ID: 1147182185

View in Genome Browser
Species Human (GRCh38)
Location 17:38693375-38693397
Sequence TCCCCCATCATTTTCTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147182185_1147182188 17 Left 1147182185 17:38693375-38693397 CCAGGGGAGAAAATGATGGGGGA No data
Right 1147182188 17:38693415-38693437 ATATTCTGCACATATTTTGAAGG No data
1147182185_1147182189 30 Left 1147182185 17:38693375-38693397 CCAGGGGAGAAAATGATGGGGGA No data
Right 1147182189 17:38693428-38693450 ATTTTGAAGGTAGAGCCAACAGG 0: 11
1: 63
2: 177
3: 412
4: 902

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147182185 Original CRISPR TCCCCCATCATTTTCTCCCC TGG (reversed) Intergenic
No off target data available for this crispr