ID: 1147188429

View in Genome Browser
Species Human (GRCh38)
Location 17:38725386-38725408
Sequence ACACCCCTGCGCATCGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 192}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147188419_1147188429 29 Left 1147188419 17:38725334-38725356 CCTTAGCTTGCACATGCCCACGC 0: 1
1: 0
2: 0
3: 3
4: 93
Right 1147188429 17:38725386-38725408 ACACCCCTGCGCATCGGCCCTGG 0: 1
1: 0
2: 0
3: 6
4: 192
1147188421_1147188429 13 Left 1147188421 17:38725350-38725372 CCCACGCAGCCCGGTGCTCTTCT 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1147188429 17:38725386-38725408 ACACCCCTGCGCATCGGCCCTGG 0: 1
1: 0
2: 0
3: 6
4: 192
1147188422_1147188429 12 Left 1147188422 17:38725351-38725373 CCACGCAGCCCGGTGCTCTTCTG 0: 1
1: 0
2: 0
3: 16
4: 147
Right 1147188429 17:38725386-38725408 ACACCCCTGCGCATCGGCCCTGG 0: 1
1: 0
2: 0
3: 6
4: 192
1147188427_1147188429 3 Left 1147188427 17:38725360-38725382 CCGGTGCTCTTCTGCAGGGTGGT 0: 1
1: 0
2: 2
3: 18
4: 172
Right 1147188429 17:38725386-38725408 ACACCCCTGCGCATCGGCCCTGG 0: 1
1: 0
2: 0
3: 6
4: 192
1147188425_1147188429 4 Left 1147188425 17:38725359-38725381 CCCGGTGCTCTTCTGCAGGGTGG 0: 1
1: 0
2: 1
3: 25
4: 245
Right 1147188429 17:38725386-38725408 ACACCCCTGCGCATCGGCCCTGG 0: 1
1: 0
2: 0
3: 6
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147188429 Original CRISPR ACACCCCTGCGCATCGGCCC TGG Intronic
900517165 1:3087962-3087984 ACACCCCTGCTCTTTGGCCTTGG + Intronic
900883923 1:5402179-5402201 ACACCCCTGCCCCCCTGCCCTGG + Intergenic
900933054 1:5748579-5748601 ACGGCCCTGCGGATCAGCCCAGG - Intergenic
900947774 1:5840997-5841019 AGCCCCCTGCCCATGGGCCCTGG + Intergenic
901563481 1:10092178-10092200 ACACCCCTGCACTCCAGCCCTGG + Intronic
901583587 1:10267058-10267080 ACACCCCTGCACTTCAGCCTCGG - Intronic
901867561 1:12117123-12117145 ACACCACTGCACATCGGCCTGGG - Intronic
902370377 1:16003112-16003134 ACACCACTGCGCTTCAGCCTGGG + Intergenic
902420596 1:16276335-16276357 ACACCACTGCACACCAGCCCGGG + Intronic
904628222 1:31820964-31820986 ACACCACTGCACTTCGGCCTGGG - Intergenic
904699794 1:32351536-32351558 TCGCCCCTTCGCATAGGCCCCGG + Intronic
904734611 1:32621354-32621376 ACACCACTGCGCTTCAGCCTGGG + Exonic
905095910 1:35470448-35470470 ACACCACTGCACTTCGGCCTAGG + Intronic
906326678 1:44850497-44850519 CCACGCCTGAGCATCAGCCCAGG - Intergenic
908151336 1:61305888-61305910 ACACCACTGCACTTCGGCCTGGG - Intronic
908545506 1:65158541-65158563 ACACCACTGCACTTCGGCCTGGG - Intronic
908680641 1:66657131-66657153 ACACCACTGCGCTTCAGCCTGGG + Intronic
912215523 1:107606995-107607017 ACACCACTGCACACCAGCCCGGG - Intronic
915124640 1:153655247-153655269 ATACCCCTGCACTTCAGCCCAGG + Intergenic
915207870 1:154284340-154284362 ACACCACTGCACTTCAGCCCAGG + Intergenic
915509237 1:156377531-156377553 AGGCCCCTGCCCATGGGCCCCGG + Intronic
918030980 1:180810534-180810556 ACACCCCTGCGCTCCAGCCTAGG + Intronic
919858992 1:201725912-201725934 ACACCCCTGCACACCAGCCTGGG + Intronic
922984904 1:229858707-229858729 ACACCCCTGCTCTCCGGCCTGGG + Intergenic
923102841 1:230830393-230830415 ACACCACTGCACATCAGCCTGGG + Intergenic
1065306574 10:24374827-24374849 ACACCACTGCACATCAGCCTGGG - Intronic
1067483456 10:46622445-46622467 ACACCACTGCACACCGGCCTGGG + Intergenic
1067611299 10:47719200-47719222 ACACCACTGCACACCGGCCTGGG - Intergenic
1067878959 10:50027226-50027248 GCACCCCTGCTCATCGTCCTGGG - Intergenic
1070622050 10:78020445-78020467 ACACCACTGCACTTCGGCCTGGG + Intronic
1070632807 10:78099531-78099553 ACACCACTGCACATCAGCCTGGG + Intergenic
1072235089 10:93446761-93446783 ACACCACTGCGCTCCAGCCCTGG - Intronic
1074247539 10:111709995-111710017 ACACCACTGCACTTCAGCCCGGG - Intergenic
1076906145 10:133362263-133362285 ACACCCCTGCACACGGGCACAGG - Intergenic
1077168392 11:1153851-1153873 AAACCCCTGGGCATGGGCCACGG - Intergenic
1078193989 11:9119509-9119531 ACACCACTGCACACCAGCCCAGG + Intronic
1079059102 11:17232206-17232228 ACACCTCTGCACACCGGCCTAGG - Intronic
1079636334 11:22746137-22746159 ACACCACTGCACATCAGCCTAGG + Intronic
1080719660 11:34836923-34836945 ACACCACTGCACTTCAGCCCGGG + Intergenic
1081859927 11:46327108-46327130 ACACCCCTGACCATCGCCCCGGG - Intergenic
1083579153 11:63813795-63813817 TCACCTCTGAGCATCGGCTCGGG - Exonic
1083739882 11:64702944-64702966 ACACCACTGCACTTCAGCCCAGG + Intronic
1085407548 11:76272363-76272385 ACACCCCTGCACTCCGGCCTGGG - Intergenic
1085682628 11:78592603-78592625 ACGCCTCTGCGCTTCGGCCTGGG - Intergenic
1086383658 11:86285638-86285660 ACACCCCTGCACTCCAGCCCGGG - Intergenic
1087996270 11:104813279-104813301 ACACCACTGCGCTCCAGCCCAGG - Intergenic
1088220498 11:107565595-107565617 ACACACCTCCGCTTCGGCTCAGG + Exonic
1089153428 11:116382909-116382931 ACACCACTGCGCTTCAGCCCGGG + Intergenic
1096237909 12:49942405-49942427 TCGCCCCTGCTCATCGGGCCAGG - Intergenic
1098342236 12:69464130-69464152 GCACCACTGCGCATCAGCCTGGG + Intergenic
1100840332 12:98606067-98606089 ACACCCCTGCACTCCGGCCTGGG + Intronic
1103302113 12:119935854-119935876 ACACCACTGCGCTTCAGCCTGGG + Intergenic
1103339420 12:120213599-120213621 CCAGCCCTGTGCAGCGGCCCTGG - Intronic
1104323742 12:127775831-127775853 ACACCACTGCACTTCAGCCCGGG + Intergenic
1105514254 13:21076165-21076187 TCACCCCTCCGCCTCGCCCCGGG + Intergenic
1107364446 13:39655619-39655641 CCGCGCATGCGCATCGGCCCCGG - Intronic
1114423643 14:22604650-22604672 ACACCACTGCACATCAGCCTGGG - Intronic
1114849015 14:26360005-26360027 ACACCACTGCGCTTCAGCCTGGG + Intergenic
1115383656 14:32770125-32770147 ACACCCCTGCACATTGCCACTGG + Intronic
1118573883 14:67222331-67222353 ACACCACTGCACATCAGCCTGGG - Intronic
1118773492 14:68958035-68958057 ACACCGAAGCGCATCAGCCCGGG + Intronic
1121254887 14:92524149-92524171 ACACCACTGCACTTCGGCCTGGG + Intronic
1122603506 14:102932786-102932808 ACACTCCTGCACACTGGCCCCGG - Exonic
1122891187 14:104733037-104733059 AGAGCCCTGCCCATCCGCCCAGG + Intronic
1123181738 14:106477753-106477775 ACACCCCTCTGCACCTGCCCTGG + Intergenic
1202945166 14_KI270726v1_random:18975-18997 ACACCCCTCTGCACCTGCCCTGG - Intergenic
1124034893 15:26045985-26046007 ACACCACTGCGCTTCAGCCTGGG + Intergenic
1129561547 15:76576314-76576336 ACAACACTGCGCTTCAGCCCGGG + Intronic
1131219416 15:90569360-90569382 ACACCACTGCACTTCGGCCTGGG - Intronic
1133040463 16:3057739-3057761 ACACCACTGCACTGCGGCCCAGG - Intronic
1133122579 16:3619402-3619424 ACACCACTGCACTTCGGCCTGGG - Intronic
1133280147 16:4660577-4660599 CCACCCCTTCGCTTCTGCCCAGG - Intronic
1133548815 16:6834105-6834127 ACACCACTGCACACCAGCCCGGG - Intronic
1134231640 16:12434658-12434680 ACACCCCTGCACAACGGCTGGGG + Intronic
1134631797 16:15761599-15761621 ACACCACTGCACTTCAGCCCGGG - Intronic
1136505199 16:30698596-30698618 ACAGCCTCGCGCACCGGCCCCGG - Intronic
1136517303 16:30775733-30775755 ACACCGCTCCGCACCGGCTCTGG - Exonic
1139719615 16:68841997-68842019 ACACCACTGCACTTCAGCCCGGG + Intergenic
1140851157 16:78935867-78935889 ACACCACTGCACTTCGGCCTGGG + Intronic
1143470311 17:7169930-7169952 GCACCACTGCACATCAGCCCAGG + Intergenic
1146357317 17:32144948-32144970 ACACCACTGCACTTCAGCCCAGG + Intronic
1146577788 17:34010119-34010141 TCACCCCTGCCCACCAGCCCAGG - Intronic
1147188429 17:38725386-38725408 ACACCCCTGCGCATCGGCCCTGG + Intronic
1147389685 17:40101440-40101462 ACACCCCTGCCCCTCGGTGCTGG + Intergenic
1148388057 17:47250423-47250445 ACACCACTGCACATCAGCCTCGG - Intergenic
1148655465 17:49280014-49280036 ACACCGCTGCACATCAGCCTGGG - Intergenic
1149931390 17:60759705-60759727 ACACCTCTGCACTTCAGCCCAGG - Intronic
1150778065 17:68098041-68098063 ACACCCCTGCACTTCAGCCTGGG - Intergenic
1150807351 17:68329699-68329721 ACACCCCTGCGATTAGTCCCTGG - Intronic
1150953206 17:69825193-69825215 ACACTCATGTGCATCAGCCCAGG - Intergenic
1151748964 17:76026285-76026307 ACACCCCTGCGCTCCCGCCTGGG - Intronic
1152436338 17:80278578-80278600 ACCCTCCTGCCCATGGGCCCTGG + Intronic
1152600392 17:81259334-81259356 ACACCCCTCTGCAGAGGCCCCGG - Intronic
1154347827 18:13558297-13558319 ACATCCCTGGGGATCCGCCCAGG + Intronic
1157119714 18:44897450-44897472 ACACACCTTCTCATCAGCCCGGG - Intronic
1158279305 18:55803576-55803598 ACACCACTGCACATCAGCCTGGG - Intergenic
1158598030 18:58833345-58833367 ACACCACTGCACTTCAGCCCGGG + Intergenic
1161156195 19:2732956-2732978 ATCCCCCTGGGCATCGGCCTGGG - Exonic
1165522244 19:36323826-36323848 AGACCCCTCAGCATCTGCCCTGG + Intergenic
1166116005 19:40654945-40654967 ACACCCCTGCACACCAGCCTGGG - Intergenic
1167973033 19:53200780-53200802 ACACCACTGCACTTCAGCCCAGG - Intergenic
925925966 2:8670837-8670859 ACACCTCTGAGCATTGGACCAGG - Intergenic
927641811 2:24850141-24850163 ACACCCCTGGGCAGGGGCCAGGG - Intronic
930571832 2:53095589-53095611 ACACCACTGCACATCAACCCTGG + Intergenic
933475699 2:82787675-82787697 ACTCCCCTGCACATTGGCCTAGG + Intergenic
935030793 2:99320048-99320070 ACACCACTGCACATCAGCCTGGG - Intronic
935878548 2:107537669-107537691 ACACCACTGCGCTTCAGCCTGGG + Intergenic
938135727 2:128755057-128755079 ACATCCCTGACCCTCGGCCCTGG + Intergenic
939524033 2:143270013-143270035 ACACACCTGCACACCAGCCCGGG - Intronic
940422000 2:153489939-153489961 ACACCCCTGCACTCCAGCCCGGG + Intergenic
943872644 2:193021038-193021060 ACACCGCTGCGCTTCAGCCTGGG + Intergenic
944225579 2:197345869-197345891 ACACCACTGCACATCAGCCTGGG + Intergenic
948748378 2:240112035-240112057 ACACCACTGCGCTCCGGCCTGGG - Intergenic
948806037 2:240453725-240453747 AGACCCCTGCGCACCCGCTCCGG + Intronic
1169041447 20:2498880-2498902 ACACCACTGCGCTTCAGCCTGGG - Intronic
1170940382 20:20843764-20843786 ACACCCCTGCACACAGGCCCAGG + Intergenic
1172548245 20:35778708-35778730 ACACCACTGCGCTTCAGCCTGGG + Intronic
1173527593 20:43744836-43744858 ACACCACTGCGCTTCAGCCTGGG + Intergenic
1174014981 20:47480590-47480612 ACACCACTGCGCTTCAGCCTGGG + Intergenic
1175153526 20:56953908-56953930 ACACCACTGCACTTCAGCCCAGG + Intergenic
1176382771 21:6121355-6121377 ACACACCTGCACATTGGCACCGG + Exonic
1179740698 21:43416884-43416906 ACACACCTGCACATTGGCACCGG - Exonic
1179925498 21:44531893-44531915 GCACCCCTGCTCTTCCGCCCAGG - Intronic
1182372671 22:29822761-29822783 ACACCACTGCACATCAGCCTGGG - Intronic
1183859393 22:40658541-40658563 ACACACCTGGGCACCAGCCCAGG - Intergenic
1184003373 22:41691306-41691328 ACACCACTGCACACCAGCCCAGG - Intronic
1184836881 22:47029215-47029237 ATACCCCTTCCCATGGGCCCAGG + Intronic
952365429 3:32670691-32670713 ACACCACTGCACATCAGCCCGGG - Intergenic
953107308 3:39896321-39896343 CCACCCCTGTGCATCGGTCAGGG + Intronic
953938021 3:47063432-47063454 ACACCACTGCGCTTCAGCCTGGG + Intronic
954446327 3:50548853-50548875 ACACCCCTGTCCAAGGGCCCTGG - Intergenic
954701968 3:52455337-52455359 ACAGCTCTGGGCATCGCCCCTGG - Intronic
956198350 3:66677039-66677061 ACACCACTGCGCTTCAGCCTAGG - Intergenic
960269533 3:115658850-115658872 AGAGCCCGGCGCATCGCCCCTGG - Intronic
961072941 3:123953244-123953266 ACAACCCTGAGAAGCGGCCCAGG - Intronic
961340566 3:126214214-126214236 ACTCCCCTGCCCAGAGGCCCGGG - Intergenic
963326465 3:143868809-143868831 ACACCCCTGAGACTCTGCCCCGG - Intergenic
968786734 4:2627618-2627640 ACACCACTGCACATCAGCCTGGG - Intronic
968898626 4:3419991-3420013 ACACCGCTGCACATGGGCTCTGG - Intronic
972521447 4:39861019-39861041 ACACCACTGCACTTCAGCCCGGG + Intronic
978127431 4:105151276-105151298 ACACCACTGCGCTCCAGCCCAGG + Intronic
980931620 4:139187974-139187996 ACACCACTGCGCTTCAGCCTGGG - Intergenic
981766017 4:148250991-148251013 ACACCACTGCACTTCGGCCTGGG - Intronic
988057317 5:26115164-26115186 ACACCACTGCGCTTCAGCCTGGG - Intergenic
990522163 5:56590745-56590767 ACACCACTGCGCTTCAGCCTGGG - Intronic
990671404 5:58134461-58134483 ACACCACTGCGCTTCAGCCAGGG - Intergenic
991395450 5:66199612-66199634 ACACCACTGCACTACGGCCCAGG - Intergenic
993151669 5:84170835-84170857 ACACCCCTGCACTCCAGCCCGGG - Intronic
994243475 5:97450934-97450956 ACACCACTGCACTTCGGCCTGGG + Intergenic
995324321 5:110873236-110873258 CCACTGCTGCGCATAGGCCCAGG + Intergenic
995554744 5:113315833-113315855 ACACCACTGCGCTCCAGCCCGGG + Intronic
995788392 5:115856495-115856517 ACACCACTGCCCATCAGCCTGGG - Intronic
996721581 5:126635719-126635741 ACACCCCTGCACTTCAGCCTGGG - Intronic
997795015 5:136800339-136800361 ACACCCCTGGGCATAGGACAGGG + Intergenic
997971307 5:138404764-138404786 ACACCCCTGCACTTCAGCCTGGG - Intronic
999760220 5:154694297-154694319 ACACCACTGCACTTCGGCCTGGG - Intergenic
1002060472 5:176622777-176622799 ACACCACTGCGCACCAGCCTGGG - Intronic
1002524227 5:179806638-179806660 CGACCCCTGCGCCCCGGCCCCGG - Intronic
1002702238 5:181132437-181132459 ACACCCCTGCACTTCAGCCTGGG + Intergenic
1005692438 6:28320521-28320543 TCACCCCTGCCCCTCGGCCTTGG + Intergenic
1007552237 6:42738900-42738922 ACACCACTGCACATCAGCCTGGG + Intergenic
1013585168 6:111571870-111571892 ACACCACTGCACACCAGCCCAGG + Intronic
1014798283 6:125749533-125749555 CCGCCCCCGCGCACCGGCCCAGG - Intronic
1017012474 6:150071922-150071944 ACACCACTGCACACCAGCCCGGG - Intergenic
1017376307 6:153773198-153773220 ACACCTCTGCACTTCAGCCCAGG + Intergenic
1019499547 7:1358148-1358170 ACACACCTGGGCATGAGCCCTGG - Intergenic
1019990538 7:4687333-4687355 ACACCCCTGCACTCCAGCCCGGG - Intronic
1020141260 7:5613117-5613139 ACACCCCTGTGCATCCTCACTGG + Intergenic
1022520497 7:31003733-31003755 ACAGCCCTGCGAAACAGCCCGGG - Intergenic
1023491166 7:40743804-40743826 AAAGCCCTGAGCATAGGCCCTGG - Intronic
1025976074 7:66371013-66371035 ACACCACTGCACATCAGCCTGGG + Intronic
1026101442 7:67387737-67387759 ACACCACTGCGCTTCAGCCTGGG + Intergenic
1028440287 7:90851863-90851885 ACACCACTGCACTTCGGCCTAGG - Intronic
1028615683 7:92764179-92764201 ACACCCCTGCACAGCAGCCTGGG - Intronic
1030058308 7:105602436-105602458 ACACCACTGTGCTTCGGCCTGGG - Intergenic
1032196272 7:129790584-129790606 ACACCCCTGCACTTCAGCCTGGG - Intergenic
1035774566 8:2178245-2178267 CCACCCCTGCGATTCGGCACAGG - Intergenic
1035862720 8:3047169-3047191 ACACCACTGCACTTCAGCCCAGG + Intronic
1037371809 8:18187824-18187846 ACAAACCTGCGCATATGCCCCGG + Intronic
1037807296 8:22065790-22065812 GCACCCCTGCGCTCCGGCCTGGG + Intronic
1038260187 8:25985957-25985979 ACACCACTGCACACCAGCCCGGG + Intronic
1045871322 8:106930325-106930347 GCACCCCTGCACTTCAGCCCAGG + Intergenic
1047706540 8:127505161-127505183 ACACCCCTGCCCCTGGACCCAGG + Intergenic
1048194563 8:132321753-132321775 ACACCCCTGTGCTTTGGCCCAGG + Intronic
1049167401 8:141135192-141135214 ACACCACTGCGCTCCGGCCTGGG - Intronic
1049466148 8:142752119-142752141 ACACCCCTGAGCACCAGCCTGGG - Intronic
1049689658 8:143953049-143953071 ACACCCCTGCGCCAGGGTCCAGG + Intronic
1050763141 9:9098297-9098319 ACACCACTGCACTTCAGCCCGGG - Intronic
1053753928 9:41283892-41283914 ACACCCCTGCACTTCAGCCTGGG - Intergenic
1054259448 9:62848253-62848275 ACACCCCTGCACTTCAGCCTGGG - Intergenic
1056347870 9:85717457-85717479 ACACCACTGCGCTTCAGCCTGGG + Intronic
1060049856 9:120370556-120370578 GCACCACTGCACACCGGCCCGGG + Intergenic
1061321726 9:129835251-129835273 GCGCCTCTGCGCAGCGGCCCAGG + Exonic
1193893091 X:87075749-87075771 ACACCACTGCACATCAGCCTGGG + Intergenic
1196099035 X:111829257-111829279 ACACCACTGCACTCCGGCCCGGG + Intronic
1196264324 X:113624212-113624234 ACACTCCTGCACATTGGCCTGGG - Intergenic
1196673977 X:118400043-118400065 ACACCACTGCACTTCGGCCTGGG + Intronic
1200053030 X:153444780-153444802 ACGGGCCTGCTCATCGGCCCAGG + Exonic
1202080564 Y:21079938-21079960 ACACCTCTGCACACCGGCCTGGG - Intergenic