ID: 1147170232

View in Genome Browser
Species Human (GRCh38)
Location 17:38614214-38614236
Sequence ATGTGTGTAAGGAAGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147170232_1147170238 23 Left 1147170232 17:38614214-38614236 CCCCCTTCCTTCCTTACACACAT No data
Right 1147170238 17:38614260-38614282 AGCTGAACTTTGCACTCCCCTGG No data
1147170232_1147170239 24 Left 1147170232 17:38614214-38614236 CCCCCTTCCTTCCTTACACACAT No data
Right 1147170239 17:38614261-38614283 GCTGAACTTTGCACTCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147170232 Original CRISPR ATGTGTGTAAGGAAGGAAGG GGG (reversed) Intergenic
No off target data available for this crispr