ID: 1147190181

View in Genome Browser
Species Human (GRCh38)
Location 17:38733869-38733891
Sequence CTGTAGTTCTTTGGGGTGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 272}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147190181 Original CRISPR CTGTAGTTCTTTGGGGTGGA GGG (reversed) Exonic
900766709 1:4510780-4510802 CTGTTGATGTTTGGGGTGGGAGG + Intergenic
901339435 1:8482240-8482262 CTAAACTTCTCTGGGGTGGATGG - Intronic
901428546 1:9198687-9198709 CTGTACTTCATTGGAGTTGAGGG - Intergenic
902224249 1:14986737-14986759 CAGTTGTTTGTTGGGGTGGAGGG + Intronic
903143532 1:21355129-21355151 CTGTAGTTCTTTCATGTGGAGGG + Intergenic
903739578 1:25550914-25550936 CTTTGGTTCTTTGGAATGGAGGG + Intronic
903890084 1:26563792-26563814 CTTCAGTTTTTTGGGGGGGATGG + Intronic
906008394 1:42500057-42500079 CAGTAGTTCTTTGATGTGAAAGG + Intronic
909229349 1:73065635-73065657 CTGTAGATGTTTGCAGTGGAGGG + Intergenic
910821717 1:91358010-91358032 CTGTACTTCTTTGGGTAGTATGG - Intronic
911769263 1:101718623-101718645 CTGTAGTTCCTTGGAGAGGTAGG + Intergenic
911854151 1:102855273-102855295 TTGTATTTCTGTGGGGTCGATGG + Intergenic
912381500 1:109250187-109250209 CTGTCGTTCCTTGGGGTCCAGGG + Exonic
913227251 1:116710934-116710956 CTGTAGTCCTCTGGGCTGGCTGG + Intergenic
916184427 1:162116912-162116934 CTGTAGCTTTTTGGGGGGGCTGG + Intronic
918169106 1:181978607-181978629 TTGTATTTCTTTGGGGTCGGTGG - Intergenic
920945898 1:210528247-210528269 CCCAAGATCTTTGGGGTGGAAGG + Intronic
922191817 1:223325479-223325501 CTCTTGTTCTTTGTGGTGAATGG - Intronic
924208915 1:241744581-241744603 CTTTCGTTCTTTAGGGTAGAAGG + Intronic
924610081 1:245566352-245566374 CTGTGGTTCTTTTGGGTGAAAGG - Intronic
1063775477 10:9258882-9258904 CTGTAATACTGTGGGGTGGTGGG + Intergenic
1068561762 10:58522876-58522898 CTGTAGTTCTGTGGGATCGATGG - Intronic
1069291677 10:66787621-66787643 CTGTAGTTCGAAGGGGAGGAGGG + Intronic
1069625251 10:69863676-69863698 ATGAAGTTCTCAGGGGTGGAAGG - Intronic
1069914032 10:71776210-71776232 CTCTGGATCTTGGGGGTGGAGGG - Intronic
1071910287 10:90224083-90224105 CTCTTCTTCTTTGGGGTGGCTGG + Intergenic
1074404198 10:113166560-113166582 GTGTTGTTCTTTTGGGGGGAGGG + Exonic
1074940866 10:118235001-118235023 ATGGAGTTGTTTGGGCTGGAAGG + Intergenic
1077000346 11:319227-319249 CTTTAGTTCCTCGGGGTGGAGGG - Intergenic
1077220347 11:1412958-1412980 CTGTAGGCCTGAGGGGTGGATGG + Intronic
1078116162 11:8453001-8453023 CTGGGGTTCTTGGGGGTGGGAGG + Intronic
1078929277 11:15901087-15901109 CTAAGGTTCCTTGGGGTGGAGGG - Intergenic
1078946473 11:16073608-16073630 CTGTTTTTTTGTGGGGTGGAGGG - Intronic
1080839134 11:35968217-35968239 CTATAGGACTTTGGGGTGAAGGG + Intronic
1083427991 11:62599164-62599186 CTGCAGCTCCTTGGGGAGGAAGG - Intronic
1083542304 11:63520693-63520715 CAGTAGTTCTTTGGTGTGAAAGG + Intergenic
1084484375 11:69439289-69439311 CTGGAGGCCTTGGGGGTGGAGGG - Intergenic
1086071579 11:82805630-82805652 CTCTACTTCTTGGAGGTGGAGGG - Intergenic
1086756714 11:90573041-90573063 CTGTATTTCTGTGGGGTTGGTGG + Intergenic
1087251651 11:95907186-95907208 TTGTATTTCTTTGGGGTTGGTGG - Intronic
1087528404 11:99348332-99348354 GTGTATTTTTTTGGGGGGGACGG - Intronic
1087545653 11:99580649-99580671 TTGTAGTTCTGTGGGGTCGGTGG + Intronic
1088782400 11:113148731-113148753 CTGCAGTAGTTTTGGGTGGAGGG + Intronic
1088834901 11:113569242-113569264 CTGTGGGTCCTTGGGGTGGGAGG - Intergenic
1089277160 11:117345146-117345168 CTAGAGCTCTTTGGGTTGGAAGG + Intronic
1090182664 11:124714452-124714474 CTGTAGATCTATGAGGTGGTTGG + Intergenic
1093206046 12:16251267-16251289 CTCTAGTTCCTTGAGGTGTAAGG - Intronic
1093301007 12:17454973-17454995 CTGTACTACTTTGGGGAGGTAGG - Intergenic
1093732033 12:22575713-22575735 GTGGAGTTATTTGTGGTGGATGG + Intergenic
1095320077 12:40816469-40816491 TTGTATTTCTGTGGGGTCGATGG + Intronic
1095331635 12:40972231-40972253 TTGTAGATCGTTTGGGTGGAAGG + Intronic
1095487639 12:42701384-42701406 TCATAGTTTTTTGGGGTGGAGGG + Intergenic
1096533276 12:52255219-52255241 CTGTAGTTCGGAGAGGTGGAGGG - Intronic
1097161144 12:57047522-57047544 AGGAAGTTCTGTGGGGTGGAGGG + Intronic
1101329507 12:103746112-103746134 ATGTAGTGCTTAGGGGAGGAGGG - Intronic
1101354778 12:103966492-103966514 CAGTAGGCCTTTGGGGTGGGGGG - Intronic
1103935805 12:124475906-124475928 CTATGGTTCTGTGGGGTGAACGG - Intronic
1105541509 13:21320716-21320738 CTGAATGTCTTTGGGCTGGATGG + Intergenic
1105624714 13:22101623-22101645 CTGTAGTTCTGGGGGTTCGAGGG - Intergenic
1106749123 13:32740404-32740426 CTGTAGCTCTTTGTGTTTGAGGG + Intronic
1107964278 13:45585564-45585586 CTGCAGTTACTTGGGGTGGGGGG - Intronic
1110078635 13:71282709-71282731 CTCCAGTTCTTGGGGGTGGAGGG + Intergenic
1111004665 13:82232317-82232339 TTGTATTTCTTTGGGATGGGTGG - Intergenic
1111503410 13:89155541-89155563 CTGCAATTCTTCGGGGTGAATGG - Intergenic
1112054579 13:95677764-95677786 CTGGAGTTCTTGGGTGGGGAAGG + Intronic
1116871153 14:50070191-50070213 GTTTTGTTTTTTGGGGTGGATGG - Intergenic
1117959544 14:61149154-61149176 CTGAACCTGTTTGGGGTGGAGGG - Intergenic
1118146377 14:63141802-63141824 CTGTATTTCTGTGGGATTGATGG + Intergenic
1118249170 14:64142348-64142370 CTGTGGTTATTGGGGGTGGTGGG - Intronic
1118646262 14:67843675-67843697 TTGTATTTCTGTGGGGTCGATGG + Intronic
1121374062 14:93389533-93389555 TTGGAGTTCTTGGAGGTGGAAGG + Intronic
1123028758 14:105440815-105440837 CTGGAGCTCCTTGGCGTGGAGGG - Intronic
1124948135 15:34289798-34289820 CTGTATTTCTTTGGGATAGGTGG + Intronic
1126175315 15:45730433-45730455 CTGGAGTTCTTTGAGGGGGATGG + Intergenic
1128325795 15:66723198-66723220 CTTTAGTGCCTTGGGATGGAGGG - Intronic
1128718117 15:69925018-69925040 CTGGAGTTCTTGTTGGTGGACGG + Intergenic
1129771471 15:78206019-78206041 CTGGTGTCCTTGGGGGTGGAGGG - Intronic
1130398929 15:83530917-83530939 CTGTCTTTCTTTGTGTTGGAAGG - Intronic
1130528246 15:84725325-84725347 CTTTGGTTGTTGGGGGTGGAGGG - Intergenic
1131506269 15:93022484-93022506 CTGGAGGTCTTTGGTGTGGCTGG + Intronic
1131710838 15:95054534-95054556 TTGTATTTCTGTGGGGTAGATGG + Intergenic
1132002737 15:98196467-98196489 CTGGGGTTCTTTGGGATGAAAGG - Intergenic
1132628994 16:907590-907612 CTGTGGTTCTGTGGCCTGGAGGG - Intronic
1132780022 16:1618540-1618562 CTGAAGTTCTTCGGGGTGAGAGG - Intronic
1135548525 16:23381128-23381150 CTGTTCCTCTCTGGGGTGGATGG - Exonic
1137636885 16:49994554-49994576 ATGTAGTTCTCTGTGCTGGAAGG - Intergenic
1139910508 16:70394802-70394824 CTTTACCTGTTTGGGGTGGATGG - Intronic
1140040148 16:71402176-71402198 CTGTTGTTCTGTGGGAGGGAGGG - Intergenic
1140742133 16:77951083-77951105 CTGTATTTCCTTCAGGTGGATGG - Intronic
1141375037 16:83522834-83522856 CTTTAAGTCCTTGGGGTGGAGGG - Intronic
1144001574 17:11060029-11060051 CTGTAGTTCTGTGGTCTTGATGG + Intergenic
1144247950 17:13386061-13386083 CTGTATTTTTGGGGGGTGGATGG + Intergenic
1144903915 17:18624778-18624800 ATGAAGTTCTTAAGGGTGGAAGG + Intergenic
1147190181 17:38733869-38733891 CTGTAGTTCTTTGGGGTGGAGGG - Exonic
1147467851 17:40625502-40625524 TGGTAGTGCTTGGGGGTGGAGGG + Exonic
1147510105 17:41060713-41060735 CTGTACTATTTGGGGGTGGAGGG + Intergenic
1147618496 17:41845803-41845825 CTGCTCTTTTTTGGGGTGGATGG + Intronic
1148992910 17:51681936-51681958 CTGTGGCTGTTTGGGGTGAAGGG + Intronic
1149400555 17:56291649-56291671 CTGTAGTTCTTTGCTGCAGATGG + Intronic
1150787123 17:68172170-68172192 CAGTAGTTGTTTGGGGGTGATGG + Intergenic
1150976409 17:70091924-70091946 CTGTAATTTATTGGGTTGGAGGG + Intronic
1151744692 17:76005594-76005616 GTGTTGTTTTTTGGGTTGGACGG + Exonic
1155476601 18:26241403-26241425 TTGTATTTCTGTGGGGTTGATGG + Intronic
1155479227 18:26267501-26267523 CTAGAGTTCTTGGCGGTGGAGGG - Exonic
1156249645 18:35340324-35340346 CTGTAGCTCTTTGGGTAGGATGG + Exonic
1156253433 18:35373966-35373988 CTGAAGCTCTTTTGGGAGGATGG + Exonic
1157519995 18:48338900-48338922 CTGTAGTTTGTTGGGGGGGGGGG + Intronic
1157805629 18:50655547-50655569 CTGCACTCCTCTGGGGTGGAGGG + Intronic
1158693773 18:59684871-59684893 CTTTTGTTTTCTGGGGTGGAGGG + Intronic
1158890947 18:61871205-61871227 CTGTTTTTTTTTGGGGTGGGGGG - Intronic
1159622166 18:70651107-70651129 CTGTAGGGCTTTAGGGAGGATGG + Intergenic
1160143807 18:76348233-76348255 CTGGAGTTCTTGGGGGTTCAGGG - Intergenic
1161689764 19:5724692-5724714 CTGTTCTTTTTTGGGGGGGACGG - Intronic
1163264688 19:16212419-16212441 TTGTAGTTCTGTGGGGTCAATGG + Intronic
1164468941 19:28512348-28512370 CCATAGTTCTTTGCTGTGGATGG - Intergenic
1164893520 19:31846773-31846795 ATGTATTGCTTTGGGCTGGATGG + Intergenic
1166616232 19:44249873-44249895 CTGTAACTCTAGGGGGTGGAGGG - Intronic
1167108195 19:47443350-47443372 TTGTGGGTCTTTGGGGTCGAGGG - Intronic
1168318120 19:55493138-55493160 CTGATGTCCTTTGGGGAGGAAGG - Intronic
925407825 2:3617400-3617422 CCGTAGTTCTTTGATGTGAAAGG + Intronic
926103012 2:10132632-10132654 CTGAAGTATTTTGGGGTGGATGG + Intergenic
926525560 2:13975368-13975390 CTGTCTTTCTCTGGGGTGGCAGG + Intergenic
928285627 2:29987828-29987850 TTGGGGTTCTCTGGGGTGGAAGG + Intergenic
930623065 2:53664849-53664871 TTGTATTTCTTTGGGATGGGAGG - Intronic
931084108 2:58809931-58809953 CTGTAGTTTTTGGAAGTGGAGGG + Intergenic
931530976 2:63213984-63214006 CTGGAGTTCTTTTGGTTGGTAGG - Intronic
933393413 2:81701479-81701501 CTTTAGTTCTTGGTGGTGGTAGG - Intergenic
933639354 2:84742535-84742557 CTGTAGTTATTTGTTGTGGAGGG - Intronic
933724393 2:85418457-85418479 TTGTAGTTCTTAGGGGTCTAGGG - Intergenic
938315493 2:130324148-130324170 CTGTATTTCCTTGGGGTTGGTGG + Intergenic
939205295 2:139094206-139094228 CTGTAGTTTTTGGGTTTGGAGGG - Intergenic
939294456 2:140241917-140241939 CTGTACTTATTAAGGGTGGAGGG + Intronic
941156389 2:161983076-161983098 TTGTGGTGCTTTGGGGTTGACGG + Intronic
941560949 2:167043515-167043537 TTGTAGTTCTGTGGGGTTGCTGG - Intronic
941763246 2:169267928-169267950 TTGTATTTCTTTGGGATGGGTGG - Intronic
943302519 2:186221801-186221823 GTGTAGCTCTCTGTGGTGGATGG + Intergenic
943741464 2:191414653-191414675 CTTTACCTCTTTGAGGTGGACGG - Exonic
944215249 2:197248022-197248044 GGGTAGTTTTTTGGGATGGAGGG - Intronic
944347719 2:198688285-198688307 CTGGAATTCTTTTGGTTGGAAGG - Intergenic
945351912 2:208790260-208790282 CTGTTGTGCGTTGGGGTGGGGGG + Intronic
946202094 2:218076412-218076434 CTGAGGCTCTGTGGGGTGGAAGG - Exonic
946863779 2:224024640-224024662 CTGAAGTTCATTGGTGGGGAAGG - Intronic
948964101 2:241362933-241362955 CTGTGGTTCTGGGAGGTGGAGGG + Intronic
1169142119 20:3232562-3232584 CTGTAGTTTTTGGTGGTGGCGGG + Intronic
1169321184 20:4634536-4634558 GTTTAGTTATTTGGGGAGGAGGG - Intergenic
1169507372 20:6226007-6226029 CTGTATTTTTTTGGGATGGGGGG + Intergenic
1169806735 20:9567374-9567396 ATCTAGGTCCTTGGGGTGGATGG - Intronic
1169930996 20:10832842-10832864 CTGTAGTTCTTGGGAGTACAAGG + Intergenic
1172163552 20:32885055-32885077 CTCTAGTGCTCTGGGGTAGAGGG - Intronic
1172664901 20:36592335-36592357 TTGTAGTTTTTTTGGGTGGGTGG + Exonic
1173477103 20:43367867-43367889 CAGCAGTTCTGAGGGGTGGAGGG + Intergenic
1173662480 20:44744299-44744321 TTCTAGTTCTGTAGGGTGGAGGG + Intergenic
1174482354 20:50840467-50840489 CAGTAGTTCTTTGATGTGAAAGG + Intronic
1175368996 20:58474299-58474321 CTGTGGTTCAGAGGGGTGGAGGG + Intronic
1176228925 20:64020678-64020700 CTGTAGTTCTGTTGAGTGGATGG + Intronic
1176756302 21:10728169-10728191 CTGGAGTTAATTGGAGTGGAAGG - Intergenic
1178996987 21:37411366-37411388 CTGTCATTTTTTGGGGGGGAGGG - Intronic
1179949557 21:44702172-44702194 CTTTTGCTCTGTGGGGTGGATGG - Intronic
1181814960 22:25430595-25430617 CAAGAGTTCTCTGGGGTGGATGG + Intergenic
1182943259 22:34298422-34298444 CTGTAGGTTTTTAGGGTGTAAGG + Intergenic
949510936 3:4766357-4766379 CTGTAGTTCTCTGGGTTCTAAGG - Intronic
952193422 3:31047393-31047415 CTGTACTTCTTTGGAGGGCAGGG + Intergenic
952749670 3:36815233-36815255 TTGTAGGACTTTGGAGTGGAAGG - Intergenic
954304023 3:49716193-49716215 CTGTAGTGTGTTGGGGTGCAGGG - Intronic
954500506 3:51009436-51009458 TTGTATTTCTTTGGGATCGATGG + Intronic
955771252 3:62386883-62386905 CAGTAGAGATTTGGGGTGGAAGG - Intergenic
956786383 3:72646110-72646132 ATGTTGTTCTTGGTGGTGGAAGG - Intergenic
956894037 3:73641399-73641421 CTGAAGATCTTTGTGGTTGAGGG + Intergenic
957457980 3:80478227-80478249 TTCTAGTTCTTTGAGGTGTAAGG + Intergenic
958591067 3:96158586-96158608 TTGTATTTCTGTGGGGTTGATGG - Intergenic
959270071 3:104195823-104195845 CTGGACTTCACTGGGGTGGAGGG + Intergenic
959624732 3:108436982-108437004 CCTGAGTTCTTTGGGGTGTAAGG + Intronic
960502189 3:118451386-118451408 TTGTAGTTCTGTGGGGTGAGTGG + Intergenic
962221041 3:133564840-133564862 CTGTAGATCTTTGGGAGGGGAGG - Intergenic
963388474 3:144627200-144627222 CTGAATTGCTTTGGAGTGGAGGG + Intergenic
965171388 3:165269293-165269315 CTGCATGTCTTTGGGGAGGAAGG + Intergenic
965178458 3:165367089-165367111 CTGTAGTTCAGTGGGCAGGAAGG + Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967890300 3:194359982-194360004 CTGCAGTGCGTTGGTGTGGAGGG + Exonic
969410167 4:7022850-7022872 CTTTAGTTCTTTGGGCTTGGGGG + Intronic
970674769 4:18436337-18436359 CTGTTGTTCTTTGTGGTGGGTGG + Intergenic
971169013 4:24214124-24214146 TTGTGGTTTTCTGGGGTGGATGG + Intergenic
971950385 4:33337386-33337408 TTGTATTTTTTTGGGGGGGAAGG + Intergenic
976951575 4:90838755-90838777 CAGTAGTTCTTTGATGTGAAAGG + Intronic
977084160 4:92573141-92573163 CTGTATTTCTTTGGGGTCAGTGG + Intronic
977110015 4:92941387-92941409 CTGTATTTCTTTGGGATTGGTGG + Intronic
977689844 4:99894212-99894234 GCCTAGCTCTTTGGGGTGGAGGG - Intronic
981250795 4:142598502-142598524 CTGTAGTCCTTTGGTGGGAATGG - Intronic
984466009 4:180101068-180101090 CTGTGTTTCCCTGGGGTGGATGG - Intergenic
985245242 4:187973975-187973997 CAGTTGTTTTGTGGGGTGGAGGG + Intergenic
985941880 5:3142703-3142725 CTGAAAATCCTTGGGGTGGACGG + Intergenic
986356425 5:6931840-6931862 TTGTATTTCTTTGGGGTCAATGG + Intergenic
987296034 5:16552111-16552133 ATGGACTTCTTTGGTGTGGATGG + Intronic
987552635 5:19403635-19403657 CTGATGTTCCTGGGGGTGGAAGG + Intergenic
989679029 5:44007573-44007595 ATGTAGTTCTATGTTGTGGATGG + Intergenic
989799281 5:45516467-45516489 CAGTAGTTCTTTGGAATGCAAGG + Intronic
989943653 5:50188574-50188596 CTGTAGTTCTTTGCGGCCTAAGG - Intergenic
991277464 5:64866467-64866489 CTCTAGTTTTTTAGGGTAGAAGG + Intronic
992992777 5:82301304-82301326 CTGTAGTTGCCTGGGGTTGAGGG + Intronic
995651462 5:114373732-114373754 TTGGAGTTTGTTGGGGTGGAAGG + Intronic
996265772 5:121537950-121537972 TTGTATTTCTGTGGGGTAGATGG - Intergenic
996888397 5:128387281-128387303 CTGTATTTCTTTGGGGTTGTTGG + Intronic
997138026 5:131347321-131347343 CTGTATTTCTGTGGGATGGGTGG - Intronic
997642631 5:135459303-135459325 CTGTAGTCCTCTGGGGTTGCCGG - Intergenic
998545344 5:143022949-143022971 CTCTAGTTCTTTGTGGCTGAGGG + Intronic
1000026449 5:157363140-157363162 CTGGAGTGCCTTGGGGAGGAAGG - Intronic
1001783465 5:174391013-174391035 CTGAAGTGCTGTGGGGTGTAGGG - Intergenic
1002182937 5:177440946-177440968 CTGAATGTCTTTGGGCTGGATGG + Exonic
1005450134 6:25963971-25963993 TTGTTGTTCTTTGTGGGGGATGG + Intronic
1005914347 6:30339817-30339839 CTGTGGAACTTTGGGGAGGAGGG + Intronic
1006634159 6:35450388-35450410 CTGCAGTTCATGGGGGTGGAGGG - Intergenic
1008707077 6:54175319-54175341 CTGTAGTACTTTGGGTAGTATGG + Intronic
1011351667 6:86431039-86431061 ATGTATTTCTCTGGGGTGGTTGG - Intergenic
1014900769 6:126961795-126961817 GGCTAGTGCTTTGGGGTGGAGGG - Intergenic
1015651650 6:135468671-135468693 CTGCATTTCTGTGGGGTCGATGG - Intronic
1015689635 6:135907373-135907395 CTGTAATTCTTTGGGGTGCCAGG - Intronic
1016347954 6:143136101-143136123 CTGTAGTTTTTTTGGGGGGGCGG + Intronic
1017271374 6:152510793-152510815 CTGGAGTTCTTCGGGGTGTGAGG + Intronic
1017639046 6:156472508-156472530 CAGTAGTTCCTTAGGGTGGCAGG - Intergenic
1017959139 6:159206774-159206796 CTGGAATTCTTTGGGCTGGCTGG + Intronic
1022214902 7:28249414-28249436 CTGTGGTTCCTAGGGGTTGAGGG + Intergenic
1022525598 7:31035101-31035123 CTTTCCTTCTTTGGGGTCGAGGG - Intergenic
1022563780 7:31376354-31376376 CTTTACTTCTTTGGAGTGAAAGG - Intergenic
1022982127 7:35613896-35613918 GTGTAGTTCTTTGAGGCAGATGG + Intergenic
1023517998 7:41021615-41021637 CTCTAGTTCTTGGGGGTGGGGGG - Intergenic
1024195711 7:47056921-47056943 TTGTACTTAGTTGGGGTGGAGGG + Intergenic
1025520232 7:61719543-61719565 TTGTTGCTCTTTGGGGTGAATGG - Intergenic
1025544554 7:62148198-62148220 TTGTTGCTCTTTGGGGTGAATGG - Intergenic
1026036476 7:66833458-66833480 CTGCAGTTCTCTGGGAGGGAGGG - Intergenic
1026192556 7:68142803-68142825 CTGATTGTCTTTGGGGTGGAAGG - Intergenic
1026347087 7:69483521-69483543 CTGTGGATCTTTGGGGCTGAGGG - Intergenic
1026583390 7:71636320-71636342 CTGCAGTTCTCTGGGGAAGATGG + Intronic
1027479273 7:78674326-78674348 CAATATTTCTTTGAGGTGGAAGG + Intronic
1030599449 7:111576906-111576928 CTGTAATTCTTTGGGTAGTATGG - Intergenic
1030702712 7:112659060-112659082 TTGTATTTCTGTGGGGTGGGTGG + Intergenic
1031274370 7:119699976-119699998 CTGTAATTCCTTGGGGAGAAAGG - Intergenic
1031863536 7:127011907-127011929 CTCAAGTTTTTTGGTGTGGAAGG - Intronic
1032947262 7:136869017-136869039 CTTTAGTGGTTTGGCGTGGAGGG + Intronic
1034551881 7:151826018-151826040 CTCCAGTTCTCTGGGATGGAGGG - Intronic
1034717145 7:153254080-153254102 CTGAAGTGTTTTGGTGTGGAGGG + Intergenic
1034717159 7:153254162-153254184 CTGCAGATATCTGGGGTGGAGGG + Intergenic
1034931981 7:155169862-155169884 CTGGGGTTCTTATGGGTGGAGGG - Intergenic
1036061832 8:5331427-5331449 CTGTGGTTCTTTGGGCTCCATGG + Intergenic
1036181891 8:6592987-6593009 CTGTGTTTATTTGGGGTGTAGGG - Intronic
1037578616 8:20231211-20231233 CTGTAGCCCTTTGGGTTGGCTGG + Intergenic
1037601562 8:20400564-20400586 CTCCAGTGGTTTGGGGTGGAGGG + Intergenic
1037730895 8:21523304-21523326 CTGAACTTCTTGGGGGTGGGGGG + Intergenic
1040798575 8:51315492-51315514 CCGTAGGCGTTTGGGGTGGAAGG - Intergenic
1041567506 8:59296531-59296553 ATGTCATTCCTTGGGGTGGAGGG - Intergenic
1041841863 8:62281192-62281214 TTGTAGTTCTGTGGGATTGATGG + Intronic
1041855822 8:62453699-62453721 CTGTATTTCTGTGGGGTCGGTGG - Intronic
1042493101 8:69424332-69424354 CTGTAGTTGTTTGGAGTGGGAGG + Intergenic
1042622883 8:70725297-70725319 ATGTTGCTCTTTTGGGTGGATGG + Intronic
1043877570 8:85503329-85503351 CTGTGGTTCAGTGGGGAGGAAGG - Intergenic
1044369423 8:91390938-91390960 GTGTACTTCTTTGTGGAGGAGGG + Intronic
1044444477 8:92258464-92258486 CTGAAGATCTCTGGGGTGGCTGG + Intergenic
1046571129 8:115967577-115967599 GTGTTGTTCTATGGGGTGAAAGG + Intergenic
1048862003 8:138730446-138730468 CTGTAATTTTCTGGAGTGGAGGG - Intronic
1048887175 8:138917942-138917964 CTGTAATGCTTTGGGGTCTATGG - Intergenic
1049954677 9:681369-681391 CTGTGTTTCTTTGGGGTGTAGGG + Intronic
1049965845 9:778664-778686 TTGTAGTTCCTTGAGGTGCATGG - Intergenic
1050289440 9:4138884-4138906 CTGTAGCTCTTTGGGGTGCCTGG - Intronic
1051232795 9:14970288-14970310 TTGTATTTCTTTGGGATTGATGG - Intergenic
1051706136 9:19882098-19882120 CTCTATTTCCTTGGGGTAGAGGG + Intergenic
1057714821 9:97484272-97484294 CTGCAGGGCTTTGGGGAGGAGGG - Intronic
1059407873 9:114113119-114113141 CTATAGTTTAGTGGGGTGGAAGG + Intergenic
1059504285 9:114783712-114783734 CTGAAGTTCTTAGGCATGGAGGG + Intergenic
1059557988 9:115300572-115300594 CTGTAGCTCATTGGGATGGAGGG + Intronic
1061076128 9:128342492-128342514 CAGTAGTTCTTTGATGTGAAAGG - Intronic
1061393446 9:130330398-130330420 CTGTAGGTGGTTGGGGTGGATGG + Intronic
1203397032 Un_KI270519v1:30897-30919 TTGTAGTGCTTTGGGGTTTATGG - Intergenic
1203685071 Un_KI270757v1:42264-42286 TTGGAGTTCTTTGGGGTCTATGG + Intergenic
1185784047 X:2874905-2874927 GTGGAATTCTTGGGGGTGGATGG - Intronic
1186039653 X:5461929-5461951 CTGGAATTCTTTGGGAAGGAGGG - Intergenic
1186539160 X:10382609-10382631 CTGTAGCCCTTGGGGATGGAGGG + Intergenic
1186788815 X:12976937-12976959 CAGTAGTTCTTTGATGTGAAAGG - Exonic
1186919893 X:14267008-14267030 GTGTAGTTGCTTAGGGTGGATGG + Intergenic
1187265100 X:17725255-17725277 CTGTAGATCTGTGGGCTGGCAGG - Intronic
1187444543 X:19349548-19349570 CTGTTGTTCTGTGGGGGGAAGGG + Intronic
1187737233 X:22317212-22317234 CTTTAGTTTTTTGAGGGGGAAGG - Intergenic
1188648830 X:32604470-32604492 TTGTAGTTCTTGGGGGAGGGGGG - Intronic
1188792637 X:34423210-34423232 CTGTACTTCTTTGGGGTCAATGG - Intergenic
1189795566 X:44642770-44642792 ATGTAATTCTTTGTGGTGGGGGG - Intergenic
1190230176 X:48575803-48575825 CTTTTGTTCTAGGGGGTGGAGGG + Intronic
1190651713 X:52574573-52574595 CGGGAGTTCCTTGGGGTGGCTGG - Intergenic
1191199719 X:57766747-57766769 CTGAAGTTCTTGGGGATAGATGG - Intergenic
1191747378 X:64504187-64504209 CTGTATTTCTGTGGGGTGAGAGG - Intergenic
1193607516 X:83586765-83586787 TTGTATTTCTCTGGGGTAGATGG - Intergenic
1195491357 X:105473969-105473991 ATGGACATCTTTGGGGTGGAGGG - Intronic
1195794694 X:108632342-108632364 CTGGACTTCTTTTGGGTGGTAGG - Intronic
1197465759 X:126802821-126802843 CTGTATTTCTGTGGGATTGATGG + Intergenic
1197869858 X:131054528-131054550 CTCTACTTCTTTTGGGTGCATGG - Intergenic
1198277859 X:135113140-135113162 CTGTGGATGTTTGGGCTGGAAGG - Intergenic
1201489133 Y:14523154-14523176 CTCCATTTCTTTGGTGTGGATGG + Intronic
1201980980 Y:19910299-19910321 CTATAGTTCTGAGGAGTGGATGG + Intergenic