ID: 1147170557

View in Genome Browser
Species Human (GRCh38)
Location 17:38616455-38616477
Sequence GATGAAGGCCTGGCACCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147170551_1147170557 -3 Left 1147170551 17:38616435-38616457 CCTGGCAGTGCAGGAGGGATGAT No data
Right 1147170557 17:38616455-38616477 GATGAAGGCCTGGCACCAGGGGG No data
1147170550_1147170557 0 Left 1147170550 17:38616432-38616454 CCTCCTGGCAGTGCAGGAGGGAT No data
Right 1147170557 17:38616455-38616477 GATGAAGGCCTGGCACCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147170557 Original CRISPR GATGAAGGCCTGGCACCAGG GGG Intergenic
No off target data available for this crispr