ID: 1147183754

View in Genome Browser
Species Human (GRCh38)
Location 17:38702912-38702934
Sequence GGCTGGGCTGGATTCGTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 359}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147183754_1147183768 10 Left 1147183754 17:38702912-38702934 CCCGCCACGAATCCAGCCCAGCC 0: 1
1: 0
2: 2
3: 24
4: 359
Right 1147183768 17:38702945-38702967 CGGGTTTCTCCAGACCTCGCAGG 0: 1
1: 0
2: 0
3: 7
4: 76
1147183754_1147183762 -9 Left 1147183754 17:38702912-38702934 CCCGCCACGAATCCAGCCCAGCC 0: 1
1: 0
2: 2
3: 24
4: 359
Right 1147183762 17:38702926-38702948 AGCCCAGCCCGCGGGGCACCGGG 0: 1
1: 0
2: 3
3: 18
4: 242
1147183754_1147183771 22 Left 1147183754 17:38702912-38702934 CCCGCCACGAATCCAGCCCAGCC 0: 1
1: 0
2: 2
3: 24
4: 359
Right 1147183771 17:38702957-38702979 GACCTCGCAGGGAACATTTGCGG 0: 1
1: 0
2: 0
3: 8
4: 62
1147183754_1147183761 -10 Left 1147183754 17:38702912-38702934 CCCGCCACGAATCCAGCCCAGCC 0: 1
1: 0
2: 2
3: 24
4: 359
Right 1147183761 17:38702925-38702947 CAGCCCAGCCCGCGGGGCACCGG 0: 1
1: 0
2: 3
3: 32
4: 325
1147183754_1147183769 11 Left 1147183754 17:38702912-38702934 CCCGCCACGAATCCAGCCCAGCC 0: 1
1: 0
2: 2
3: 24
4: 359
Right 1147183769 17:38702946-38702968 GGGTTTCTCCAGACCTCGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 98
1147183754_1147183773 26 Left 1147183754 17:38702912-38702934 CCCGCCACGAATCCAGCCCAGCC 0: 1
1: 0
2: 2
3: 24
4: 359
Right 1147183773 17:38702961-38702983 TCGCAGGGAACATTTGCGGATGG 0: 1
1: 0
2: 0
3: 1
4: 55
1147183754_1147183774 27 Left 1147183754 17:38702912-38702934 CCCGCCACGAATCCAGCCCAGCC 0: 1
1: 0
2: 2
3: 24
4: 359
Right 1147183774 17:38702962-38702984 CGCAGGGAACATTTGCGGATGGG 0: 1
1: 0
2: 0
3: 3
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147183754 Original CRISPR GGCTGGGCTGGATTCGTGGC GGG (reversed) Intergenic
900544711 1:3222218-3222240 GGCTGGGCTGGGTGGGTGGGAGG - Intronic
900574032 1:3374194-3374216 GGATGTGCTGGTTTCGGGGCAGG - Intronic
900601474 1:3504571-3504593 CGCTGGGCTGGAATCGCGTCGGG + Intronic
900659298 1:3774794-3774816 GTCTGGGGAGGATGCGTGGCTGG - Intronic
901059447 1:6465382-6465404 GGCAGGGCTGGAGAGGTGGCGGG - Intronic
902059287 1:13628688-13628710 GGATGGGCTGGATGGGTAGCGGG - Intergenic
902374396 1:16023496-16023518 GGCTGGGCAGGATTTGTGGCAGG - Intronic
902379351 1:16045374-16045396 GGCCGGGCAGGATTTGTGGGAGG - Intronic
902678680 1:18027995-18028017 AGCTGGGTTGGAGTCGTGGCTGG + Intergenic
902812936 1:18899387-18899409 GGCTGAGCTGGAGTCATGTCTGG + Intronic
903263191 1:22142356-22142378 GGCTGGGCTGGAGGCGTGCAGGG - Intronic
903406134 1:23097899-23097921 GGCTGGGCTGAATTTGTAGAGGG + Intronic
905386312 1:37606614-37606636 GGGTGAGATGGATTCCTGGCTGG - Intergenic
906797743 1:48711189-48711211 GGCTGGGCTGCACTCTTGGGGGG + Intronic
906995452 1:50788930-50788952 GGCTGGGGTGGATTGATTGCTGG - Intronic
907276211 1:53317913-53317935 TGGTGGGCTGGATTCTGGGCAGG - Intronic
907413752 1:54300134-54300156 AGCAGTGCTGGACTCGTGGCTGG + Intronic
907512984 1:54976066-54976088 GGCTGGGCTGGCCTCTTGTCTGG - Intergenic
912507203 1:110164510-110164532 GGCTGGGCTGCAGTCATGACTGG - Intronic
913171553 1:116237281-116237303 GGCTGGGCTGCATTCCTGCGGGG + Intergenic
914047198 1:144102614-144102636 GGCTTGGCTGGCTGGGTGGCTGG + Intergenic
914677892 1:149917859-149917881 GGCGGGGCTGGAGTGGTGGAAGG - Exonic
915902601 1:159857176-159857198 AGCTGGGCTTGAATCCTGGCTGG - Intronic
916533735 1:165682980-165683002 GGCTTGGCTGCATCCATGGCTGG - Exonic
917291589 1:173477207-173477229 GGCTGGGCTGGGCGCGGGGCGGG - Intergenic
917370661 1:174290082-174290104 AGCTGGGCTGGATTGCTGACTGG + Intronic
917671118 1:177274553-177274575 GGATGGGCTGGGTTTGTGTCTGG + Intronic
919592722 1:199524667-199524689 GGCTGGGCTGCTTTCCTGTCTGG + Intergenic
919829574 1:201531098-201531120 GGGTGGGCTGGATGAGTGGAGGG + Intergenic
920508977 1:206536776-206536798 GGGTGGGCGGGTTTTGTGGCAGG - Intronic
924700188 1:246443597-246443619 GGTTGGGCTGGTGTAGTGGCAGG + Intronic
1065928674 10:30459124-30459146 GGCTGAACTGCATTCGTTGCAGG + Intronic
1070558359 10:77547061-77547083 GGCTGGGCTGGGTTCCTGTGTGG - Intronic
1070767442 10:79065033-79065055 GGCTGGGCTGGGATGGGGGCGGG - Intergenic
1070921399 10:80188873-80188895 GGCTGGGCTGGTCCCCTGGCGGG - Intronic
1071037464 10:81265079-81265101 CGCTGTGCTGGATTTGTCGCCGG - Intergenic
1073381122 10:103078822-103078844 GGCTGGGCTGTGTGCGGGGCAGG + Exonic
1075024545 10:118974997-118975019 GGCAGGGCTGGGTTCGTTTCTGG + Intergenic
1075068606 10:119306107-119306129 GCCTGGGCTGGATTTGGGGGAGG + Intronic
1078150672 11:8757120-8757142 GGCAGGGCTGGACTCAAGGCAGG - Intronic
1080869985 11:36228796-36228818 GGCTGGGCTGGTATCTTGACTGG - Intronic
1081526893 11:43933740-43933762 GGCTGGGCTTGATTCTTGGGAGG + Intronic
1081651494 11:44827074-44827096 GGCTGGGCTGGAGTCTTGGGTGG + Intronic
1083854641 11:65386699-65386721 GGCGGGGCAGGATTCCAGGCAGG + Exonic
1084020359 11:66413680-66413702 GGCTGTGCTGGGTGGGTGGCTGG - Intergenic
1085515974 11:77112232-77112254 GGGTGGGCTGGATGGGTGGATGG + Intronic
1085986660 11:81795923-81795945 GGCTGTGCTGGTTTGGTGGAGGG - Intergenic
1087586764 11:100131530-100131552 GCCTGGACTTGATTCTTGGCAGG + Intronic
1088600395 11:111469301-111469323 GGCAGGGCTGGAGTCCTGGTGGG - Intronic
1088920955 11:114259489-114259511 TGCTGGGCAGGATGCGGGGCAGG + Intronic
1089340708 11:117755475-117755497 GGCAGGGATGGATTCTTGGCTGG - Intronic
1089569117 11:119390873-119390895 AGCTGGGCTGGACTCATGTCTGG + Intergenic
1090399755 11:126441473-126441495 GGCTCTGCTGGCTTCCTGGCTGG + Intronic
1090815083 11:130285891-130285913 AGGTGGGCTGGATCAGTGGCTGG - Intronic
1092263708 12:6965600-6965622 GGCTGTGCTGGACCCCTGGCTGG + Exonic
1092631875 12:10388790-10388812 TGATGGGGTGGATTCGTGGTCGG - Exonic
1094470194 12:30795911-30795933 GGCTGGGGTGGAATGGGGGCAGG - Intergenic
1094818870 12:34209776-34209798 GGCAGGGCTGGCCTCTTGGCTGG - Intergenic
1095581528 12:43806124-43806146 GGCAGGGCTGGAGTCGGGCCGGG - Intronic
1096111858 12:49033624-49033646 GGTGGGGCTGGATCCCTGGCTGG - Exonic
1096139582 12:49231989-49232011 TGCTGGGCTGATTTCCTGGCTGG + Intronic
1096179735 12:49544081-49544103 GGCTGGGCTGGCTGGGTGGGTGG + Intronic
1096465664 12:51846952-51846974 GGCTGGGCTGGACGGGTGACAGG - Intergenic
1096515435 12:52152728-52152750 GCCTGTGCTGGAGTCCTGGCTGG + Intergenic
1096694635 12:53340682-53340704 GGCTGGGCTGGGTGCATGGGCGG - Intronic
1101527292 12:105543071-105543093 GGCTGGGCTGCATTCTTATCTGG + Intergenic
1102584753 12:113915079-113915101 GGCTGGCCTGGAGTGGTGGGGGG + Exonic
1103851433 12:123936133-123936155 GGCTGGCCTGGAGCCCTGGCTGG + Exonic
1104092551 12:125527783-125527805 GGCTGGGTTGGATGGGTGGATGG - Intronic
1104307604 12:127623577-127623599 GGCTGGGCTGCATTCCTAGGAGG + Intergenic
1104462270 12:128965403-128965425 GGCTGGGCTGGGCTCCTGTCTGG - Intronic
1104893633 12:132151666-132151688 GGCTGGGCTGGAGCTGGGGCGGG + Intronic
1104966036 12:132509231-132509253 GGCTGGGCTGGAGCTGTTGCTGG - Intronic
1105865098 13:24451974-24451996 GGCTGTGCTGGACTCGTGCTGGG - Intronic
1106413649 13:29528115-29528137 GCCTGGCCTGGATTCCTGGCTGG + Intronic
1111214018 13:85119803-85119825 GGCTGGGGTGCAGTAGTGGCAGG - Intergenic
1117888689 14:60393748-60393770 GGCTGGGAAGGATTGGTGGGGGG - Intergenic
1118328307 14:64796473-64796495 GGCTGGGCTGGAGTCCAAGCTGG - Intronic
1118787031 14:69054577-69054599 GGCTGGGTTGTCTTTGTGGCTGG + Exonic
1119168639 14:72515999-72516021 GTCTGGGCTGAATCCCTGGCTGG - Intronic
1119408304 14:74412217-74412239 TGCTGGGCTGGGCTCGTGGCTGG + Intronic
1119766852 14:77195840-77195862 GGCTGGCCTGGATTTGGAGCTGG + Intronic
1120381085 14:83780738-83780760 GGCAGGGCTGCAGCCGTGGCAGG - Intergenic
1120969018 14:90192013-90192035 GGCTGGACTGGATTCCCAGCTGG + Intergenic
1121305433 14:92903724-92903746 GACTGGGCTGCATTTCTGGCAGG + Intergenic
1121515707 14:94548521-94548543 GGCTGGGCTGGAGCCATGGTGGG + Intergenic
1122254754 14:100468630-100468652 GGGTAGGATGGATTCGTGCCGGG + Intronic
1122519589 14:102334054-102334076 GGCAGGGCTGGAAGCCTGGCAGG - Intronic
1122627063 14:103090186-103090208 GGCTGAGCTGGCTCTGTGGCTGG + Intergenic
1122694438 14:103545910-103545932 GGCAGGGCTGGGTTTGGGGCAGG + Intergenic
1122789794 14:104179398-104179420 GGCCGGGCTGGGTCCGTGGGCGG - Intronic
1123416786 15:20100966-20100988 GGCTTGGCTGGCTGGGTGGCTGG + Intergenic
1123416873 15:20101323-20101345 GGCTTGGCTGGCTGGGTGGCTGG + Intergenic
1123416971 15:20101738-20101760 GGCTTGGCTGGCTGGGTGGCTGG + Intergenic
1123417620 15:20104461-20104483 GGCTTGGCTGGCTGGGTGGCTGG + Intergenic
1123417637 15:20104529-20104551 GGCTTGGCTGGCTGGGTGGCTGG + Intergenic
1123417724 15:20104887-20104909 GGCTTGGCTGGCTGGGTGGCTGG + Intergenic
1123417741 15:20104955-20104977 GGCTTGGCTGGCTGGGTGGCTGG + Intergenic
1123447645 15:20342090-20342112 GGCTTGGCTGGCTGGGTGGCTGG - Intergenic
1123447656 15:20342133-20342155 GGCTTGGCTGGCTGGGTGGCTGG - Intergenic
1123447967 15:20343563-20343585 GGCTGGCTTGGCTTGGTGGCTGG - Intergenic
1123526125 15:21108072-21108094 GGCTTGGCTGGCTGGGTGGCTGG + Intergenic
1123526212 15:21108429-21108451 GGCTTGGCTGGCTGGGTGGCTGG + Intergenic
1123526310 15:21108844-21108866 GGCTTGGCTGGCTGGGTGGCTGG + Intergenic
1123526994 15:21111739-21111761 GGCTTGGCTGGCTGGGTGGCTGG + Intergenic
1123527011 15:21111807-21111829 GGCTTGGCTGGCTGGGTGGCTGG + Intergenic
1124106235 15:26740456-26740478 GACTGGGCTGTGTTCCTGGCAGG + Intronic
1124626687 15:31311851-31311873 GGCTGGGCTGGAGTCCTGGCTGG - Intergenic
1126598165 15:50402418-50402440 GGATGGGCTGGAATTGTGACTGG + Intergenic
1127545280 15:59988304-59988326 GGCTGGGCTGGCTGGCTGGCTGG - Intergenic
1129253178 15:74319734-74319756 GGCTGGGCTGGGGTGGGGGCGGG - Intronic
1129592248 15:76927124-76927146 GTGTGGGCAGGATTCGTGTCTGG - Intergenic
1133641518 16:7721821-7721843 TGCTGGGCTGGATTCCTAGGAGG + Intergenic
1134299518 16:12977186-12977208 GGTTGGGCTGGGTTCCTGGGTGG + Intronic
1135738527 16:24953626-24953648 GGCTGTACAGGAATCGTGGCTGG - Intronic
1136020563 16:27437366-27437388 GGCTGGGAGGGATTTGAGGCAGG - Intronic
1136349006 16:29695035-29695057 GGCTGGACTGGGCACGTGGCAGG + Exonic
1136787734 16:32945724-32945746 GGCTGGGCTGGCATGGGGGCTGG + Intergenic
1136822787 16:33336249-33336271 GGCTTGGCTGGCTGCCTGGCTGG + Intergenic
1136823331 16:33338593-33338615 GGCTTGGCTGGCTGCCTGGCTGG + Intergenic
1136823549 16:33339535-33339557 GGCTTGGCTGGCTGCCTGGCTGG + Intergenic
1136834420 16:33491556-33491578 GGCTGGCTTGGATTGCTGGCTGG + Intergenic
1136834478 16:33491804-33491826 GGCTTGGCTGGCTGCCTGGCTGG + Intergenic
1136882047 16:33908065-33908087 GGCTGGGCTGGCATGGGGGCTGG - Intergenic
1137472774 16:48776819-48776841 TGGTGGGCTGGATTGGTGCCTGG + Intergenic
1138415648 16:56870029-56870051 GGCTGGGGTGGACTCAGGGCAGG - Intronic
1138588190 16:57985111-57985133 GGCGGGGCTGGATTGTGGGCGGG + Intronic
1140642340 16:76990880-76990902 GGCAGGGCTGGATTCCTTTCTGG + Intergenic
1140891252 16:79287277-79287299 AGCTGGGCTGGGAGCGTGGCAGG - Intergenic
1141003979 16:80335109-80335131 GACTGGGCTGGGTTCTGGGCAGG - Intergenic
1141538689 16:84700739-84700761 GGCTGGGATGGATTCGTGCAAGG - Intronic
1142078201 16:88132425-88132447 GGCGGGGCTGGATCTGTGACTGG + Intergenic
1203010323 16_KI270728v1_random:232228-232250 GGCTTGGCTGGCTGCCTGGCTGG - Intergenic
1203010500 16_KI270728v1_random:232966-232988 GGCTTGGCTGGCTGCCTGGCTGG - Intergenic
1203089962 16_KI270728v1_random:1207381-1207403 GGCTGGGCTGGCATGGGGGCTGG + Intergenic
1203138722 16_KI270728v1_random:1746565-1746587 GGCTTGGCTGGCTTGCTGGCTGG - Intergenic
1203139016 16_KI270728v1_random:1747898-1747920 GGCTTGGCTGGCTGGGTGGCTGG - Intergenic
1203144567 16_KI270728v1_random:1791767-1791789 GGCTTGGCTGGCTGCCTGGCTGG + Intergenic
1203144575 16_KI270728v1_random:1791814-1791836 GGCTTGGCTGGCTGCCTGGCTGG + Intergenic
1203144719 16_KI270728v1_random:1792454-1792476 GGCTTGGCTGGCTGCCTGGCTGG + Intergenic
1142594622 17:1023446-1023468 GGCAGGGCCGGCTTCCTGGCTGG - Intronic
1143512646 17:7404922-7404944 GGCTGGGATGGACGCGGGGCGGG + Intronic
1144876004 17:18397581-18397603 GGAGGGGCTGGAGTGGTGGCCGG + Intergenic
1145018593 17:19413926-19413948 GGCTGGGCTGGCCTCAAGGCCGG - Intronic
1145156224 17:20546839-20546861 GGAGGGGCTGGAGTGGTGGCCGG - Intergenic
1146674093 17:34761078-34761100 AGCTGGGCTGGCTTTGTGGGTGG - Intergenic
1147148089 17:38497842-38497864 GGCTGGGCTGGCATGGGGGCTGG + Intronic
1147183754 17:38702912-38702934 GGCTGGGCTGGATTCGTGGCGGG - Intergenic
1147331278 17:39700710-39700732 GCCTGGGCTGGATTCCTTGGGGG + Intronic
1147364791 17:39952797-39952819 GGCTGGGGTGGAGGCGGGGCTGG + Intergenic
1147885565 17:43682092-43682114 GACAGGGCTGGCTTCATGGCCGG + Intergenic
1148439461 17:47704219-47704241 AGCTCTGGTGGATTCGTGGCAGG + Intronic
1150488370 17:65559445-65559467 GACTGAGCTGGATTCTTGGTGGG - Intronic
1151557733 17:74855017-74855039 GGCAGGGCTGGGTCCGGGGCAGG - Exonic
1151805123 17:76400322-76400344 AGCTGGGCTGGACTCCTGGGAGG + Intronic
1151994172 17:77598127-77598149 CGCTGGGCTAGCTGCGTGGCAGG - Intergenic
1152067320 17:78118924-78118946 GGCTGGGCTGGCAGGGTGGCCGG - Intronic
1152213537 17:79018337-79018359 TGCTGGGCTGTATTCCTGGGAGG + Intergenic
1152253103 17:79221872-79221894 GGCTGGCATGGATGCCTGGCAGG + Intronic
1152572508 17:81126986-81127008 GGCTGGGCTGGATCCCCTGCTGG - Intronic
1152903958 17:82960533-82960555 GGCTGCGTTGGAGCCGTGGCAGG - Intronic
1154001784 18:10487821-10487843 GTCTGGGCTGGACCCGTCGCTGG - Exonic
1154010713 18:10571809-10571831 GGCTTGGCTGTTTTGGTGGCTGG + Intergenic
1155893472 18:31294483-31294505 GGCTGGGCTGGACTGATGGGTGG - Intergenic
1156844798 18:41652803-41652825 TGCTGGGCTCAATTCTTGGCTGG + Intergenic
1160753490 19:746508-746530 GGCCGGGCTGGATCCCCGGCGGG - Exonic
1160784393 19:892813-892835 CGCGGGGCTGGGTTCGGGGCGGG - Intronic
1160806088 19:992734-992756 GGCTGGGCTGGGGTGGGGGCTGG + Intronic
1160989441 19:1854474-1854496 GGCTGGGCTGGGCGCGGGGCTGG + Exonic
1162396077 19:10418800-10418822 GGCTGGGCCAAATTCTTGGCGGG - Intronic
1162403746 19:10461403-10461425 GACTGGGCTGGAGGCGAGGCTGG + Intronic
1163999761 19:21086701-21086723 GACTGGGCTGCATTCCTGGATGG - Intronic
1164005713 19:21146788-21146810 GACTGGGCTGCATTCCTGGATGG - Intronic
1165069418 19:33247165-33247187 GGCTGGGCTGGCTTCCTGTGGGG - Intergenic
1165898759 19:39158611-39158633 TGCTGGGCCAGATTCGGGGCAGG + Intronic
1166098125 19:40554362-40554384 GGCTGAGGTGGAGGCGTGGCTGG + Exonic
1166620140 19:44290193-44290215 GGCTGGGCTGGACTGGTTTCTGG - Intronic
1166669761 19:44702758-44702780 AGCTGGGCTGGATACGCAGCCGG + Intronic
1167054968 19:47104687-47104709 GGGTGGGCTGCATCCGAGGCAGG - Intronic
1167254652 19:48419831-48419853 GGCTGGGCTGGAGCTGGGGCTGG + Intronic
1167322749 19:48806567-48806589 GGAAGGGCTGGATTCGGGGCTGG + Exonic
1168406791 19:56114642-56114664 GGCAGGGCTGACTTCCTGGCTGG + Intronic
1202687208 1_KI270712v1_random:58056-58078 GTCTGGGCTGGCTGGGTGGCTGG + Intergenic
1202687226 1_KI270712v1_random:58124-58146 GGCTTGGCTGGCTGGGTGGCAGG + Intergenic
1202687277 1_KI270712v1_random:58328-58350 GGCTTGGCTGGCTGGGTGGCTGG + Intergenic
925347899 2:3183387-3183409 GGCTGGGTTGGATAGGTGGGTGG - Intergenic
926081187 2:9987709-9987731 GGCTGAGCTGGATTCAATGCAGG + Intronic
926083375 2:10006433-10006455 TGCTGGGCTTGATTGGAGGCTGG - Intergenic
927149208 2:20186124-20186146 GGCTGGCCTGGAATGGTGGGTGG - Intergenic
928303450 2:30147075-30147097 GGAGGGGCTGGACTCGGGGCCGG + Intronic
928313738 2:30231114-30231136 GGCTGGGGTGGAGGAGTGGCGGG + Intergenic
929950887 2:46408860-46408882 GGTTGGGATGGGTTCCTGGCTGG - Intergenic
933916911 2:87004614-87004636 GGCTGGGCTGTTTTCCAGGCTGG - Intronic
933959238 2:87398018-87398040 GGCTTGGCTGGCTGGGTGGCTGG - Intergenic
933959252 2:87398077-87398099 GGCTTGGCTGGCTGGGTGGCTGG - Intergenic
933960702 2:87406559-87406581 GGCTTGGCTGGCTGGGTGGCTGG - Intergenic
933960716 2:87406609-87406631 GGCTTGGCTGGCTGGGTGGCAGG - Intergenic
933960731 2:87406677-87406699 GGCTTGGCTGGCTGGGTGGCTGG - Intergenic
933962438 2:87414532-87414554 GGCTTGGCTGGCTGGGTGGCTGG - Intergenic
933962454 2:87414582-87414604 GGCTTGGCTGGCTGGGTGGCAGG - Intergenic
933962645 2:87415409-87415431 GGCTTGGCTGGCTGGGTGGCTGG - Intergenic
933962660 2:87415459-87415481 GGCTTGGCTGGCTGGGTGGCAGG - Intergenic
933962988 2:87416979-87417001 GGCTTGGCTGGCTGGGTGGCAGG - Intergenic
933963254 2:87418121-87418143 GGCTGGGCTGGCTGGCTGGCTGG - Intergenic
933963320 2:87418395-87418417 GGCTTGGCTGGCTGGGTGGCTGG - Intergenic
933963335 2:87418445-87418467 GGCTTGGCTGGCTGGGTGGCTGG - Intergenic
933963350 2:87418495-87418517 GGCTTGGCTGGCTGGGTGGCAGG - Intergenic
933964538 2:87423976-87423998 GGCTTGGCTGGCTGGGTGGCTGG - Intergenic
933965553 2:87428604-87428626 GGCTTGGCTGGCTGGGTGGCTGG - Intergenic
933965585 2:87428722-87428744 GTCTGGGCTGGCTGAGTGGCTGG - Intergenic
933965789 2:87429599-87429621 GGCTTGGCTGGCTGGGTGGCTGG - Intergenic
933966193 2:87431342-87431364 GGCTTGGCTGGCTGGGTGGCAGG - Intergenic
934006084 2:87765300-87765322 GGCTGGGCTGTTTTCCAGGCTGG + Intronic
934243418 2:90290310-90290332 GGCTTGGCTGGCTGGGTGGCTGG - Intergenic
934243659 2:90291365-90291387 GTCTGGGCTGACTGCGTGGCTGG - Intergenic
934243869 2:90292313-90292335 GGCTTGGCTGGCTGGGTGGCTGG - Intergenic
934243916 2:90292500-90292522 GGCTGGCCTGGCTGCCTGGCTGG - Intergenic
934244841 2:90297539-90297561 GGCTTGGCTGGCTGGGTGGCAGG - Intergenic
934263898 2:91499465-91499487 GGCTTGGCTGGCTGGGTGGCAGG + Intergenic
934263913 2:91499515-91499537 GGCTTGGCTGGCTGGGTGGCTGG + Intergenic
934263919 2:91499536-91499558 GGCTTGGCTGGCTGGGTGGCTGG + Intergenic
934263977 2:91499798-91499820 GGCTTGGCTGGCTGTGTGGCAGG + Intergenic
934264914 2:91504818-91504840 GGCTTGGCTGGCTGGGTGGCTGG + Intergenic
934265207 2:91506112-91506134 GGCTTGGCTGGCTGGGTGGCTGG + Intergenic
934265456 2:91507225-91507247 GGCTTGGCTGGCTGGGTGGCTGG + Intergenic
934265693 2:91508273-91508295 GGCTTGGCTGGCTGGGTGGCTGG + Intergenic
934265959 2:91509435-91509457 GGCTTGGCTGGCTGGGTGGCTGG + Intergenic
934266384 2:91511385-91511407 GGCTTGGCTGGCTGGGTGGCTGG + Intergenic
934266629 2:91512478-91512500 GGCTTGGCTGGCTGGGTGGCTGG + Intergenic
934266879 2:91513591-91513613 GGCTTGGCTGGCTGGGTGGCTGG + Intergenic
934267116 2:91514638-91514660 GGCTTGGCTGGCTGGGTGGCTGG + Intergenic
934267885 2:91518106-91518128 GGCTTGGCTGGCTGGGTGGCTGG + Intergenic
934268039 2:91518768-91518790 GGCTTGGCTGGCTGGGTGGCTGG + Intergenic
934268073 2:91518909-91518931 GGCTTGGCTGGCTGGGTGGCTGG + Intergenic
934268453 2:91520610-91520632 GGCTTGGCTGGCTGGGTGGCTGG + Intergenic
934268851 2:91522384-91522406 GGCTTGGCTGGCTGGGTGGCTGG + Intergenic
934269097 2:91523484-91523506 GGCTTGGCTGGCTGGGTGGCTGG + Intergenic
934269350 2:91524611-91524633 GGCTTGGCTGGCTGGGTGGCTGG + Intergenic
934269599 2:91525701-91525723 GGCTTGGCTGGCTGGGTGGCTGG + Intergenic
934269894 2:91527041-91527063 GTCTGGGCTGGCTGCGTTGCTGG + Intergenic
934269910 2:91527109-91527131 GGCTTGGCTGGCTGGGTGGCAGG + Intergenic
935617656 2:105102616-105102638 GGCTGAGGTGGATTTGTGGAGGG + Intergenic
935692448 2:105744190-105744212 GGCTGGCCTGGATGCCTGGGAGG + Intergenic
940786987 2:157991956-157991978 GCCTGGACTGGAGTCGTGGTAGG + Intronic
942382430 2:175405759-175405781 GGCAGGCCTGGAGTTGTGGCTGG + Intergenic
945345319 2:208706436-208706458 GGCTGTGCAGGAATCATGGCTGG - Intronic
946165101 2:217858943-217858965 GGCTGGGCTGGGGTTGGGGCTGG - Intronic
946243189 2:218369133-218369155 GGCTGGGTTGGATGCGGGGCTGG + Intergenic
948060645 2:235041371-235041393 GGCTGAGCTGGATTCGGTGAAGG - Exonic
948697038 2:239737659-239737681 GGCTGGGCTGGGGACGGGGCCGG - Intergenic
1172033404 20:31996460-31996482 GGGTGGGCTGGGTTAGGGGCGGG - Intronic
1172123864 20:32613786-32613808 GGCTGGGATGGATAGGTGGGTGG + Intergenic
1172483402 20:35284834-35284856 AGAGGGGCTGGATGCGTGGCGGG - Exonic
1172585767 20:36083332-36083354 TGCTGGGCTGCATTCCTAGCTGG + Intergenic
1174546107 20:51326333-51326355 GGCTGAGCTGGAATCTTGTCAGG + Intergenic
1175041535 20:56056296-56056318 GGCAAGGCTGGCTTCCTGGCAGG + Intergenic
1175861265 20:62151569-62151591 GGCTTGGCTGGGCTCGTGGCTGG - Intronic
1175896425 20:62337829-62337851 GCCGGGGCTGCATTCCTGGCAGG + Exonic
1176137533 20:63530708-63530730 GGCGTGGCTGGGGTCGTGGCCGG - Intronic
1177078865 21:16613612-16613634 GGCTGGTCTCGACTCCTGGCTGG + Intergenic
1178610196 21:34073383-34073405 GGCTGGGCTGGGGTCGGGGCGGG + Intronic
1179538569 21:42068430-42068452 GGATGGGCTGGATGCTGGGCTGG + Intronic
1179674815 21:42974373-42974395 GGCGGGGCTGGAGGCGGGGCCGG + Intergenic
1180002079 21:44999731-44999753 GGCTGGGCTGTGTTGGTGGCAGG + Intergenic
1180553505 22:16559141-16559163 GGCTTGGCTGGCTGGGTGGCTGG - Intergenic
1180553728 22:16560130-16560152 GGCTTGGCTGGCTGGGTGGCTGG - Intergenic
1180554639 22:16564451-16564473 GGCTTGGCTGGCTGGGTGGCTGG - Intergenic
1180555166 22:16566694-16566716 GGCTGGCTTGGATGCCTGGCTGG - Intergenic
1180632519 22:17239521-17239543 GGCAGGGCTGCATTCCTGACCGG - Intergenic
1180711813 22:17844206-17844228 GACTGGGCTGGCATCCTGGCTGG + Intronic
1180956072 22:19741944-19741966 GGCTGGGCTGGATACTGGGCTGG - Intergenic
1181672603 22:24432725-24432747 GGGTGAGCTGGAGTCCTGGCAGG + Exonic
1181772962 22:25140121-25140143 GGCTGGGCTGCATTCTCAGCTGG + Intronic
1181953942 22:26574802-26574824 GGCGGGGCTGGAGTTGTGGGAGG - Intronic
1182916612 22:34038881-34038903 GGCTGTGATGGCTTCGTGTCTGG + Intergenic
1183407586 22:37638112-37638134 GTCTGGGCTGGAGGCTTGGCTGG + Intronic
1183495185 22:38139234-38139256 GGCTGGGCTGGGTTAGAGGAGGG + Intronic
1184110190 22:42389681-42389703 GGCTGGGCTGGGCTGGGGGCTGG + Intronic
1184697876 22:46150139-46150161 GGCGGGGCTGAATTCGAGGCGGG - Intergenic
1184750621 22:46484311-46484333 GGCTGGGCTGGGCTGGTGGAAGG - Intronic
950194735 3:11001137-11001159 AGCTGGGCTGGCTTGGTGGAAGG - Intronic
950442649 3:13019038-13019060 AGCTGGGCGGGCTTCTTGGCAGG - Intronic
950773120 3:15328112-15328134 GGCTGGGCTGGGTTGCTGGCTGG - Intronic
952415931 3:33091804-33091826 GGCTGGGCTGGTTTCCTGCTGGG - Exonic
953772124 3:45785795-45785817 GGCTGGGCTGGCCTTGGGGCTGG + Intronic
953926693 3:46986174-46986196 GGCTGAGCTGGGTTCAGGGCTGG - Intronic
954156448 3:48687441-48687463 GGCTGGGCAGGAGTGGTGACAGG + Intergenic
954863556 3:53710238-53710260 TGCTGAGCTGGATTCCTAGCAGG + Intronic
955759916 3:62268644-62268666 GGCCGGGTTGGATTCATGGAAGG - Intronic
957751939 3:84431508-84431530 GGCTAGGATGCATTCATGGCAGG + Intergenic
962855857 3:139344101-139344123 GCCAGGGCTGGATTCGAGCCCGG - Exonic
966949144 3:184800509-184800531 GGCAGGGCTGGTTTAGTGGCAGG + Intergenic
969247634 4:5945776-5945798 GGCTGGGCTGGACCCTGGGCCGG + Intronic
969558997 4:7933820-7933842 GGCTGGGCTGCATTCCTCACTGG - Intronic
969701059 4:8768072-8768094 GGCTGGGCTCAATTCAGGGCAGG - Intergenic
970385961 4:15556781-15556803 GGCTGGGCTGGATCCATCTCTGG + Intronic
977178659 4:93845855-93845877 AGCTGTGCTGGACTCTTGGCTGG - Intergenic
982277220 4:153648409-153648431 GGCTGGGCTGGCGTGCTGGCAGG + Intergenic
982370329 4:154626909-154626931 GGCTGGGCTGGGCTGGGGGCCGG - Intergenic
985540737 5:486267-486289 GGCTGGGATGGTGTCGGGGCCGG + Intronic
985591374 5:767085-767107 GGTTGGGCTGGAGTCGGTGCAGG + Intergenic
985604428 5:850768-850790 GGCTGGGCTGGAGTCGGTGCAGG + Exonic
988698763 5:33651165-33651187 GGTGGGGCTGGATTTGTAGCAGG - Intronic
996679966 5:126221031-126221053 TGCTGGGCTTGATCAGTGGCTGG + Intergenic
997212521 5:132085837-132085859 GGCTGGGGTGCATTCCAGGCAGG - Intergenic
997304338 5:132826845-132826867 GGCAGGCCTGGATTCCAGGCAGG - Intronic
998003853 5:138644339-138644361 GGCTGGGCTGGAGCTGAGGCTGG - Intronic
998148618 5:139744687-139744709 GGCTGGGCTGGGTCTGGGGCAGG - Intergenic
998150143 5:139752336-139752358 AGCTGGGCTGGATGTGTGGGTGG - Intergenic
998622597 5:143811487-143811509 GGATGGGCAGGATTTCTGGCAGG + Intergenic
998876453 5:146605011-146605033 TGCTGGGCTGGAATCCAGGCTGG + Intronic
999248873 5:150169764-150169786 GGCTAGCCAGGATTGGTGGCAGG - Intronic
1000905616 5:166962642-166962664 GGGTGGGGTGGAATCTTGGCTGG + Intergenic
1001288330 5:170439391-170439413 GGCTGGGCTGCCTTCCAGGCAGG + Intronic
1002067122 5:176657436-176657458 GGCTGAGGTGGGTTCCTGGCAGG - Intronic
1002323335 5:178388703-178388725 GGCTGGGCTGGGCTGGAGGCAGG - Intronic
1002541204 5:179907643-179907665 GGCTGGGCTGGCGGCGGGGCTGG - Intronic
1002623495 5:180507764-180507786 GGCTGTGCAGGAAACGTGGCTGG + Intronic
1004511660 6:16288451-16288473 CGCTGCGCTGGATTTCTGGCTGG + Intronic
1004606600 6:17200730-17200752 TGCTGGGCTTGATTGGAGGCTGG + Intergenic
1005893925 6:30162435-30162457 TCCTGGGCTGCACTCGTGGCAGG + Intergenic
1006119843 6:31797278-31797300 AGCTGAGTTGGATTCTTGGCTGG + Intergenic
1006905240 6:37528851-37528873 GGCTGGACTGGCTTCCTGCCTGG + Intergenic
1017129697 6:151097585-151097607 GGCTGGGAAGGATGGGTGGCTGG + Intronic
1017523239 6:155220409-155220431 GGCTGGTCTGGAGGCCTGGCGGG + Intronic
1017647466 6:156552172-156552194 GGCTGGGCTGAATCCGTGTCTGG - Intergenic
1019182608 6:170200491-170200513 GGCTGGGGAGGATTCTTGGCGGG - Intergenic
1019502075 7:1369459-1369481 GGATGGGCTGGAGTCGCTGCCGG - Intergenic
1019518415 7:1449815-1449837 GGCAGGACTGGAATCCTGGCAGG + Intronic
1022658826 7:32347138-32347160 GGCTGGGCTAGATGTGTGGGTGG - Intergenic
1023684649 7:42721874-42721896 GGCTGGGCTGGGGCCCTGGCGGG - Intergenic
1024480321 7:49855758-49855780 GGCTGGGCTGGCTTCTGGGGAGG - Intronic
1027226677 7:76248109-76248131 GGCTGGGCTGAGTGCGGGGCAGG + Intronic
1027831959 7:83188472-83188494 AGCTGGGCTGCATCCGGGGCTGG + Intergenic
1031987638 7:128173532-128173554 GGCTGGGCTGGGTTGGGGGCTGG - Intergenic
1033274239 7:139959215-139959237 GGCTGTCCTGGATTTGTGGTTGG - Intronic
1033647108 7:143313962-143313984 GGCTGGGCTGGAGTAGGGGGTGG - Intergenic
1034825929 7:154262496-154262518 GGCTGGGCTGGATTCCTCTGAGG - Intronic
1035332543 7:158105707-158105729 AGCTGGGATGGATTTGTGGATGG - Intronic
1035356588 7:158279583-158279605 TGCTGGGCTTGATTGGAGGCTGG - Intronic
1035385807 7:158471975-158471997 GGCGGGGCCGGAACCGTGGCGGG - Intronic
1036719133 8:11156423-11156445 AGCTGGGCTGAATTCCTGGAGGG + Intronic
1038533832 8:28339615-28339637 GGGTGGGCTGGACTCCTTGCGGG - Intronic
1038829017 8:31036014-31036036 GGCTGGGATGGATGGGTGGTGGG - Intronic
1040039030 8:42897396-42897418 GGCTGGGCTGGGAACGCGGCGGG + Intronic
1040301690 8:46191307-46191329 GGGTGGGCTGGGCTTGTGGCAGG + Intergenic
1040810769 8:51450363-51450385 TGCTGGGCTGGATTCCTAGCAGG - Intronic
1041511621 8:58659708-58659730 GGGAGGGCGGGATTGGTGGCCGG + Intronic
1042570347 8:70156920-70156942 GGCTGTCCTGGATTCATGCCAGG + Exonic
1043029842 8:75120579-75120601 GGCTGGGCTTGCTTCCTTGCAGG + Intergenic
1043643903 8:82492821-82492843 GGCTGGTCTGGATAGGTGGTAGG + Intergenic
1044177427 8:89145773-89145795 AGCTGGGCTAGATTCCTGGCAGG - Intergenic
1047421490 8:124711497-124711519 GGCTGGGCTGGGCTGGAGGCTGG - Intronic
1048198598 8:132352912-132352934 GGCTGGTTTGGATTCATGGAAGG + Intronic
1049477320 8:142802775-142802797 GGGTGGGCTGTGTTCCTGGCTGG + Intergenic
1049742953 8:144249777-144249799 AGCTGGGCTGGGGACGTGGCGGG - Intronic
1056035243 9:82597772-82597794 GGGAGGGCTGGATTTCTGGCAGG - Intergenic
1056997491 9:91477152-91477174 GGCTGGGCTGAATTCCTGTCTGG + Intergenic
1059419934 9:114184518-114184540 GGCTGGGCTGGGTTCCTTTCCGG + Intronic
1060128759 9:121075170-121075192 GCTTGGGATGGATTCGGGGCGGG + Intronic
1060393676 9:123300626-123300648 GGCTGGGCTCTAATCCTGGCAGG + Intergenic
1061365801 9:130172123-130172145 GCCAGGGCTGGATTCGGGGAGGG + Intergenic
1061367633 9:130180875-130180897 GGCCCGGCTGGGTTGGTGGCCGG + Intronic
1062089485 9:134667685-134667707 GTCTGGGCTGGCTTCCTGGGAGG - Intronic
1062384221 9:136302715-136302737 GGCTGTGCTGGACACGTGGTGGG - Intronic
1062385441 9:136309177-136309199 GGCGGGGCTGGGTGGGTGGCAGG + Intergenic
1062628642 9:137454046-137454068 GGCCGGGCTGGGGGCGTGGCTGG + Intronic
1062628659 9:137454084-137454106 GGCCGGGCTGGGGGCGTGGCTGG + Intronic
1062628676 9:137454122-137454144 GGCCGGGCTGGGGGCGTGGCTGG + Intronic
1062628693 9:137454160-137454182 GGCCGGGCTGGGGGCGTGGCTGG + Intronic
1062628710 9:137454198-137454220 GGCCGGGCTGGGGGCGTGGCTGG + Intronic
1062666348 9:137675080-137675102 GGCTGGGCTGGATTTGGCCCGGG + Intronic
1185644761 X:1608906-1608928 GGCTTGGCTGGAGTAGGGGCAGG - Intergenic
1185645128 X:1610493-1610515 GGCTTGGCTGGAGTCGGGGTGGG - Intergenic
1186790847 X:12997036-12997058 GCCTGGGCTGGATTCTTATCTGG + Intergenic
1188822247 X:34789686-34789708 GGCTGTGCTGGAAGCATGGCTGG - Intergenic
1189077968 X:37937966-37937988 GGTTGGGCTGTAATCCTGGCTGG + Intronic
1189332857 X:40153875-40153897 GGCAGGGCTGGCCTCGTGGCGGG + Intronic
1189373014 X:40445173-40445195 GGCTGGGCTGGAATGGGGGGAGG - Intergenic
1196031098 X:111096394-111096416 GGGGTGGCTGGATCCGTGGCAGG + Intronic
1197335594 X:125206029-125206051 GGCAGGCTTGGAGTCGTGGCTGG + Intergenic
1198400881 X:136267161-136267183 GGCTGAGCCGGTTTTGTGGCTGG - Intergenic
1199556428 X:149114153-149114175 TGCTGGGCTTGATTGGAGGCTGG - Intergenic
1199716619 X:150511570-150511592 GGGTGGGCTGGGCTGGTGGCGGG - Intronic
1200116460 X:153771774-153771796 GGCTGGGCTGGTTGGCTGGCCGG + Intronic
1200135661 X:153873405-153873427 CGCTGGGCTGGAGCAGTGGCAGG + Intronic