ID: 1147176568

View in Genome Browser
Species Human (GRCh38)
Location 17:38659480-38659502
Sequence GAGGGGCTTCTCCCCTTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147176568_1147176579 29 Left 1147176568 17:38659480-38659502 CCTACCAAGGGGAGAAGCCCCTC No data
Right 1147176579 17:38659532-38659554 AAGGTTAATGTAGAGGAGGAAGG No data
1147176568_1147176576 22 Left 1147176568 17:38659480-38659502 CCTACCAAGGGGAGAAGCCCCTC No data
Right 1147176576 17:38659525-38659547 TTATGCCAAGGTTAATGTAGAGG No data
1147176568_1147176577 25 Left 1147176568 17:38659480-38659502 CCTACCAAGGGGAGAAGCCCCTC No data
Right 1147176577 17:38659528-38659550 TGCCAAGGTTAATGTAGAGGAGG No data
1147176568_1147176580 30 Left 1147176568 17:38659480-38659502 CCTACCAAGGGGAGAAGCCCCTC No data
Right 1147176580 17:38659533-38659555 AGGTTAATGTAGAGGAGGAAGGG No data
1147176568_1147176575 10 Left 1147176568 17:38659480-38659502 CCTACCAAGGGGAGAAGCCCCTC No data
Right 1147176575 17:38659513-38659535 TGCAGCTTCTCTTTATGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147176568 Original CRISPR GAGGGGCTTCTCCCCTTGGT AGG (reversed) Intergenic
No off target data available for this crispr