ID: 1147185243

View in Genome Browser
Species Human (GRCh38)
Location 17:38709806-38709828
Sequence GAAGCCTCCTAGACTCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 120}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147185243_1147185246 6 Left 1147185243 17:38709806-38709828 CCTGTCAGAGTCTAGGAGGCTTC 0: 1
1: 0
2: 0
3: 4
4: 120
Right 1147185246 17:38709835-38709857 GAGGTAGCATTTAAGCTGAGTGG 0: 1
1: 0
2: 2
3: 18
4: 156
1147185243_1147185248 12 Left 1147185243 17:38709806-38709828 CCTGTCAGAGTCTAGGAGGCTTC 0: 1
1: 0
2: 0
3: 4
4: 120
Right 1147185248 17:38709841-38709863 GCATTTAAGCTGAGTGGAGGTGG 0: 1
1: 0
2: 0
3: 29
4: 181
1147185243_1147185247 9 Left 1147185243 17:38709806-38709828 CCTGTCAGAGTCTAGGAGGCTTC 0: 1
1: 0
2: 0
3: 4
4: 120
Right 1147185247 17:38709838-38709860 GTAGCATTTAAGCTGAGTGGAGG 0: 1
1: 0
2: 2
3: 7
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147185243 Original CRISPR GAAGCCTCCTAGACTCTGAC AGG (reversed) Intronic
900150387 1:1176465-1176487 GAAGCCTGGAAGACTCTCACAGG - Intronic
900392482 1:2439761-2439783 GAATCCAGCTGGACTCTGACGGG - Intronic
901870299 1:12134909-12134931 GAAGCCTCCTGGGCTCTGGTTGG + Intronic
902124458 1:14196878-14196900 GAAGCCTCCTTCACTTTCACTGG - Intergenic
902172820 1:14626907-14626929 GAAGCCTTCCAGACTCTGCCAGG + Intronic
904015543 1:27417412-27417434 GAAGGCTCCCTGAATCTGACTGG + Intronic
904923942 1:34030944-34030966 GAAGCTTCCTAAAGTCTGTCTGG - Intronic
905095935 1:35470726-35470748 GAATCCTCCAAAAATCTGACTGG - Intronic
906161815 1:43655521-43655543 CATGCTTCCTGGACTCTGACTGG + Intronic
906814486 1:48865033-48865055 GAAGGCTCCCAGTCTATGACTGG + Intronic
907334113 1:53689276-53689298 GAGGCCTCCTTCCCTCTGACTGG - Intronic
907871065 1:58443279-58443301 GAAGCCTCCTGTACTGTGAGAGG - Intronic
907921192 1:58913808-58913830 GAAGTCTGCTGGACTCTGTCTGG - Intergenic
908328822 1:63050505-63050527 GACTTCTCCTAGACTCTGAATGG - Intergenic
917278789 1:173359425-173359447 TAAAACTCTTAGACTCTGACTGG - Intergenic
1067671110 10:48322499-48322521 GAAACATCATAGTCTCTGACTGG - Intronic
1070812228 10:79304205-79304227 CAAGCCACCTAGACTCTGGCTGG + Intronic
1070976493 10:80609687-80609709 GCAGCCTCCTGGACTCCCACTGG - Intronic
1074764036 10:116687346-116687368 GAGGCCTCCCAGACACTGCCTGG - Intronic
1076022841 10:127088878-127088900 GAAGCCCCTTAGACTCTGAGGGG - Intronic
1076746247 10:132516150-132516172 AAAGCCTCCTTGACTCTGGAGGG + Intergenic
1077529942 11:3090375-3090397 GCTGCCTCCCAGACTCTGAGAGG + Intronic
1079414888 11:20224852-20224874 AAAGCCTTCTAGACTCTTCCAGG + Intergenic
1080033051 11:27682556-27682578 CTAGCCTCCTACACCCTGACAGG + Intronic
1083347662 11:62004839-62004861 AAGGCCTCCTAGACTCTCAGGGG - Intergenic
1085289832 11:75389996-75390018 GAAGACTCTTAGACTCAGAAAGG + Intergenic
1088738014 11:112744544-112744566 TAAGCCACCTAGGCTCTGTCTGG + Intergenic
1090382575 11:126337441-126337463 GCAGCCTCCTAACCTCAGACAGG + Intronic
1090501542 11:127265974-127265996 GGAGCCTCATAGCCTCTGATAGG + Intergenic
1098101041 12:67017688-67017710 GAAGCTTCCTAGCCTCTTAAGGG - Intergenic
1102210128 12:111120540-111120562 GAAGCCTGGTAGAATCTCACAGG + Intronic
1103556199 12:121768090-121768112 GGGGCTTCTTAGACTCTGACAGG + Intronic
1106796814 13:33215155-33215177 TGAGCCTGCTAGTCTCTGACTGG + Intronic
1109855156 13:68117518-68117540 TAAACCTCCTGGTCTCTGACTGG - Intergenic
1110817533 13:79878825-79878847 GAATCCTCACAGGCTCTGACTGG - Intergenic
1111804852 13:93027688-93027710 CAAGCTTCCAAGACTCTGTCAGG + Intergenic
1122774999 14:104113183-104113205 GAAGCCCCCTTGACACTCACAGG - Exonic
1122902655 14:104788195-104788217 GAAGCCACCTAGACGCAGCCTGG + Intronic
1128544344 15:68557109-68557131 GAAGCCTACTTGCCTCTGCCAGG + Intergenic
1129035212 15:72644957-72644979 GAAGCCTCCTACTCACTGATGGG - Intergenic
1129214672 15:74092259-74092281 GAAGCCTCCTACTCACTGATGGG + Intergenic
1132411487 15:101581465-101581487 GAACACTCCTAGACCATGACAGG - Intergenic
1135275550 16:21109308-21109330 GAAGACACTGAGACTCTGACAGG - Intronic
1137629148 16:49930021-49930043 GAAGGCCCCAAGCCTCTGACAGG + Intergenic
1140971993 16:80022380-80022402 GAGGACTCCCAGACTCTAACAGG + Intergenic
1142689008 17:1593548-1593570 GAAGGCTCCTGGGCTCTGCCAGG - Intronic
1143772053 17:9175152-9175174 GAAGGCTCCTGGGCTCTGCCAGG - Intronic
1147185243 17:38709806-38709828 GAAGCCTCCTAGACTCTGACAGG - Intronic
1148866630 17:50632178-50632200 GAAGCCTCCTAGCCCAGGACTGG + Intergenic
1151631778 17:75315882-75315904 GAAGCCTCCCAGCATCTTACAGG - Intergenic
1153993304 18:10418943-10418965 GAAGCCTCCTAACCTCTTCCTGG + Intergenic
1155071110 18:22317046-22317068 GAAGGCTCCTAGCTTCTAACTGG - Intergenic
1158527188 18:58225586-58225608 GAGGCCACTTAGACTCTAACTGG - Intronic
1158879125 18:61759800-61759822 GAAGCAACCTAGACACTGAAAGG + Intergenic
1160923448 19:1531603-1531625 GAAGCCCCCAAGCCTCTGTCCGG + Intronic
1162792360 19:13069648-13069670 GCAGCCTCCCGGACTCTGGCCGG - Intronic
925073234 2:987788-987810 GAGGCCTCCTAGACAAGGACAGG + Intronic
927653288 2:24925079-24925101 GGAGCCTCCCTGACTCTCACAGG + Intergenic
930376356 2:50572043-50572065 GAAGCCCCAAAGACTCTGGCGGG + Intronic
932367596 2:71162899-71162921 GAAGCCCCCTAGACCATCACAGG - Intergenic
937546250 2:123024663-123024685 AAAGCCTCCTATATTCTCACAGG + Intergenic
938051596 2:128177677-128177699 GAATCCTTCTAGACTCTGGGTGG + Intronic
941175011 2:162186093-162186115 TAAGCCACCTACACTCTGAAGGG - Intronic
944883197 2:204036355-204036377 CCAGCCCCCCAGACTCTGACAGG - Intergenic
944948702 2:204721348-204721370 GTCACCTCCTAGACTCTTACAGG - Intronic
945767535 2:213999181-213999203 TAAGCCTCCTAGCCTGTGATGGG - Intronic
948633896 2:239321670-239321692 AAAGCATCCTGTACTCTGACAGG - Intronic
1174538099 20:51268308-51268330 GAGGTGTCCTAGACACTGACTGG - Intergenic
1175919194 20:62442081-62442103 GATGCCTCCTGAACACTGACGGG + Intergenic
1179828813 21:43983269-43983291 GAAGCATCCTAGAGTCCCACAGG - Exonic
1180878187 22:19185090-19185112 GAAGCCTCCTGGAGTCTTCCTGG - Intronic
1182430138 22:30294411-30294433 GGAGCTTCCTTGACCCTGACAGG - Intronic
1182801779 22:33037628-33037650 GAAGCATCCGAGACTCAGAAAGG + Intronic
1184441483 22:44519327-44519349 GCAGCTTCCTAGACACTGGCTGG + Intergenic
1184824124 22:46935602-46935624 CAAGACTCCTAGACTCGGAAAGG - Intronic
949600138 3:5589225-5589247 GTAGGCTCATAGACTCTGCCTGG + Intergenic
950349080 3:12328989-12329011 GAGGCCTCCTAGAGGCTGAGGGG + Intronic
951243829 3:20317284-20317306 GAAGGGTCCTAGAAGCTGACAGG - Intergenic
954943245 3:54393986-54394008 GAAGCATCCTAGACCCTGTATGG - Intronic
955591231 3:60538075-60538097 GAAGCTACCTAGACTCTTAGAGG - Intronic
958812909 3:98882569-98882591 CCAGCCTCCCAGCCTCTGACAGG + Intronic
965265068 3:166532205-166532227 TAAGCCTCCAAGCCTGTGACAGG + Intergenic
966435560 3:179879943-179879965 GAAGTCTCCGGGACTCTGAGAGG + Exonic
967096272 3:186180001-186180023 GAGGCCTCTGAGACTCTGCCAGG + Intronic
967417959 3:189239886-189239908 GATGCCTCGAAGACTATGACAGG - Intronic
974195684 4:58571524-58571546 GAAGGCTACTAGAATCTGAGAGG - Intergenic
976544911 4:86323651-86323673 AAAGCCTCAGAGACTATGACTGG - Intronic
981041241 4:140224381-140224403 GAAGCCTTTCTGACTCTGACTGG + Intergenic
985085924 4:186312369-186312391 GAAGAAGCCGAGACTCTGACGGG + Intergenic
985829057 5:2214369-2214391 GAGGCTTCACAGACTCTGACGGG + Intergenic
986966472 5:13278392-13278414 GAAGCCATCTTGACTTTGACAGG + Intergenic
992922807 5:81544371-81544393 GAAGCCTCTTTGACTCTGGAAGG + Intronic
996675269 5:126167981-126168003 GCAATCTCCTAGACCCTGACTGG + Intergenic
998217029 5:140245230-140245252 GAGGCCTCCTAGAGGCTGAGGGG - Exonic
1000854332 5:166379760-166379782 GAAGCCCCCTTGACTCCCACAGG - Intergenic
1007964249 6:45988929-45988951 CAAGCCTCATAGACTGAGACTGG - Intronic
1012934233 6:105348902-105348924 GAAGCCTGGTAGCCCCTGACAGG + Intronic
1013173831 6:107660914-107660936 GAAGCCTCCAAGATTCTCTCGGG - Intergenic
1017523559 6:155222936-155222958 GAAGCCTCCAAAAATCTTACAGG - Intronic
1018309560 6:162493878-162493900 CCAGCCTCCTAGGCTTTGACTGG + Intronic
1021001749 7:15340458-15340480 GAGGCCTCCTGGCCTGTGACAGG - Intronic
1021992951 7:26154205-26154227 GATCCCTCCAAGACTCTCACTGG - Intronic
1026422904 7:70258974-70258996 GAACCCTCCCAGACTCTGGAGGG - Intronic
1034669719 7:152848857-152848879 GATGGTCCCTAGACTCTGACAGG + Intronic
1035169427 7:157009523-157009545 GAAGCCGCCTCGGCTCTGCCCGG - Intronic
1035474910 7:159136463-159136485 GAAGCCACCAAGAATCTGACAGG + Intronic
1037169051 8:15868086-15868108 GGAGCCTGCTAGCCACTGACTGG + Intergenic
1039101708 8:33948460-33948482 AATGCCTCCTAGACTCTTCCAGG - Intergenic
1040308833 8:46226175-46226197 GAAGCCCCCTGGACTCTCCCAGG + Intergenic
1041392157 8:57356548-57356570 GAAGCTTCCTAGACTCTCTAAGG - Intergenic
1044835590 8:96292520-96292542 GCAGCCTCCTAGCCTCAGGCAGG - Intronic
1053893378 9:42718738-42718760 TAAGCCTCCTGGCCTCTGATGGG - Intergenic
1057292002 9:93812778-93812800 TAAGCCTCACAGATTCTGACAGG - Intergenic
1060825755 9:126687021-126687043 GCAGCCTCCCTGACGCTGACTGG - Intronic
1186576888 X:10776307-10776329 CAAGCCTTCTACACTCTGTCTGG - Intronic
1186655192 X:11604828-11604850 CAAGCCTCCTTGCCTCTGAAGGG - Intronic
1189364025 X:40374480-40374502 GAGCCATCCTAGACTCTGGCAGG - Intergenic
1189404937 X:40712982-40713004 GAAGCCACCTTGACTGTGATGGG - Exonic
1189961418 X:46327997-46328019 GAAGCCTCCTCAACTCTTCCAGG - Intergenic
1193842424 X:86423279-86423301 AAAGCCTCCTAGACTATTAGTGG - Intronic
1196799497 X:119530052-119530074 GTAGCCTCCTAGACACATACTGG - Intergenic
1197904508 X:131410650-131410672 AAAAACTCCTAGACTCTCACGGG + Intergenic
1198611207 X:138402654-138402676 GAAGCCACCTAGAGTCTATCTGG - Intergenic
1200702223 Y:6412035-6412057 CAAGCCTCCCAGACTTTGTCGGG - Intergenic
1201031888 Y:9752663-9752685 CAAGCCTCCCAGACTTTGTCGGG + Intergenic