ID: 1147176571

View in Genome Browser
Species Human (GRCh38)
Location 17:38659497-38659519
Sequence AGCTGCAGGTAGCCTCTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147176571_1147176586 26 Left 1147176571 17:38659497-38659519 CCCCTCAGAGGCTACCTGCAGCT No data
Right 1147176586 17:38659546-38659568 GGAGGAAGGGATGGAGGGAGGGG No data
1147176571_1147176582 20 Left 1147176571 17:38659497-38659519 CCCCTCAGAGGCTACCTGCAGCT No data
Right 1147176582 17:38659540-38659562 TGTAGAGGAGGAAGGGATGGAGG No data
1147176571_1147176577 8 Left 1147176571 17:38659497-38659519 CCCCTCAGAGGCTACCTGCAGCT No data
Right 1147176577 17:38659528-38659550 TGCCAAGGTTAATGTAGAGGAGG No data
1147176571_1147176575 -7 Left 1147176571 17:38659497-38659519 CCCCTCAGAGGCTACCTGCAGCT No data
Right 1147176575 17:38659513-38659535 TGCAGCTTCTCTTTATGCCAAGG No data
1147176571_1147176583 21 Left 1147176571 17:38659497-38659519 CCCCTCAGAGGCTACCTGCAGCT No data
Right 1147176583 17:38659541-38659563 GTAGAGGAGGAAGGGATGGAGGG No data
1147176571_1147176576 5 Left 1147176571 17:38659497-38659519 CCCCTCAGAGGCTACCTGCAGCT No data
Right 1147176576 17:38659525-38659547 TTATGCCAAGGTTAATGTAGAGG No data
1147176571_1147176579 12 Left 1147176571 17:38659497-38659519 CCCCTCAGAGGCTACCTGCAGCT No data
Right 1147176579 17:38659532-38659554 AAGGTTAATGTAGAGGAGGAAGG No data
1147176571_1147176580 13 Left 1147176571 17:38659497-38659519 CCCCTCAGAGGCTACCTGCAGCT No data
Right 1147176580 17:38659533-38659555 AGGTTAATGTAGAGGAGGAAGGG No data
1147176571_1147176584 24 Left 1147176571 17:38659497-38659519 CCCCTCAGAGGCTACCTGCAGCT No data
Right 1147176584 17:38659544-38659566 GAGGAGGAAGGGATGGAGGGAGG No data
1147176571_1147176581 17 Left 1147176571 17:38659497-38659519 CCCCTCAGAGGCTACCTGCAGCT No data
Right 1147176581 17:38659537-38659559 TAATGTAGAGGAGGAAGGGATGG No data
1147176571_1147176585 25 Left 1147176571 17:38659497-38659519 CCCCTCAGAGGCTACCTGCAGCT No data
Right 1147176585 17:38659545-38659567 AGGAGGAAGGGATGGAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147176571 Original CRISPR AGCTGCAGGTAGCCTCTGAG GGG (reversed) Intergenic
No off target data available for this crispr