ID: 1147166575

View in Genome Browser
Species Human (GRCh38)
Location 17:38596589-38596611
Sequence ATGCCATTCTGGAAGGTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 239}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147166565_1147166575 14 Left 1147166565 17:38596552-38596574 CCAAATGATAGCCCGCCTGCCTC 0: 1
1: 0
2: 0
3: 22
4: 661
Right 1147166575 17:38596589-38596611 ATGCCATTCTGGAAGGTTGATGG 0: 1
1: 0
2: 2
3: 21
4: 239
1147166564_1147166575 15 Left 1147166564 17:38596551-38596573 CCCAAATGATAGCCCGCCTGCCT 0: 1
1: 0
2: 0
3: 5
4: 52
Right 1147166575 17:38596589-38596611 ATGCCATTCTGGAAGGTTGATGG 0: 1
1: 0
2: 2
3: 21
4: 239
1147166569_1147166575 -1 Left 1147166569 17:38596567-38596589 CCTGCCTCCTTCATGCCAGGTTA 0: 1
1: 0
2: 1
3: 18
4: 186
Right 1147166575 17:38596589-38596611 ATGCCATTCTGGAAGGTTGATGG 0: 1
1: 0
2: 2
3: 21
4: 239
1147166567_1147166575 2 Left 1147166567 17:38596564-38596586 CCGCCTGCCTCCTTCATGCCAGG 0: 1
1: 0
2: 3
3: 75
4: 562
Right 1147166575 17:38596589-38596611 ATGCCATTCTGGAAGGTTGATGG 0: 1
1: 0
2: 2
3: 21
4: 239
1147166563_1147166575 16 Left 1147166563 17:38596550-38596572 CCCCAAATGATAGCCCGCCTGCC 0: 1
1: 0
2: 0
3: 1
4: 63
Right 1147166575 17:38596589-38596611 ATGCCATTCTGGAAGGTTGATGG 0: 1
1: 0
2: 2
3: 21
4: 239
1147166561_1147166575 26 Left 1147166561 17:38596540-38596562 CCAACCTAGACCCCAAATGATAG 0: 1
1: 0
2: 0
3: 4
4: 119
Right 1147166575 17:38596589-38596611 ATGCCATTCTGGAAGGTTGATGG 0: 1
1: 0
2: 2
3: 21
4: 239
1147166570_1147166575 -5 Left 1147166570 17:38596571-38596593 CCTCCTTCATGCCAGGTTATGCC 0: 1
1: 0
2: 0
3: 12
4: 165
Right 1147166575 17:38596589-38596611 ATGCCATTCTGGAAGGTTGATGG 0: 1
1: 0
2: 2
3: 21
4: 239
1147166566_1147166575 3 Left 1147166566 17:38596563-38596585 CCCGCCTGCCTCCTTCATGCCAG 0: 1
1: 0
2: 7
3: 66
4: 540
Right 1147166575 17:38596589-38596611 ATGCCATTCTGGAAGGTTGATGG 0: 1
1: 0
2: 2
3: 21
4: 239
1147166560_1147166575 27 Left 1147166560 17:38596539-38596561 CCCAACCTAGACCCCAAATGATA 0: 1
1: 0
2: 1
3: 6
4: 114
Right 1147166575 17:38596589-38596611 ATGCCATTCTGGAAGGTTGATGG 0: 1
1: 0
2: 2
3: 21
4: 239
1147166562_1147166575 22 Left 1147166562 17:38596544-38596566 CCTAGACCCCAAATGATAGCCCG 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1147166575 17:38596589-38596611 ATGCCATTCTGGAAGGTTGATGG 0: 1
1: 0
2: 2
3: 21
4: 239
1147166571_1147166575 -8 Left 1147166571 17:38596574-38596596 CCTTCATGCCAGGTTATGCCATT 0: 1
1: 0
2: 0
3: 12
4: 128
Right 1147166575 17:38596589-38596611 ATGCCATTCTGGAAGGTTGATGG 0: 1
1: 0
2: 2
3: 21
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147166575 Original CRISPR ATGCCATTCTGGAAGGTTGA TGG Intronic
900723921 1:4202302-4202324 ATCCCATGGTGGAAGGTGGATGG + Intergenic
902390677 1:16103206-16103228 AGCCCATGCTGGAAGGTTGTGGG - Intergenic
902968935 1:20032726-20032748 ATGCCATTCAGGAAGGAGGATGG - Intronic
903281321 1:22251561-22251583 ATGCCAGACTGGAAGGTTTCTGG - Intergenic
905334326 1:37233780-37233802 ATGCAATTTTGCAAGGTTGTGGG - Intergenic
905491807 1:38350163-38350185 ATCCCATGGTGGAAGGTGGAAGG + Intergenic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
909059981 1:70868844-70868866 ATGCCATAGTGGGAGGTTGTGGG + Intronic
909576125 1:77178295-77178317 ATGCCCTTCTAGAAGTATGAAGG - Intronic
909825012 1:80116807-80116829 ATGCTCTTCTGGAAGAGTGAAGG + Intergenic
910116397 1:83736708-83736730 ATCACATTCTGGAAAGTTGAAGG + Intergenic
910544559 1:88399049-88399071 ATCCCATACTGGGAGGTGGAAGG - Intergenic
910927067 1:92408590-92408612 ATTCCATGGTGGAAGGTGGAAGG - Intergenic
911264591 1:95728011-95728033 ATTCCATGATGGAAGGTTGAAGG + Intergenic
912240945 1:107907728-107907750 ATACCATGGTGGAAGGTGGAAGG - Intronic
912386081 1:109271823-109271845 ATCCCTTCCTGGAAGGTGGAAGG + Intronic
912932081 1:113973120-113973142 CTGCCATGCTGGAAGGTGTAGGG - Exonic
913228886 1:116724556-116724578 ATCCCATGGTGGAAGGTGGAAGG + Intergenic
914319774 1:146548027-146548049 ATTCCCTTCTGGAGGCTTGAGGG + Intergenic
915401322 1:155624055-155624077 AGCCCATGCTGGAAGGTTGTGGG + Intergenic
916022498 1:160805889-160805911 ATGCCATTATGTAATGATGAAGG - Intronic
918808392 1:189080599-189080621 ATGCCCTACTGGCAGGTTGTAGG - Intergenic
919195394 1:194278520-194278542 AGGCCCTTCTTGAAGGTGGAGGG + Intergenic
919340995 1:196306509-196306531 GTCCAACTCTGGAAGGTTGATGG + Intronic
920826348 1:209427218-209427240 ATGCTATTCTGGAAGGAAGAGGG + Intergenic
920978438 1:210808433-210808455 GAGGCATTCTGGAAGGTTAAGGG + Intronic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922728492 1:227937706-227937728 ATGCCCCTCTGGAGGCTTGAGGG - Intronic
922852285 1:228743360-228743382 CTGACGTTCTGGAAGGATGAGGG - Exonic
923003114 1:230023822-230023844 ATCCCACTCTGGAATTTTGATGG - Intergenic
923511704 1:234658824-234658846 ATTCCATTATCGAAGGTGGAGGG + Intergenic
1064350656 10:14573340-14573362 ATCCCATGGTGGAAGGTGGAAGG - Intronic
1069185620 10:65418822-65418844 ATCCCATGATGGAAGGTGGAAGG - Intergenic
1072016295 10:91349966-91349988 ATCCCCATCTGGAAGGTTGTGGG - Intergenic
1072863555 10:99032720-99032742 ATTCCATTCTGGAAGCTCTAAGG + Intronic
1073707532 10:106001908-106001930 CTTCCTTTCTGGAAGCTTGAGGG - Intergenic
1075620112 10:123920880-123920902 ATCCCATGGTGGAAGGTGGAAGG - Intronic
1076427748 10:130379633-130379655 ATTCCAGGCTGGAAGGATGAAGG - Intergenic
1080898537 11:36466319-36466341 ATTCCTTTCTGGAAGCTTTAAGG + Intergenic
1081182087 11:39996329-39996351 ATGCCATGGTGGAAGGTGGAAGG - Intergenic
1082068067 11:47916888-47916910 ATCCCAATCTGCAAGGCTGAAGG + Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1083376656 11:62228828-62228850 ATACCCTTCTGGAAGTGTGAAGG - Intergenic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1085856695 11:80183263-80183285 ATTGCATGCTGGAAGGTGGAAGG - Intergenic
1086935605 11:92742665-92742687 ATTCCATGGTGGAAGGTGGAAGG - Intronic
1088749778 11:112833971-112833993 ATCCCATTCTGGTAGGTAAAAGG + Intergenic
1089846098 11:121459814-121459836 ATGCCAATCTGGAGGGTTGAAGG - Intronic
1089998733 11:122934503-122934525 CTGGTCTTCTGGAAGGTTGATGG - Exonic
1091049596 11:132355437-132355459 ATGTCCTCCTGGAAGGATGATGG + Intergenic
1091294302 11:134462076-134462098 ATCCCATGGTGGAAGGTGGAAGG - Intergenic
1091358909 11:134958784-134958806 ATGCAGTTCTGGAATGTAGAAGG + Intergenic
1093038994 12:14358113-14358135 ATTCCATGGTGGAAGGTGGAAGG + Intergenic
1093356236 12:18171840-18171862 ATGCCATTCTAGAAGATTGAAGG - Intronic
1094024232 12:25945510-25945532 GTGCCCATCTGGAAGGATGAAGG + Intergenic
1094558167 12:31523368-31523390 TTGCAATTCTGGAAGATTTAGGG + Intronic
1096125069 12:49113140-49113162 ATGCCCCGCTGGAAGGTTGTGGG - Intergenic
1096430175 12:51536822-51536844 CTGCAATTTTAGAAGGTTGAGGG - Intergenic
1096623041 12:52876466-52876488 GTGCCAAGATGGAAGGTTGAGGG - Intergenic
1097566898 12:61281591-61281613 AGGCCTATCTTGAAGGTTGAAGG - Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1100068501 12:90681155-90681177 AAGACATTCTGGAAGGTAAAGGG - Intergenic
1100333704 12:93609918-93609940 ATCCCATGGTGGAAGGTGGAAGG + Intergenic
1101451701 12:104785702-104785724 ATCCCATGGTGGAAGGTGGAGGG + Intergenic
1103234174 12:119358385-119358407 ATCCCATGGTGGAAGGTGGAAGG - Intronic
1104671669 12:130685092-130685114 CTGCCATTTAGGAAGGTTGCAGG - Intronic
1106770460 13:32956583-32956605 ATTTCATCCTGAAAGGTTGAGGG + Intergenic
1107019279 13:35735085-35735107 ATCCCATGGTGGAAGGTGGAAGG + Intergenic
1107636695 13:42399377-42399399 CTGCCAGTCTGGAAGGCTGCAGG - Intergenic
1107880569 13:44828847-44828869 ATCCCATGGTGGAAGGTGGAAGG + Intergenic
1111594602 13:90395612-90395634 ATGCCCTTCTAGAAGACTGATGG - Intergenic
1111716242 13:91883109-91883131 AAGCCAGTCTGGAAGGTGCAAGG + Intronic
1111804491 13:93022700-93022722 TTACCATTCTGGAAGCTTCATGG - Intergenic
1115736699 14:36339323-36339345 ATCCCATGGTGGAAGGTAGAAGG + Intergenic
1116423140 14:44756882-44756904 ATGCCATTCTGGAAAGAAGTAGG + Intergenic
1116478230 14:45366204-45366226 AAGCATTCCTGGAAGGTTGAGGG - Intergenic
1116802884 14:49461809-49461831 ATGTGCTTCTGGAAGGCTGAAGG - Intergenic
1117034832 14:51717315-51717337 ATCCCATGATGGAAGGTGGAAGG + Intronic
1117530264 14:56654114-56654136 ATTACATTCTGGAGGGTTGAAGG - Intronic
1118299850 14:64605675-64605697 ATGCCATTCTGGATGAATGAGGG + Intergenic
1120703544 14:87724551-87724573 ATTCCATGGTGGAAGGTGGAAGG + Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1121751531 14:96362426-96362448 ATGACATTCTGGAAGGATTAAGG - Intronic
1123100338 14:105793413-105793435 ATGCCATTGTGGGAGGTGGGGGG - Intergenic
1124240019 15:28020881-28020903 AGGCCTTTCTGGAAGGCTGCTGG + Intronic
1124936700 15:34179250-34179272 ATCCCATGGTGGAAGGTAGAAGG + Intronic
1125291972 15:38159221-38159243 ATTCCATGGTGGAAGGTGGAAGG - Intergenic
1126508034 15:49430642-49430664 ATTCCATGGTGGAAGGTAGAAGG + Intronic
1126740890 15:51775069-51775091 GGGCCCTTCTGGAAGATTGAAGG + Intronic
1127864698 15:63022835-63022857 ATGCCAGTGTGGATGGTTGATGG - Intergenic
1131204805 15:90434606-90434628 ATGCAAGTCTGGAAGGATGGTGG + Intronic
1131949059 15:97661024-97661046 ATTCCATGATGGAAGGTGGAAGG - Intergenic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1134018343 16:10904789-10904811 AGGCCATTTTGGAAGCTTGTTGG - Exonic
1134050733 16:11135491-11135513 ATGCTTTTCTGGGAGGTGGAGGG + Intronic
1135754339 16:25083843-25083865 ATCCCATGGTGGAAGGTGGACGG - Intergenic
1136995453 16:35185837-35185859 ATGCCAGGCTGGAAGGAGGAGGG + Intergenic
1139489036 16:67276774-67276796 AGGCCAGTCTGGGAGGTAGATGG + Intergenic
1140013754 16:71162050-71162072 ATTCCCTTCTGGAGGCTTGAGGG - Intronic
1142295772 16:89221112-89221134 CTGCCATCCTGGGAGGCTGACGG - Exonic
1144459943 17:15450413-15450435 ATTGCATTTTGGAAGGTGGAGGG - Intronic
1147166575 17:38596589-38596611 ATGCCATTCTGGAAGGTTGATGG + Intronic
1152926809 17:83091114-83091136 CTCCCATTCTGGAGGGTTGCTGG + Intronic
1153707463 18:7760752-7760774 ATAACATTCTAGAAGGTAGATGG + Intronic
1156631960 18:38980730-38980752 ATGCCATTCTTCTAGCTTGATGG + Intergenic
1157013303 18:43678854-43678876 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1157543479 18:48530494-48530516 ATCCCATAGTGGAAGGTGGAAGG + Intergenic
1157781497 18:50443911-50443933 ATCCCATGGTGGAAGGTGGAAGG + Intergenic
1158490970 18:57909493-57909515 ATCCCATGGTGGAAGGTGGAAGG - Intergenic
1158599404 18:58844417-58844439 AGGCTATTCTGTAAGGTTCAGGG - Intergenic
1159195668 18:65110878-65110900 ATCCCATGCTGGAAGGTTGTGGG - Intergenic
1159871831 18:73767274-73767296 ATTCCTTTCTGGAAGCTTTAGGG + Intergenic
1160262929 18:77312438-77312460 ATGCCTTTCTAGAAGAGTGAAGG + Intergenic
1160893842 19:1393682-1393704 GTGCCCTTCTGTAAGGCTGAGGG - Intronic
1163766634 19:19166764-19166786 CTGCCCTTCTGGAAGATTCAAGG - Intronic
1164024487 19:21338767-21338789 AGCCCATGCTGGAAGGTTGTGGG - Intergenic
1166208635 19:41290748-41290770 ATCCCATTTTAGAAGGTGGATGG - Intronic
1168637223 19:58005786-58005808 ATGCCATTGTAAAAGGTTCATGG + Intronic
924975205 2:167181-167203 CTGCCATTCTTGAGGGTCGATGG - Intergenic
925303154 2:2831116-2831138 ATCCCATGGTGGAAGGTGGAAGG - Intergenic
926851509 2:17203212-17203234 ATTCCATGGTGGAAGGTGGAAGG + Intergenic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
929114754 2:38434741-38434763 ATCCCATGGTGGAAGGGTGAAGG - Intergenic
929617251 2:43321615-43321637 ATCCCATGGTGGAAGGCTGAAGG - Intronic
931553799 2:63477491-63477513 AAACCATTCTGGGAGGTAGAAGG + Intronic
931637576 2:64354724-64354746 ATGCCAGTCTGCAAGATTGGGGG - Intergenic
932291762 2:70586792-70586814 AGGCCAGTCTGGAAGGGTAAGGG - Intergenic
935013508 2:99157647-99157669 ATGCTATTATGGAAGCTTCAAGG - Intronic
935238812 2:101160728-101160750 ATGCCATTCTAGGAGGGGGAGGG + Intronic
936125578 2:109787009-109787031 ATGCCCTTCTGGAAAGGTGAAGG + Intergenic
936219115 2:110584459-110584481 ATGCCCTTCTGGAAAGGTGAAGG - Intergenic
936238464 2:110766953-110766975 ATTCCTTTCTGCAAGGCTGAGGG - Intronic
938364594 2:130725067-130725089 ATGCCATGATGGAAGGTGGAAGG - Intergenic
938654702 2:133419163-133419185 ATGCCACTCTAGAATGTTCAAGG + Intronic
938713739 2:133999746-133999768 ATCCCATGATGGAAGGTAGAAGG + Intergenic
938728635 2:134129138-134129160 ATTCCTTTCTGGAGGCTTGAAGG + Intronic
938790649 2:134672764-134672786 GTGGCATTCTGGATGGATGAAGG - Intronic
940361699 2:152803109-152803131 CTACCAGTCTGGAAGGTTGAGGG + Intergenic
941764771 2:169284823-169284845 ATGACATTCTGGGGGTTTGAGGG - Intronic
943024868 2:182615727-182615749 ATACCATGGTGGAAGGTAGAAGG + Intergenic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
945955455 2:216082012-216082034 ATGCCATTGGGGAGGGTGGAAGG + Intronic
946132376 2:217616751-217616773 ATCCCATGGTGGAAGGTGGAGGG + Intronic
947592311 2:231392854-231392876 AACCTATTCTGGAAGGTTGAAGG + Intergenic
948199154 2:236117285-236117307 TGGCCATTCTTGAAGGATGAAGG + Intronic
948817741 2:240521422-240521444 ATGCCTTTCTGGTGGGTTGTTGG + Intronic
1169234958 20:3923315-3923337 ATCCCATTGTGGAAGGTTTCAGG - Exonic
1169681393 20:8217888-8217910 ATCCCATGATGGAAGGTGGAAGG - Intronic
1170282861 20:14670617-14670639 ATGCCATTTTGAAATGTTGTAGG - Intronic
1170677801 20:18498521-18498543 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1170838753 20:19907059-19907081 ATTCCATGGTGGAAGGTGGAAGG + Intronic
1172149802 20:32781741-32781763 GTGCCATTCTGGTAGCATGATGG + Intronic
1173343996 20:42181521-42181543 ATCCCATAGAGGAAGGTTGAGGG - Intronic
1175126499 20:56756109-56756131 ATTCCATGGTGGAAGGTGGAAGG + Intergenic
1175376891 20:58533940-58533962 AACCCATTCTGAAAGGTTGAAGG + Intergenic
1180030183 21:45201566-45201588 TTTCCATTTTGGAAGGTGGAAGG + Intronic
1180137895 21:45873009-45873031 GTGCCACCCAGGAAGGTTGATGG - Intronic
1180636138 22:17264493-17264515 AGGCCATTCTGGAAGGTTCCGGG - Intergenic
1181540034 22:23568059-23568081 CTGTCATTCTGGCAGGTGGAGGG - Intergenic
1183063828 22:35350516-35350538 AGGCCATTCTGGAAGGGAGCAGG - Intergenic
950688549 3:14636925-14636947 GTGCCATGCTGTAAGGTTTATGG - Intergenic
951013041 3:17702896-17702918 AAGCCATTCTGAAAAGCTGAGGG + Intronic
951313048 3:21153165-21153187 AAGCTTTTCTGCAAGGTTGAGGG + Intergenic
953860644 3:46541491-46541513 TTGCCCTTCTGCAAGGTTTATGG - Intronic
955980152 3:64517085-64517107 AAGCCATTATGGATGGATGAAGG - Exonic
956255971 3:67283632-67283654 ATCCCAGTGTGGAAGGTGGAAGG + Intergenic
956334803 3:68151556-68151578 ATACCATGGTGGAAGGTGGAAGG + Intronic
958564813 3:95796669-95796691 ATGCCAATCTCAAAGCTTGATGG + Intergenic
961185582 3:124912321-124912343 ATGGGGTTCTGGAAGGGTGAGGG + Intronic
962185810 3:133258368-133258390 ATGCCCTTCTTGTAGCTTGATGG - Intronic
962850572 3:139305731-139305753 ATGCCTTTCTTGCAGGGTGACGG + Intronic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
965634981 3:170771568-170771590 AGGCCATTCAGGAATGCTGAAGG + Intronic
968108347 3:196020336-196020358 CTGCCATTCTGGAGGGGAGATGG - Intergenic
968266489 3:197367291-197367313 GTGGCATTCTGGAAGACTGAGGG - Intergenic
970909864 4:21262371-21262393 AAGGCATTCTGGAAGCCTGAAGG - Intronic
971341791 4:25776276-25776298 ATGCCTACCTGGAAGGTTCATGG - Exonic
971387642 4:26155769-26155791 CTTCCATAGTGGAAGGTTGAAGG + Intergenic
971643407 4:29164665-29164687 ATGCCGTACTGGAAGTGTGAAGG + Intergenic
978661052 4:111126706-111126728 GTTCCATTCTGGAAGCTTCAAGG - Intergenic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979206486 4:118044778-118044800 ATCTCATGGTGGAAGGTTGAAGG + Intronic
979589138 4:122458414-122458436 CTTCCATTCTGGAAGGGTAAAGG - Intergenic
979631090 4:122903984-122904006 ATGCCATTCTGGTGGGTTGTGGG - Intronic
980156622 4:129115441-129115463 ATGCAAACCTGGAAGTTTGAGGG + Exonic
981796993 4:148606547-148606569 ATCCCATGGTGGAAGGTGGAAGG - Intergenic
983355002 4:166645700-166645722 ATGCAATGGTGGAAGGTTGTGGG - Intergenic
983671223 4:170240131-170240153 ATCCCATGGTGGAAGGTGGAAGG + Intergenic
985470286 5:37955-37977 CTGCTATTCTGGAGGGGTGATGG - Intergenic
987531377 5:19125445-19125467 ATGCTATTCTGAAATGATGAAGG - Intergenic
987954628 5:24722596-24722618 ATGTCATTCTGGAAGGTCTCTGG + Intergenic
990082002 5:51928480-51928502 ATGCCCTTCTAGAAGATCGAAGG - Intergenic
990950219 5:61291287-61291309 ATTCCATTCAGGAAAATTGATGG + Intergenic
992471905 5:77065986-77066008 AGGCCATTCTGTAAAGTTGCAGG + Intergenic
994247155 5:97490707-97490729 ATCCCATGCTAGAAGGTGGAAGG - Intergenic
996233423 5:121095639-121095661 ATGCCCTGCTGGAAGCATGAGGG - Intergenic
999928741 5:156407839-156407861 ATGCCATTGTGGAGTGTTCAGGG + Intronic
1000892620 5:166817405-166817427 TTGTGATTTTGGAAGGTTGAGGG + Intergenic
1002064452 5:176645115-176645137 ATGCCATCCTGCAAGGCAGATGG - Exonic
1003263107 6:4541148-4541170 ATCCCATGGTGGAAGGTGGAAGG - Intergenic
1004835382 6:19525691-19525713 AAGCAATTCTGGATTGTTGAAGG - Intergenic
1005195143 6:23273901-23273923 CTGTCACTCTGTAAGGTTGATGG - Intergenic
1006290670 6:33133669-33133691 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1008661614 6:53673882-53673904 ATTACATTCTGAAAGCTTGATGG + Intergenic
1008881555 6:56385365-56385387 ATTCCTTTCTGGAAGCTTGAGGG + Intronic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1016045293 6:139474581-139474603 AGGCCATTCTGCAATGATGAAGG - Intergenic
1017454733 6:154591230-154591252 ATGCCAATCTGTAAGAATGAGGG - Intergenic
1020516676 7:9130239-9130261 ATCCCATTCTGGAAGCTGCAGGG + Intergenic
1022085955 7:27067694-27067716 AAGGCATTTTGGAAGGTTGTTGG - Intergenic
1023957135 7:44895349-44895371 AGGCCCTTCTGGAAGGTTCAGGG - Intergenic
1025122480 7:56317037-56317059 AGCCCATGCTGGAAGGTTGTGGG + Intergenic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033123306 7:138685417-138685439 ATGCCATTCTGAGTGGCTGAGGG + Intronic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1034318398 7:150156000-150156022 ATGTCATTCTGGAATGGAGAGGG + Intergenic
1034580588 7:152038496-152038518 ACGCAATGCTGGAAGGTTGTCGG - Intronic
1034581263 7:152044414-152044436 ATGCAATGCTGGAAGGCTGTCGG - Intronic
1034774353 7:153811232-153811254 ATGTCATTCTGGAATGGAGAGGG - Intergenic
1034907121 7:154959541-154959563 AGGCCATTCTTGAAGTGTGAGGG - Intronic
1036993243 8:13624722-13624744 ATGGCATTCTGGAAAATTTATGG - Intergenic
1037415255 8:18643170-18643192 ATCCCATTGTGGAAGGTGCAAGG + Intronic
1038070967 8:24012821-24012843 ATGCCATTCTGGCTGGTGTAAGG + Intergenic
1038390181 8:27190641-27190663 ATGCTATCCTGGAATGGTGAGGG + Intergenic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1042523915 8:69744427-69744449 ATGCCAATCCTGAAAGTTGATGG - Intronic
1042773437 8:72403720-72403742 AAGTCATCCTGGAAGGGTGAAGG + Intergenic
1045594835 8:103641669-103641691 ATGCCATTCTTGGGGGTGGAGGG + Intronic
1046275266 8:111950763-111950785 ATTCCTTTCTGGAAGTTCGAGGG - Intergenic
1047958592 8:129994559-129994581 CTCCCATTCTGGGAGGTAGATGG - Intronic
1048101521 8:131357543-131357565 ACCCCATGCTGGAAGGTTGTGGG + Intergenic
1048385422 8:133908068-133908090 ATCCCATTGTGGAAGGCAGAAGG + Intergenic
1048389198 8:133945165-133945187 ATTCCATTCAGGAAGGAAGAAGG - Intergenic
1050040831 9:1491525-1491547 ATTGCACTCTGGAAGGGTGAGGG + Intergenic
1052648607 9:31271349-31271371 ATCCCATAATGGAAGGTGGAAGG - Intergenic
1055452511 9:76443584-76443606 TAGCCATGCTGGAAGGTTGTGGG - Intronic
1056079254 9:83073447-83073469 ATATCAGTGTGGAAGGTTGAGGG - Intergenic
1057421528 9:94916886-94916908 ATGAGATTCTGGAATGTTTAAGG + Intronic
1058218064 9:102259719-102259741 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1058895368 9:109396285-109396307 ATGTCTTTCTGGAAGGGTCAGGG + Intronic
1058960894 9:109991827-109991849 ATCGCATCCTGGAAGCTTGAAGG + Intronic
1060697809 9:125724228-125724250 AGGACATTCTGGAAGGGAGAGGG + Intergenic
1061782941 9:133006509-133006531 AAGCCAGTCTGGAAGGAGGAAGG - Intergenic
1185745746 X:2572126-2572148 ATGCCACTGTGAAAGGTGGAGGG - Intergenic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1188238217 X:27754404-27754426 ATGCCATTCTGGAGTCTGGAGGG + Intergenic
1188929072 X:36082666-36082688 ATGCCAGTCAGGAAGCTTAAGGG + Intronic
1189704898 X:43749994-43750016 CTGCTATTCTAAAAGGTTGATGG - Intergenic
1190200217 X:48354950-48354972 AGTCCATTCTGGAAGGTGGGAGG - Intronic
1190933301 X:54969376-54969398 ATCCCATTGTGGAAGGTGAAAGG - Intronic
1191822130 X:65322258-65322280 ATGCCATTCTTGAAAGGTGGGGG - Intergenic
1193879648 X:86906527-86906549 ATCCCATTGTAGAAGGCTGAAGG + Intergenic
1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG + Intronic
1196464109 X:115956018-115956040 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1197099778 X:122638341-122638363 ATGCCAATCAGGAATGTTAATGG + Intergenic
1197342809 X:125293604-125293626 ATCCCATGGTGGAAGGTGGAAGG + Intergenic
1197388476 X:125829607-125829629 ATGACATTCTGGAGAGTTAAGGG - Intergenic
1198126857 X:133653408-133653430 TTGTCATTCTGGAAGGAGGAAGG + Intronic
1198319028 X:135499979-135500001 ATCCCATGGTGGAAGGTGGAAGG - Intergenic
1199423665 X:147676415-147676437 ATACCATTCTGGAATCTGGAAGG - Intergenic
1200407576 Y:2829125-2829147 ATGCCTTTCAGGAAGAGTGAAGG + Intergenic
1200967549 Y:9111000-9111022 AGGCCATTCTGGACTGTGGAGGG + Intergenic