRISPR TGCTGTTTGTGCAGGGAAGC GGG Intronic
901180104 1:7335984-7336006 TGCTTCTTGGGCAGGAAAGCCGG - Intronic
902517194 1:16995940-16995962 TGGGGTTGGTGCAGGGGAGCGGG - Intronic
903031847 1:20469264-20469286 TGCTGTGGGTGCAGAGAAGAGGG - Intergenic
904373997 1:30068403-30068425 TGCTGTTTGGTGAGAGAAGCAGG + Intergenic
905273453 1:36801889-36801911 TGCTGTCCTTGCCGGGAAGCCGG + Exonic
905515736 1:38560558-38560580 TGCTATATGTGCATGGAAGGGGG + Intergenic
905626535 1:39493250-39493272 TGCTGTCTGTGGAGGGAGGCTGG - Intronic
906243970 1:44260324-44260346 TGCTGCCTGTGCAGTGAGGCAGG - Intronic
906530442 1:46520743-46520765 GGCTGTCTGTACAGGGGAGCTGG - Intergenic
906608906 1:47188975-47188997 TGCTGTATGTGCATGGGAGGAGG - Intronic
909743018 1:79055819-79055841 TGATTTTTGTGCAAGGAAGTGGG - Intergenic
911484310 1:98486500-98486522 GGCTGTTTCTGCAGGGAACCAGG - Intergenic
912529948 1:110313010-110313032 AGCTGGTTATGCAGGGACGCAGG - Intergenic
912933303 1:113982804-113982826 TGCGGTTTGTGCAGGGAGGAGGG + Intergenic
913247771 1:116885370-116885392 GGCGGTTTGTGCAGGGCAGTTGG - Intergenic
914198387 1:145462720-145462742 TGCTCTTTGTGCAGTGTTGCAGG + Intergenic
914477492 1:148035848-148035870 TGCTCTTTGTGCAGTGTTGCAGG + Intergenic
914510978 1:148331579-148331601 TGCTCTTTGTGCAGTGTTGCAGG + Intergenic
914513888 1:148357113-148357135 TGCTCTTTGTGCAGTGTTGCAGG + Intergenic
915067134 1:153234355-153234377 ATCTGTTTGTGCTGTGAAGCAGG + Intergenic
915269358 1:154742694-154742716 TGCTGCTTCTTCGGGGAAGCAGG + Intronic
916759421 1:167803167-167803189 TACTGTTTGTGCAGGCACACTGG + Intergenic
917733665 1:177901010-177901032 TCCATTTTGTGCAGGAAAGCAGG - Intergenic
920165646 1:204033819-204033841 TGCTGTCAGTGCCTGGAAGCTGG - Intergenic
922850315 1:228727726-228727748 TGCAGTTTCTGGAGGGAAGTAGG + Intergenic
924613987 1:245597493-245597515 TGCTGTTAGTCTAGGGAAGATGG + Intronic
1063505230 10:6591819-6591841 TGCTGTGGGAGCAGGGGAGCAGG + Intergenic
1065674918 10:28164208-28164230 TGCAGTTTGAGAAGGGAAGCAGG + Intronic
1067709409 10:48636347-48636369 TGGTGCTTGTGCAGGGAGACTGG + Intronic
1069981672 10:72256973-72256995 GGCTTTTTGTGCAGGGCACCAGG + Intergenic
1070656166 10:78273070-78273092 TTCTGTTTGTACAGAGAAGGGGG - Intergenic
1072318089 10:94222870-94222892 TGCTGTTTGGACAGGGAATTTGG + Intronic
1073437512 10:103528669-103528691 TACTCTTTGTGCAGGAATGCAGG - Intronic
1073812702 10:107168012-107168034 TTCTGTTTGTGATGGTAAGCTGG - Intergenic
1073984070 10:109187674-109187696 AGCTGTTTGTGGTGGGAATCAGG + Intergenic
1076854744 10:133110417-133110439 TGCTCTGTGTGCAGGGACGCAGG - Intronic
1077529621 11:3089095-3089117 GGCTGTGTGGGCAGAGAAGCAGG - Intronic
1078159487 11:8828434-8828456 AGCTGTATCTGCGGGGAAGCTGG + Intronic
1078540851 11:12211816-12211838 GACCGTTTCTGCAGGGAAGCCGG - Intronic
1079367566 11:19822640-19822662 TGGTGGTTGTGCAGGCAAGTAGG + Intronic
1080175809 11:29361549-29361571 TGCTGTTCCTGCAGGCCAGCAGG - Intergenic
1080203911 11:29706914-29706936 TGATGTATGTGTAGGGAAGGTGG + Intergenic
1081392226 11:42542408-42542430 TGCTGTTTAGGCAGTGCAGCTGG - Intergenic
1087237550 11:95736946-95736968 TCCTATTTGTGAAGGGAAGATGG - Intergenic
1088912635 11:114203567-114203589 TGTTGTTTTTGCAGGGGGGCGGG - Intronic
1089153941 11:116386152-116386174 ACCTGTGGGTGCAGGGAAGCCGG + Intergenic
1089164239 11:116462390-116462412 AGATGTGTGTGCAGGGATGCAGG - Intergenic
1091555455 12:1570031-1570053 TGCTGTTGTTGCATGGAAGAGGG + Intronic
1091595804 12:1878423-1878445 TGCTGTTTGTGCTGGGCATCTGG + Intronic
1091760899 12:3086634-3086656 TGCTGTTATTGCAGGAAGGCTGG + Intronic
1096079398 12:48823607-48823629 TGCTGTTGGGGCACTGAAGCTGG + Intronic
1096505988 12:52093587-52093609 TGCTGTCTCTGCTGGGAAGTTGG + Intergenic
1099631514 12:85152317-85152339 CAGTGTTTGTGAAGGGAAGCGGG - Exonic
1100223971 12:92537898-92537920 TGCTGTGCATGAAGGGAAGCTGG - Intergenic
1104257296 12:127150856-127150878 TGCTGTTCTGGAAGGGAAGCAGG - Intergenic
1104288885 12:127450270-127450292 TGCATTTTGTACAGGGAAGGTGG + Intergenic
1106171684 13:27294070-27294092 TTCTGTCTGTGCTGGGAAACTGG + Intergenic
1107971103 13:45643307-45643329 TGCTCTTTGTGTAGGAAGGCAGG + Intergenic
1108342999 13:49515934-49515956 TGCTGTTGGAGCAGCGAAGTGGG - Intronic
1112742653 13:102492664-102492686 AGCTGTCTGGGCAGGGAGGCAGG + Intergenic
1113802312 13:113092993-113093015 TGCTGTGTGTGCACAGGAGCTGG - Intronic
1114692339 14:24595530-24595552 TGCAGGTTGTCCAGGGAAGTGGG + Intergenic
1114912609 14:27219713-27219735 AGCTGTTTCTGCAGGAAAGATGG - Intergenic
1115887738 14:37992705-37992727 TGCTGTTTGTGAACAGCAGCAGG + Intronic
1118001443 14:61527073-61527095 AGGTGCTTGTGCTGGGAAGCGGG + Intronic
1118494582 14:66295642-66295664 AGCTGTTGTTGCCGGGAAGCTGG - Intergenic
1119424886 14:74528734-74528756 TGCTGTTCCTGCAGGAAACCAGG + Intronic
1119738079 14:76996659-76996681 TGCTCCTTGGGAAGGGAAGCAGG - Intergenic
1121541818 14:94733592-94733614 TGCTTCCTGTGCAGGGAAGAAGG - Intergenic
1122721533 14:103725121-103725143 TGCTGTTAGAGCGGGGGAGCCGG + Intronic
1124200122 15:27672148-27672170 GGCTGTTGGTGTGGGGAAGCTGG + Intergenic
1124547618 15:30646233-30646255 TGCTATTTGTGCATGGTGGCTGG + Exonic
1124864044 15:33471827-33471849 TGCTGTTTGTGTTGGAAAGCAGG - Intronic
1126564432 15:50080389-50080411 TTCTTTTTTTGCAGGGAAGTAGG - Intronic
1126659120 15:51014304-51014326 TGCTTTCTGTGCAGGGCAACTGG + Intergenic
1126984489 15:54288514-54288536 TGCTGTGAGTGCAGGGACCCAGG + Intronic
1128329365 15:66745646-66745668 TGCTGCTTGTGCAGGGTACGTGG + Intronic
1128562880 15:68680020-68680042 TGGTGTCTGGGCAGGGAAGATGG + Intronic
1128691435 15:69727322-69727344 TGCTGTGTCTCCAGGGAAGTGGG - Intergenic
1128847755 15:70916809-70916831 TGCTGTTGGGGCCAGGAAGCAGG + Intronic
1131176505 15:90212575-90212597 TGCTCTTTGTGCAGGGGTGGAGG - Intronic
1131214004 15:90521923-90521945 TGCTGTTTGTGCAATGATGATGG - Intergenic
1131511224 15:93050636-93050658 TGATTTGTGTGCAGGGAGGCTGG - Intronic
1132310566 15:100854468-100854490 GGCTGTGTGTGCAGGAGAGCAGG + Intergenic
1135586960 16:23678941-23678963 TGCAGTGACTGCAGGGAAGCTGG + Exonic
1136110210 16:28059786-28059808 TTCTGTTTGTGGAAGGACGCGGG + Intronic
1136147766 16:28325587-28325609 TGCTCAGTGTGCAGTGAAGCAGG - Intergenic
1137553002 16:49453232-49453254 TGGGGCTTGTGAAGGGAAGCCGG - Intergenic
1137815948 16:51397623-51397645 TCCTGTTTGTGGGTGGAAGCTGG - Intergenic
1138962668 16:62046011-62046033 TTCTGTTTTTACAGGGAAACAGG + Intergenic
1141414588 16:83860600-83860622 TGCTAATTGTGGAGGGAGGCAGG + Intergenic
1141697086 16:85625224-85625246 TGCTGTGTGTGCGGAGAAGCAGG - Intronic
1142171855 16:88627032-88627054 TGCTTTTTGGGAAGGGAAACAGG - Intronic
1143932979 17:10450425-10450447 TGCTTTTAGTGCAGGGGAGCAGG - Intronic
1144203634 17:12963567-12963589 TGCTGTGTGTGCAGACAGGCCGG + Intronic
1144203639 17:12963601-12963623 TGCTGTGTGTGCAGACAGGCTGG + Intronic
1144389597 17:14780830-14780852 TGTTATTTATGCAGAGAAGCGGG - Intergenic
1145264098 17:21371268-21371290 TGCTGGGTCTGCAGGAAAGCAGG - Intergenic
1146818815 17:35968039-35968061 TCCTGTATGTGGAGGAAAGCCGG + Intergenic
1147166087 17:38594149-38594171 TGCTGTTTGTGCAGGGAAGCGGG + Intronic
1147659700 17:42111005-42111027 TGCAGGTTGTGAAGGGAAGAAGG - Intronic
1148284636 17:46376808-46376830 TGCTGTTTGTTGAGGTAATCTGG + Intergenic
1148306857 17:46594729-46594751 TGCTGTTTGTTGAGGTAATCTGG + Intronic
1150667333 17:67153674-67153696 TGCTGTGGGTGAAGGGAAGTGGG - Intronic
1151229651 17:72675066-72675088 AGCTCTTTGTGTATGGAAGCGGG - Intronic
1154327292 18:13400740-13400762 TGCTGTTGGTGTAGGGATGACGG + Intronic
1155705484 18:28805415-28805437 CCCTATTTGTGCAGGGAAGTGGG - Intergenic
1156451679 18:37270034-37270056 TGCTATCAGGGCAGGGAAGCTGG - Intronic
1156468184 18:37361383-37361405 TCCTGTTCCTCCAGGGAAGCTGG + Intronic
1156498814 18:37543969-37543991 TGCGGTCTGTCCAGAGAAGCAGG + Intronic
1156927298 18:42597150-42597172 GGCTGTTGGTCCAGGCAAGCAGG + Intergenic
1156965625 18:43087826-43087848 TGCTGTTTGTGCTGGTGAGTTGG - Intronic
1158745222 18:60192021-60192043 TACTGATTGTGAAGAGAAGCTGG + Intergenic
1159421323 18:68224267-68224289 TGTTATTTGTCCAGGGCAGCGGG + Intergenic
1160396096 18:78573195-78573217 TGAGATTTGTGCAGGGACGCAGG - Intergenic
1161048535 19:2150263-2150285 TGCTGTCCACGCAGGGAAGCAGG + Intronic
1162840456 19:13352703-13352725 TGATGTTTGAGCAGAGAAGGAGG - Intronic
1162840606 19:13353815-13353837 TGATGTTTGAGCAGAGAAGGAGG - Intronic
1165643165 19:37407604-37407626 CACTGTATGTGCAGGGAAACAGG - Intergenic
1166750018 19:45160137-45160159 TAATGTTTGTGCATGGCAGCCGG + Exonic
1168121025 19:54252593-54252615 AGTTGTGTGTGCAGGGCAGCTGG - Intronic
1168124603 19:54276500-54276522 AGCTGTGTGTGCAGGGCAGGGGG - Intronic
1168177384 19:54635038-54635060 AGCTGTGTGTGCAGGGCAGGGGG + Intronic
1168717741 19:58539067-58539089 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717750 19:58539106-58539128 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717756 19:58539145-58539167 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717765 19:58539184-58539206 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717773 19:58539223-58539245 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717782 19:58539262-58539284 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717790 19:58539301-58539323 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717818 19:58539454-58539476 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717827 19:58539493-58539515 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717836 19:58539532-58539554 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717845 19:58539571-58539593 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717851 19:58539610-58539632 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717860 19:58539649-58539671 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717878 19:58539724-58539746 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717887 19:58539763-58539785 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717942 19:58539995-58540017 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717951 19:58540034-58540056 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717960 19:58540073-58540095 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717979 19:58540151-58540173 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717990 19:58540190-58540212 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717996 19:58540229-58540251 TCCTGTATGAGGAGGGAAGCAGG - Intergenic
1168718005 19:58540268-58540290 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718014 19:58540307-58540329 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718025 19:58540344-58540366 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718036 19:58540383-58540405 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718057 19:58540459-58540481 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718077 19:58540537-58540559 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718099 19:58540615-58540637 TCCTGTATGAGGAGGGAAGCAGG - Intergenic
1168718108 19:58540654-58540676 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718118 19:58540693-58540715 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718151 19:58540846-58540868 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718160 19:58540885-58540907 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718169 19:58540924-58540946 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718178 19:58540963-58540985 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718187 19:58541002-58541024 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718198 19:58541041-58541063 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718217 19:58541119-58541141 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718228 19:58541158-58541180 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718239 19:58541197-58541219 TCCTGTATGAGGAGGGAAGCAGG - Intergenic
1168718248 19:58541236-58541258 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718257 19:58541275-58541297 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718268 19:58541312-58541334 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718279 19:58541351-58541373 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718300 19:58541427-58541449 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718311 19:58541466-58541488 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718318 19:58541505-58541527 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718327 19:58541544-58541566 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718336 19:58541583-58541605 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718343 19:58541622-58541644 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718352 19:58541661-58541683 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718361 19:58541700-58541722 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718379 19:58541775-58541797 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718388 19:58541814-58541836 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718444 19:58542045-58542067 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718453 19:58542084-58542106 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718462 19:58542123-58542145 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718471 19:58542162-58542184 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718480 19:58542201-58542223 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718512 19:58542319-58542341 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718521 19:58542358-58542380 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718530 19:58542397-58542419 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718585 19:58542628-58542650 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718594 19:58542667-58542689 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718603 19:58542706-58542728 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
925104428 2:1278389-1278411 TGCTGTTTATGGAGGGCACCAGG + Intronic
926309607 2:11666043-11666065 TGCTGTTGCTGCTGGGTAGCAGG - Intronic
926624842 2:15082600-15082622 GGCTGTTTGCTCAGGGAATCTGG - Intergenic
926951165 2:18245111-18245133 TGGTGTGTGTGCATGGAGGCAGG - Intronic
930150243 2:48051853-48051875 TACTCTTTGTGTAGGGATGCAGG - Intergenic
930207030 2:48597924-48597946 TGCTTTTAGGGGAGGGAAGCGGG + Exonic
930301745 2:49624500-49624522 TGCTGTATATGCAGGGTAACTGG + Intergenic
930519230 2:52442794-52442816 TGATGTTTCTCCAGAGAAGCTGG + Intergenic
930585848 2:53266078-53266100 TGCTCTTTGTGCAGCAAGGCTGG - Intergenic
932262304 2:70337055-70337077 TGGTGTTAGTGCAGGGAAATCGG + Intergenic
932284488 2:70520778-70520800 TAGTGTTTGGGCATGGAAGCAGG - Intronic
932298573 2:70646750-70646772 AGCTGTTTGGGCAGGGAATTTGG - Intronic
932417744 2:71583991-71584013 TGCTGCTTGTCCAGGGAACTGGG - Intronic
933569265 2:83990125-83990147 TGTTTTTTGTGCAGTGAACCTGG + Intergenic
934573274 2:95385091-95385113 TGCTTTTTGTGCAAGGCAGAGGG - Exonic
936080702 2:109430591-109430613 TGTGTATTGTGCAGGGAAGCTGG - Intronic
937242239 2:120469685-120469707 TGCTGTCTGTCCAGAGAAGCTGG + Intergenic
937916403 2:127101182-127101204 GGGTGTTTGTGCAGGGCAGGTGG - Intronic
938537198 2:132256658-132256680 AGCAGTGTGTGCAGGGAAGAGGG - Intronic
939110360 2:137999403-137999425 TGGTGTGTGTGGAGGGAAGGAGG - Intronic
941010457 2:160293696-160293718 AGGTGTTTGTGCAGGGAGTCAGG + Intronic
943249061 2:185494302-185494324 AGCTGTTGGTTCAGGCAAGCAGG + Intergenic
943354163 2:186831194-186831216 TGATGCTTGTGCAGGGAAAATGG + Intronic
946035623 2:216740083-216740105 TGCTATTTTTGCAGCCAAGCAGG + Intergenic
946247470 2:218396006-218396028 TGCTGTTTCCTCAGGGGAGCCGG + Exonic
946643302 2:221807141-221807163 AGCTTTTTGTGGAGGGAAGTAGG - Intergenic
946816779 2:223586901-223586923 TGCTTTTTGAGCTGGGATGCAGG + Intergenic
947812170 2:233011414-233011436 TGCTGTTTGTCCCAAGAAGCTGG - Intronic
948194525 2:236085506-236085528 TGCTCTTTGTGTGGGGAAACTGG - Intronic
948980698 2:241493157-241493179 TGCTGTGTGAACAGGGAAACTGG + Exonic
949061397 2:241960020-241960042 TGGTGTTTGTGGAGAAAAGCTGG - Intergenic
1168956056 20:1835270-1835292 TGCTGTTGGAGCAAGAAAGCAGG - Intergenic
1169126133 20:3128234-3128256 TGCTAGTTGGGCAGGGAAGCTGG - Intronic
1169404383 20:5311353-5311375 TGCTGATGGAGCTGGGAAGCTGG + Intronic
1170431293 20:16279116-16279138 TGCTGTTTGGGAAGGGAAATGGG - Intronic
1170528508 20:17265757-17265779 TTCTCTTTGTGCAGAGGAGCAGG - Intronic
1171866102 20:30488437-30488459 TGCAGTGCGTGCAGGGAAGAGGG - Intergenic
1172976458 20:38909697-38909719 CACTGTTCGTGCTGGGAAGCAGG - Intronic
1173222774 20:41143048-41143070 TGCTGGTTTTGCAGGGAGACAGG + Intronic
1173463873 20:43265963-43265985 TGACGTTTGTGCAAGGAAGAGGG + Intergenic
1175053744 20:56178856-56178878 GGCTCTTTATGCAGGGAAGTGGG - Intergenic
1175138393 20:56842074-56842096 AGCTGTTTCTGCAGAGAAGCTGG + Intergenic
1176295433 21:5069640-5069662 AGCTGTGTGTCCAGGGAAGAAGG + Intergenic
1176970302 21:15257401-15257423 TGCTGATGGTTGAGGGAAGCAGG + Intergenic
1178300673 21:31450249-31450271 TGTTGTTTCTGTAGGGAAGTTGG - Intronic
1178523346 21:33304135-33304157 TGCTCATTGTGCTGGGAAGGAGG - Intergenic
1179861617 21:44192484-44192506 AGCTGTGTGTCCAGGGAAGAAGG - Intergenic
1182758363 22:32699520-32699542 TGGTGTGTGTGCAGGGATGGGGG + Intronic
1182762713 22:32735553-32735575 GGCTGGATTTGCAGGGAAGCTGG - Intronic
1183189138 22:36310501-36310523 TGCAGTTTGTGTTGGGAAGAGGG - Intronic
1183935176 22:41257875-41257897 TGCTGTCTTTCCAGGGAAGCTGG - Intronic
1184241176 22:43212038-43212060 TGCTGTCTGTTCAGGGCATCTGG - Intronic
1184535519 22:45084106-45084128 TGCTGCCTGTGCAGGGGGGCAGG - Intergenic
1184554979 22:45228212-45228234 TGCTGTGTGTGCTGGGGATCGGG - Intronic
1184597679 22:45524205-45524227 GGCTGGCAGTGCAGGGAAGCTGG + Intronic
1185025765 22:48410934-48410956 TGGGGTTTCTGCAGGGAAGGAGG + Intergenic
1185095410 22:48803625-48803647 GGCTGTTTGAGGAGGGCAGCTGG + Intronic
1185162273 22:49237106-49237128 CGCTTTTTGTGCAGGGAGGCCGG - Intergenic
950434488 3:12970572-12970594 GGCTGGCTGTGCAGGGAGGCTGG - Intronic
950905705 3:16536089-16536111 TGCTGAGGCTGCAGGGAAGCTGG - Intergenic
952055447 3:29439392-29439414 TGCTTTTTGTTCAGAGAAGAGGG + Intronic
954698037 3:52437815-52437837 TCCTGCTAGTGCATGGAAGCAGG - Intronic
955454537 3:59105331-59105353 TACTGTTTGTGCAGGAATACAGG + Intergenic
959540108 3:107526410-107526432 AACTGTTCGTACAGGGAAGCAGG + Intronic
966425838 3:179778812-179778834 TGCTGTATGGACAGGAAAGCAGG + Intronic
967932207 3:194698348-194698370 TGCTGGTTGTGGAGGGAGGTGGG + Intergenic
968558377 4:1261892-1261914 GGCTGTTTGAGCAGGGAATTGGG + Intergenic
968656287 4:1779778-1779800 GGCACTTTGTGCAGGGAGGCTGG - Intergenic
968925941 4:3548252-3548274 TCCTGTTTGCGAAAGGAAGCAGG - Intergenic
971047408 4:22820257-22820279 TGCAGTTTCCTCAGGGAAGCAGG - Intergenic
971317688 4:25581002-25581024 GCCTGTTTGTGCAGGGTGGCTGG - Intergenic
974806477 4:66887105-66887127 TGCTGTTTGTGAAGGAGAGGGGG - Intergenic
976142233 4:82004252-82004274 TGGTGTTCGTCGAGGGAAGCAGG + Intronic
976333508 4:83859095-83859117 TGCTGTGTGTGCAAGGAATTAGG - Intergenic
979890502 4:126086332-126086354 TGCTGAATGTGCATGAAAGCAGG + Intergenic
980410000 4:132404242-132404264 TGCTTTTTCAGCAGGGAGGCTGG - Intergenic
981748501 4:148072549-148072571 TGCTGTTGGTGCAAGGGAGATGG + Exonic
984034555 4:174649265-174649287 AGCTGCTTGAGCAGGGAAGGAGG + Intronic
986138668 5:5008341-5008363 TACTGTATGTGCAAAGAAGCAGG - Intergenic
989578423 5:43010201-43010223 GGCTGTTTATGCTGGGAAGATGG - Intergenic
989997686 5:50855200-50855222 TGCTGTGTGGGCAGAGAAGTAGG - Intergenic
990949702 5:61286552-61286574 TGCTGGTTCTGAAGGAAAGCTGG + Intergenic
997350041 5:133224526-133224548 TGCTGGTTGTCCAGGAAATCTGG - Intronic
997600578 5:135135761-135135783 TGCTGTCAGTGGAGGGAAGATGG - Intronic
998109890 5:139493083-139493105 TGATGTGTGTGCAGAGCAGCAGG + Intergenic
1001062667 5:168506385-168506407 TCCAGTTTGTGGAGGCAAGCTGG - Intronic
1001558487 5:172652968-172652990 TGCTGTTTGTACAGTGAAAAAGG - Intronic
1002662140 5:180798428-180798450 TGCTGTTGGTGAAGGGTAGGTGG - Intronic
1003128118 6:3372381-3372403 TGCTGGCTGTGCTGGGAAGGGGG + Intronic
1003546383 6:7062945-7062967 TGGTGTTTGTGCAGCGATTCAGG + Intergenic
1003685339 6:8296969-8296991 TGGAGTTTGTGTAGGGAAGGTGG - Intergenic
1003716963 6:8658343-8658365 TTCTGTTTCTGCAGGGATGCCGG + Intergenic
1004395601 6:15244969-15244991 TGCTGCTTGTGCCGTGCAGCCGG - Intergenic
1004708012 6:18142468-18142490 GGCTGTTGGCACAGGGAAGCTGG - Intronic
1006916783 6:37599913-37599935 TCCTGTCAGTGCAGGGAAGTAGG + Intergenic
1007168689 6:39847209-39847231 TGCTTTTTGTGCTGGGACCCTGG + Intronic
1007729214 6:43935669-43935691 AGCTGTCTGTGCATTGAAGCTGG - Intergenic
1010604826 6:77875089-77875111 ACCTTTTTGTGTAGGGAAGCAGG - Intronic
1012061681 6:94492587-94492609 TGCTATATATGCAAGGAAGCAGG - Intergenic
1015782409 6:136882509-136882531 TGCTGAATGTGCAGGGAATAGGG - Intronic
1017459665 6:154637214-154637236 TGCTGTCTCTGCAGGGAGGTGGG - Intergenic
1019629936 7:2043673-2043695 GGCTGTTTGTGGTGGGAAACAGG - Intronic
1020108333 7:5433274-5433296 TGCTGTTGTTCCTGGGAAGCTGG + Intronic
1021714618 7:23450247-23450269 TGCTTTTTGTGCAGACAACCAGG - Intronic
1021785294 7:24145405-24145427 TGCTGTTTGTGTAAGGCAGAAGG - Intergenic
1022429459 7:30301905-30301927 TGCTGCTTGTTCAGGGAAGGAGG + Intronic
1023177224 7:37446960-37446982 TGATGTTTCTGCAGGGGATCTGG + Intronic
1024004185 7:45213160-45213182 TGCTGTGTGTGCGGTGAAGGGGG + Intergenic
1024306946 7:47937379-47937401 TGCTGCTCCTGCAGTGAAGCAGG - Intronic
1027350874 7:77309535-77309557 TGGTGTTTCTGGAGGGAAGGGGG + Intronic
1029364306 7:100107335-100107357 TGCCCTTTGTGGGGGGAAGCAGG - Exonic
1029526332 7:101096361-101096383 TCCTGTTTGGGTAGGGAAGAGGG + Intergenic
1031085175 7:117295577-117295599 AGCAGTTTGCACAGGGAAGCAGG - Intronic
1033959585 7:146897528-146897550 TCCAGTTTCTGTAGGGAAGCTGG - Intronic
1037361018 8:18073841-18073863 GGCTTTTTGTGTAGGAAAGCAGG + Intronic
1037624613 8:20596004-20596026 TGCTGTTTCTGCAGGGATAAAGG + Intergenic
1037719116 8:21427652-21427674 TCCTGTATTTGCAGAGAAGCTGG + Intergenic
1038621504 8:29147794-29147816 TGCTTTTTCTGCAGGGAAGATGG - Intronic
1039388464 8:37157792-37157814 TGCTCTTCTTGAAGGGAAGCCGG - Intergenic
1039980566 8:42406624-42406646 TGCTGTTTGCACAAAGAAGCTGG + Intergenic
1041727360 8:61030624-61030646 TGCAGTTTGTGCCGAGAAGGTGG + Intergenic
1046074396 8:109299484-109299506 TGCAGATTGTTCAGGGAAGTGGG - Intronic
1046801999 8:118438944-118438966 CACTGTTTGTGCAGGGAAAAGGG + Intronic
1049319680 8:141989446-141989468 AGCTGTCTGTGCTGGGAAGAGGG + Intergenic
1050898879 9:10919374-10919396 TGCTGATTGTGCTTTGAAGCTGG + Intergenic
1055260076 9:74423885-74423907 TGCTGTATGTCCAGGTAGGCGGG - Intergenic
1055270848 9:74556740-74556762 TGCTTTGTGTGCTGGGGAGCAGG + Intronic
1059371510 9:113843289-113843311 TGCTGTTTAGGCAGAAAAGCAGG - Intergenic
1062059866 9:134489406-134489428 GGCTGTTGGTGTTGGGAAGCTGG + Intergenic
1062141536 9:134961723-134961745 TGCAGTGTTTGCAGTGAAGCTGG - Intergenic
1062497879 9:136840140-136840162 TCCTGTCTGTGCAGGTAAGGAGG + Exonic
1185474601 X:407173-407195 TGCTGTTTCTCCAGAGTAGCTGG + Intergenic
1187249552 X:17584362-17584384 TGCTTTCTGGGCAGAGAAGCTGG + Intronic
1193551070 X:82893381-82893403 GGCTGTTTGTCCAGGAAAGTGGG - Intergenic
1193797677 X:85896475-85896497 AGCAGTTTGTGGAGGGAAGATGG + Intronic
1193801868 X:85946410-85946432 AGCATGTTGTGCAGGGAAGCAGG - Intronic
1194657994 X:96597004-96597026 AGGTGTGTGTGCAGGGAAGGGGG - Intergenic
1195274974 X:103273186-103273208 TACTGTTAGTGCAGGGGAGAGGG + Intergenic
1196655447 X:118212992-118213014 TGCTGCTCCTGCAGAGAAGCCGG + Intergenic
1197738581 X:129871786-129871808 TGCTGTTGGTGCTGGGCAGAGGG - Intergenic
1197812996 X:130465120-130465142 TGCTGATTGTGCAGAGACACCGG + Intergenic