ID: 1147180342

View in Genome Browser
Species Human (GRCh38)
Location 17:38680725-38680747
Sequence CAGAATTCCCTAAGTCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147180328_1147180342 30 Left 1147180328 17:38680672-38680694 CCATTTCTCCACCCTGCCACACC No data
Right 1147180342 17:38680725-38680747 CAGAATTCCCTAAGTCAGCAGGG No data
1147180335_1147180342 4 Left 1147180335 17:38680698-38680720 CCACCATCATTTAACCTTTCTTG No data
Right 1147180342 17:38680725-38680747 CAGAATTCCCTAAGTCAGCAGGG No data
1147180338_1147180342 -10 Left 1147180338 17:38680712-38680734 CCTTTCTTGGTCCCAGAATTCCC No data
Right 1147180342 17:38680725-38680747 CAGAATTCCCTAAGTCAGCAGGG No data
1147180329_1147180342 22 Left 1147180329 17:38680680-38680702 CCACCCTGCCACACCCAGCCACC No data
Right 1147180342 17:38680725-38680747 CAGAATTCCCTAAGTCAGCAGGG No data
1147180334_1147180342 8 Left 1147180334 17:38680694-38680716 CCAGCCACCATCATTTAACCTTT No data
Right 1147180342 17:38680725-38680747 CAGAATTCCCTAAGTCAGCAGGG No data
1147180330_1147180342 19 Left 1147180330 17:38680683-38680705 CCCTGCCACACCCAGCCACCATC No data
Right 1147180342 17:38680725-38680747 CAGAATTCCCTAAGTCAGCAGGG No data
1147180337_1147180342 1 Left 1147180337 17:38680701-38680723 CCATCATTTAACCTTTCTTGGTC No data
Right 1147180342 17:38680725-38680747 CAGAATTCCCTAAGTCAGCAGGG No data
1147180332_1147180342 14 Left 1147180332 17:38680688-38680710 CCACACCCAGCCACCATCATTTA No data
Right 1147180342 17:38680725-38680747 CAGAATTCCCTAAGTCAGCAGGG No data
1147180331_1147180342 18 Left 1147180331 17:38680684-38680706 CCTGCCACACCCAGCCACCATCA No data
Right 1147180342 17:38680725-38680747 CAGAATTCCCTAAGTCAGCAGGG No data
1147180333_1147180342 9 Left 1147180333 17:38680693-38680715 CCCAGCCACCATCATTTAACCTT No data
Right 1147180342 17:38680725-38680747 CAGAATTCCCTAAGTCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147180342 Original CRISPR CAGAATTCCCTAAGTCAGCA GGG Intergenic
No off target data available for this crispr