ID: 1147190191

View in Genome Browser
Species Human (GRCh38)
Location 17:38733925-38733947
Sequence CAAGAGATACAGATGTCCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 187}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147190184_1147190191 29 Left 1147190184 17:38733873-38733895 CCACCCCAAAGAACTACAGGCTC 0: 1
1: 0
2: 0
3: 12
4: 127
Right 1147190191 17:38733925-38733947 CAAGAGATACAGATGTCCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 187
1147190187_1147190191 24 Left 1147190187 17:38733878-38733900 CCAAAGAACTACAGGCTCCAGAA 0: 1
1: 0
2: 0
3: 19
4: 223
Right 1147190191 17:38733925-38733947 CAAGAGATACAGATGTCCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 187
1147190185_1147190191 26 Left 1147190185 17:38733876-38733898 CCCCAAAGAACTACAGGCTCCAG 0: 1
1: 0
2: 0
3: 15
4: 182
Right 1147190191 17:38733925-38733947 CAAGAGATACAGATGTCCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 187
1147190188_1147190191 7 Left 1147190188 17:38733895-38733917 CCAGAAAGTATGCAGCATTTATT 0: 1
1: 0
2: 6
3: 27
4: 300
Right 1147190191 17:38733925-38733947 CAAGAGATACAGATGTCCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 187
1147190186_1147190191 25 Left 1147190186 17:38733877-38733899 CCCAAAGAACTACAGGCTCCAGA 0: 1
1: 0
2: 0
3: 21
4: 170
Right 1147190191 17:38733925-38733947 CAAGAGATACAGATGTCCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147190191 Original CRISPR CAAGAGATACAGATGTCCCA GGG Exonic