ID: 1147174740

View in Genome Browser
Species Human (GRCh38)
Location 17:38647848-38647870
Sequence CTGTAGGGACAGGTTTGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147174733_1147174740 7 Left 1147174733 17:38647818-38647840 CCTATGTTAATAGAAGACAGAAA No data
Right 1147174740 17:38647848-38647870 CTGTAGGGACAGGTTTGGGATGG No data
1147174732_1147174740 8 Left 1147174732 17:38647817-38647839 CCCTATGTTAATAGAAGACAGAA No data
Right 1147174740 17:38647848-38647870 CTGTAGGGACAGGTTTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147174740 Original CRISPR CTGTAGGGACAGGTTTGGGA TGG Intergenic
No off target data available for this crispr