ID: 1147176569

View in Genome Browser
Species Human (GRCh38)
Location 17:38659484-38659506
Sequence CTCTGAGGGGCTTCTCCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147176569_1147176581 30 Left 1147176569 17:38659484-38659506 CCAAGGGGAGAAGCCCCTCAGAG No data
Right 1147176581 17:38659537-38659559 TAATGTAGAGGAGGAAGGGATGG No data
1147176569_1147176579 25 Left 1147176569 17:38659484-38659506 CCAAGGGGAGAAGCCCCTCAGAG No data
Right 1147176579 17:38659532-38659554 AAGGTTAATGTAGAGGAGGAAGG No data
1147176569_1147176575 6 Left 1147176569 17:38659484-38659506 CCAAGGGGAGAAGCCCCTCAGAG No data
Right 1147176575 17:38659513-38659535 TGCAGCTTCTCTTTATGCCAAGG No data
1147176569_1147176580 26 Left 1147176569 17:38659484-38659506 CCAAGGGGAGAAGCCCCTCAGAG No data
Right 1147176580 17:38659533-38659555 AGGTTAATGTAGAGGAGGAAGGG No data
1147176569_1147176576 18 Left 1147176569 17:38659484-38659506 CCAAGGGGAGAAGCCCCTCAGAG No data
Right 1147176576 17:38659525-38659547 TTATGCCAAGGTTAATGTAGAGG No data
1147176569_1147176577 21 Left 1147176569 17:38659484-38659506 CCAAGGGGAGAAGCCCCTCAGAG No data
Right 1147176577 17:38659528-38659550 TGCCAAGGTTAATGTAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147176569 Original CRISPR CTCTGAGGGGCTTCTCCCCT TGG (reversed) Intergenic
No off target data available for this crispr