ID: 1147176567

View in Genome Browser
Species Human (GRCh38)
Location 17:38659479-38659501
Sequence AGGGGCTTCTCCCCTTGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147176567_1147176575 11 Left 1147176567 17:38659479-38659501 CCCTACCAAGGGGAGAAGCCCCT No data
Right 1147176575 17:38659513-38659535 TGCAGCTTCTCTTTATGCCAAGG No data
1147176567_1147176576 23 Left 1147176567 17:38659479-38659501 CCCTACCAAGGGGAGAAGCCCCT No data
Right 1147176576 17:38659525-38659547 TTATGCCAAGGTTAATGTAGAGG No data
1147176567_1147176579 30 Left 1147176567 17:38659479-38659501 CCCTACCAAGGGGAGAAGCCCCT No data
Right 1147176579 17:38659532-38659554 AAGGTTAATGTAGAGGAGGAAGG No data
1147176567_1147176577 26 Left 1147176567 17:38659479-38659501 CCCTACCAAGGGGAGAAGCCCCT No data
Right 1147176577 17:38659528-38659550 TGCCAAGGTTAATGTAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147176567 Original CRISPR AGGGGCTTCTCCCCTTGGTA GGG (reversed) Intergenic
No off target data available for this crispr