ID: 1147184510

View in Genome Browser
Species Human (GRCh38)
Location 17:38705956-38705978
Sequence ACCCTAAGTTGAGGGAGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 119}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147184500_1147184510 -6 Left 1147184500 17:38705939-38705961 CCAGTTCCGCGCCCCCCACCCTA 0: 1
1: 0
2: 0
3: 14
4: 251
Right 1147184510 17:38705956-38705978 ACCCTAAGTTGAGGGAGTTTGGG 0: 1
1: 0
2: 0
3: 9
4: 119
1147184499_1147184510 3 Left 1147184499 17:38705930-38705952 CCTATTGTTCCAGTTCCGCGCCC 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1147184510 17:38705956-38705978 ACCCTAAGTTGAGGGAGTTTGGG 0: 1
1: 0
2: 0
3: 9
4: 119
1147184498_1147184510 26 Left 1147184498 17:38705907-38705929 CCGGGTCAGGCATTGTTTTCTTG 0: 1
1: 0
2: 2
3: 26
4: 249
Right 1147184510 17:38705956-38705978 ACCCTAAGTTGAGGGAGTTTGGG 0: 1
1: 0
2: 0
3: 9
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147184510 Original CRISPR ACCCTAAGTTGAGGGAGTTT GGG Intronic
900014434 1:138455-138477 AGCCTGATTTGAGGAAGTTTTGG + Intergenic
900044299 1:493657-493679 AGCCTGATTTGAGGAAGTTTTGG + Intergenic
900065707 1:728563-728585 AGCCTGATTTGAGGAAGTTTTGG + Intergenic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
904758401 1:32782742-32782764 ATACTAACTTGAGGGTGTTTAGG + Intronic
905186848 1:36203265-36203287 ACAGAAAGTTGAGGGACTTTTGG - Intergenic
905513455 1:38542782-38542804 ACCCTGAGTGGAGGGGGTTATGG + Intergenic
907495349 1:54840378-54840400 TTCCTAAGTTGAGGGACATTTGG + Intronic
911954002 1:104213002-104213024 ACCCTAAGTTTAGGGAATCCTGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
914438673 1:147682065-147682087 ATCCTGAGTTCATGGAGTTTTGG - Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
918620200 1:186594909-186594931 ACTCTAAGGTTTGGGAGTTTCGG - Intergenic
921692054 1:218163830-218163852 ACCCTAGGTGGGGAGAGTTTTGG - Intergenic
923115583 1:230934415-230934437 ACCTTAAGTTGGAGGTGTTTGGG + Intronic
1070024263 10:72616873-72616895 TCCCTTAATTGAGGGAGTCTGGG - Intronic
1070512102 10:77170703-77170725 ATCCTAATTTCAGAGAGTTTAGG + Intronic
1070818475 10:79340429-79340451 CCCCTAAGTTGAGGCTGCTTGGG - Intergenic
1076970631 11:130132-130154 AGCCTGATTTGAGGAAGTTTTGG + Intergenic
1078428219 11:11268294-11268316 CCCCTATTTTGAGGAAGTTTTGG - Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1083589961 11:63888092-63888114 AGCATAATTTCAGGGAGTTTGGG - Intronic
1084359523 11:68660559-68660581 CCCCCCAGCTGAGGGAGTTTGGG + Intergenic
1086463831 11:87033568-87033590 TACCTAAGGTCAGGGAGTTTGGG + Intergenic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1092006003 12:5071084-5071106 ACCTGAAGTTAAGGGAGTTCAGG + Intergenic
1094094785 12:26691456-26691478 ACCCTAAATTGAGAATGTTTTGG - Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097775797 12:63643824-63643846 AAACTAAGTTGAGTCAGTTTTGG - Intronic
1098923987 12:76328907-76328929 ACCCTGAGTTGAGGGGCCTTGGG + Intergenic
1102187614 12:110961655-110961677 AGCCTAAGTTGTGGGTGTTTAGG - Intergenic
1102948815 12:117014401-117014423 ACCCTAAGATAAGCTAGTTTGGG - Intronic
1103330483 12:120150612-120150634 ACCCTTAGCTGAGAGAGGTTTGG - Intronic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1104284530 12:127412576-127412598 ATCCTCAGGTGATGGAGTTTAGG + Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1110409405 13:75187275-75187297 ACCTCAAGTTCAGGGAGTTTGGG - Intergenic
1113751339 13:112778437-112778459 ATTCTAAGTTGAGGTAATTTGGG + Intronic
1116395984 14:44449209-44449231 TCCTTATGTTGAGGGAGTGTTGG + Intergenic
1117163505 14:53011726-53011748 ACCCTATGTTGAAGGTCTTTAGG + Intergenic
1118066172 14:62193135-62193157 ACCCTAATGTGATGGACTTTAGG - Intergenic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1121871851 14:97415338-97415360 ACACTAAGTTTAGGGAGTGTGGG - Intergenic
1122341815 14:101033504-101033526 TCCCGAAGTAGAGGGAGTCTGGG + Intergenic
1122821209 14:104346048-104346070 ACCCTAATTTGTGGGAGGATTGG + Intergenic
1124791625 15:32732394-32732416 AGTCTAAGATGAGAGAGTTTAGG + Exonic
1127375687 15:58382474-58382496 ACCCTAAGTGGAGGGACCTCTGG + Intronic
1131806705 15:96129734-96129756 AACATAGGTTGAGGTAGTTTTGG - Intergenic
1132143201 15:99411317-99411339 ACCCTAAGTCGAAGGAGTACAGG + Intergenic
1133167646 16:3959540-3959562 AACCTAAGTAAAGGGAGTTTAGG + Intronic
1133622347 16:7538383-7538405 ACAGTAAGTTGAGGTAGTTGTGG - Intronic
1133805327 16:9122339-9122361 AGCCCAAGTAGAGGGAGTATGGG + Intergenic
1137317538 16:47342429-47342451 CCCCTAAGTTCAGGAAGTTAAGG + Intronic
1139121801 16:64027842-64027864 ACCCTAATGTGATAGAGTTTGGG - Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1147184510 17:38705956-38705978 ACCCTAAGTTGAGGGAGTTTGGG + Intronic
1148478816 17:47946631-47946653 ACCCTCAGGTGATGGAGTTCTGG + Exonic
1149355258 17:55832859-55832881 AAGCTAAGTTGAGGGCTTTTGGG + Intronic
1158118619 18:54024595-54024617 ACCCTGAGCTGATGTAGTTTTGG + Intergenic
1158557853 18:58490100-58490122 ACCCTAGGTTGAATAAGTTTAGG - Intronic
1159191598 18:65051724-65051746 AAGCTAAGTTTAGGAAGTTTGGG + Intergenic
1159883642 18:73883918-73883940 TGCCTCAGTTCAGGGAGTTTGGG - Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
925125495 2:1452847-1452869 CCCCTAAGTTGAAGGGGTGTAGG - Intronic
926372236 2:12190930-12190952 ACCCTAAGGTAAGAAAGTTTGGG - Intergenic
929217525 2:39431452-39431474 ACCTGAAGTTGATGCAGTTTTGG - Intronic
936652516 2:114445074-114445096 ACTCTAAGATGAGAGGGTTTTGG + Intronic
942905683 2:181177987-181178009 ATCCTAATTTAAGGGACTTTGGG + Intergenic
946757957 2:222965599-222965621 ACCTTAAGGTGAGGGTGTGTGGG + Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
948813281 2:240496670-240496692 ACCCTAAGGTGACGGTGGTTTGG + Intronic
949063072 2:241972729-241972751 ACCCTGAGGTCAGGGATTTTAGG + Intergenic
1171344771 20:24457677-24457699 ACTCTATGTTGGGGGAGTTGAGG + Intergenic
1174283141 20:49453749-49453771 ACCCTAAGTTTGGGAGGTTTAGG - Intronic
1174718251 20:52783654-52783676 ACCTCAAGTAAAGGGAGTTTGGG + Intergenic
1182122567 22:27797278-27797300 ACCCCACGGGGAGGGAGTTTGGG + Exonic
956656414 3:71557465-71557487 ACCATGAGGTGAAGGAGTTTTGG - Intronic
958027401 3:88064608-88064630 GCCATCAGTAGAGGGAGTTTGGG - Intronic
965348325 3:167580215-167580237 ATCGTTAGTTGAGAGAGTTTAGG - Intronic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
967411928 3:189175041-189175063 ACCCTAAGCTTAGGGATTTAGGG + Intronic
968267361 3:197372545-197372567 ACCCAGAGGTGAGGGAGGTTAGG + Intergenic
969601849 4:8181547-8181569 ACTCTATCTTGAGCGAGTTTGGG + Intergenic
974989277 4:69064290-69064312 TCCCTATGTTGAAGGAGTTTTGG - Intronic
975109934 4:70611706-70611728 CCCCTCAGTTGAGGGGCTTTAGG + Intergenic
975560327 4:75702999-75703021 TCCTTCAGCTGAGGGAGTTTAGG - Intronic
976214238 4:82700337-82700359 ACCCTAAGTGTAGGGTTTTTTGG - Intronic
981484171 4:145267729-145267751 GCCCTAATTTGGAGGAGTTTAGG + Intergenic
982126143 4:152185534-152185556 GCAGTGAGTTGAGGGAGTTTGGG - Intergenic
983806630 4:172001650-172001672 TCCAAAAGTTGAGGGAGGTTCGG - Intronic
985440890 4:189981784-189981806 ACCCTATGTAGAGGGGGATTAGG - Intergenic
991350113 5:65712324-65712346 ATGCTAAGTTTAGGGAGTTTAGG - Intronic
994105746 5:95946402-95946424 AACTTAATTTGAGGGAGTTTGGG - Intronic
994859977 5:105179335-105179357 TTGCTAAGTTGAGTGAGTTTAGG - Intergenic
996257574 5:121424675-121424697 AAGCTAAGGTGAGAGAGTTTAGG + Intergenic
1002729544 5:181325272-181325294 AGCCTGATTTGAGGAAGTTTTGG - Intergenic
1002808155 6:597927-597949 AGGCTAACTTGAGGGACTTTAGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1006293406 6:33158245-33158267 ACTCTAGGTTGAAGGACTTTTGG - Intergenic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007485325 6:42177234-42177256 AGCCAAAGTTGAGAGAGATTAGG - Intronic
1011545255 6:88476191-88476213 AACCGAAGATGAGAGAGTTTAGG - Intergenic
1012616846 6:101288017-101288039 ACTATAAGTTGAAGGACTTTTGG - Intergenic
1012966165 6:105675788-105675810 CTCCTAAGTTGAGATAGTTTGGG + Intergenic
1014274604 6:119373474-119373496 AGCCAAAGTTCAGGGATTTTGGG + Intergenic
1023065289 7:36371500-36371522 TTCATAAGTTGATGGAGTTTTGG + Intronic
1023592442 7:41794235-41794257 TGCCTAATTAGAGGGAGTTTTGG + Intergenic
1023733306 7:43212229-43212251 ACCCTAATCTGAGAGAGATTGGG - Intronic
1025939853 7:66067666-66067688 AACAAAAGCTGAGGGAGTTTGGG - Intergenic
1030190248 7:106803531-106803553 ACCCTGAGTTGTGTGAGGTTGGG + Intergenic
1032054735 7:128675230-128675252 AGCTTGAGTTGAGGGAGGTTTGG - Intronic
1032720400 7:134546784-134546806 CCCCTAGGTTGAGGGAGATCAGG + Intergenic
1039149655 8:34489815-34489837 ACCCTAAGGTGAGGGAAATGAGG + Intergenic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1050367758 9:4888173-4888195 ATGATAAGTTGGGGGAGTTTAGG + Intergenic
1054899845 9:70357389-70357411 ACCCTAATTTGGGGGCGTATTGG - Intergenic
1060244553 9:121933429-121933451 ACGGTAGTTTGAGGGAGTTTTGG + Intronic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186056559 X:5655323-5655345 CCCCTAAGTTGAGTCAGTTAGGG - Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1187321614 X:18243804-18243826 ACACTAACTTTAGGGAGTTAAGG - Intronic
1188452334 X:30320804-30320826 AACCCTAATTGAGGGAGTTTGGG - Intergenic
1189852993 X:45195383-45195405 ACCCTATGTTGAGGGACTTGGGG - Intronic
1192471251 X:71400562-71400584 ATCCTAAGATGAGGCAGTTGTGG + Intronic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1199532926 X:148870136-148870158 ATCCTACGTAGAGGGAATTTAGG + Intronic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic