ID: 1147176542

View in Genome Browser
Species Human (GRCh38)
Location 17:38659372-38659394
Sequence CTTGCCAGGGATGTGGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147176542_1147176548 -10 Left 1147176542 17:38659372-38659394 CCCCTTCCCACATCCCTGGCAAG No data
Right 1147176548 17:38659385-38659407 CCCTGGCAAGATCTAGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147176542 Original CRISPR CTTGCCAGGGATGTGGGAAG GGG (reversed) Intergenic
No off target data available for this crispr