ID: 1147176579

View in Genome Browser
Species Human (GRCh38)
Location 17:38659532-38659554
Sequence AAGGTTAATGTAGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147176571_1147176579 12 Left 1147176571 17:38659497-38659519 CCCCTCAGAGGCTACCTGCAGCT No data
Right 1147176579 17:38659532-38659554 AAGGTTAATGTAGAGGAGGAAGG No data
1147176573_1147176579 10 Left 1147176573 17:38659499-38659521 CCTCAGAGGCTACCTGCAGCTTC No data
Right 1147176579 17:38659532-38659554 AAGGTTAATGTAGAGGAGGAAGG No data
1147176569_1147176579 25 Left 1147176569 17:38659484-38659506 CCAAGGGGAGAAGCCCCTCAGAG No data
Right 1147176579 17:38659532-38659554 AAGGTTAATGTAGAGGAGGAAGG No data
1147176567_1147176579 30 Left 1147176567 17:38659479-38659501 CCCTACCAAGGGGAGAAGCCCCT No data
Right 1147176579 17:38659532-38659554 AAGGTTAATGTAGAGGAGGAAGG No data
1147176574_1147176579 -2 Left 1147176574 17:38659511-38659533 CCTGCAGCTTCTCTTTATGCCAA No data
Right 1147176579 17:38659532-38659554 AAGGTTAATGTAGAGGAGGAAGG No data
1147176568_1147176579 29 Left 1147176568 17:38659480-38659502 CCTACCAAGGGGAGAAGCCCCTC No data
Right 1147176579 17:38659532-38659554 AAGGTTAATGTAGAGGAGGAAGG No data
1147176572_1147176579 11 Left 1147176572 17:38659498-38659520 CCCTCAGAGGCTACCTGCAGCTT No data
Right 1147176579 17:38659532-38659554 AAGGTTAATGTAGAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147176579 Original CRISPR AAGGTTAATGTAGAGGAGGA AGG Intergenic
No off target data available for this crispr