ID: 1147192128

View in Genome Browser
Species Human (GRCh38)
Location 17:38744098-38744120
Sequence GGCTTCTGCTTGGGGAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 294}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147192128_1147192136 15 Left 1147192128 17:38744098-38744120 CCACTTTTCCCCAAGCAGAAGCC 0: 1
1: 0
2: 0
3: 18
4: 294
Right 1147192136 17:38744136-38744158 TTCTGCCATTGTCTTTGCAAGGG 0: 1
1: 0
2: 0
3: 35
4: 336
1147192128_1147192135 14 Left 1147192128 17:38744098-38744120 CCACTTTTCCCCAAGCAGAAGCC 0: 1
1: 0
2: 0
3: 18
4: 294
Right 1147192135 17:38744135-38744157 CTTCTGCCATTGTCTTTGCAAGG 0: 1
1: 0
2: 3
3: 40
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147192128 Original CRISPR GGCTTCTGCTTGGGGAAAAG TGG (reversed) Intronic
900131789 1:1090325-1090347 GGAATCTGCTTGGGACAAAGCGG + Intronic
900480832 1:2898330-2898352 GGTTTCTGCTTGGGCACATGGGG + Intergenic
901079208 1:6574432-6574454 GGAATCTGCCTGGGGACAAGGGG - Intronic
905324978 1:37145505-37145527 GGCTTGTCCTTGGGGAGAAAGGG - Intergenic
906849006 1:49227507-49227529 GGCTCTTACTTGGGGAAAAAAGG - Intronic
907194166 1:52672935-52672957 GACCCCTGCTTGGGGAGAAGTGG - Intergenic
911261799 1:95695120-95695142 GGCTTCTCCTGGGAGAAAACAGG - Intergenic
912050786 1:105525833-105525855 GTCTTCTGCATGGGGCAAATAGG + Intergenic
912694118 1:111828100-111828122 TGCTGCTGCTTGGGGCAGAGCGG - Intronic
916492569 1:165314916-165314938 GGCTTCTGCCTGGGATGAAGTGG - Intronic
916722202 1:167492869-167492891 GGCGTCTGCTAGGGGCAGAGAGG + Intronic
918892580 1:190294959-190294981 TCCTTCTGCTTGAGGGAAAGTGG - Intronic
922082612 1:222311566-222311588 GGCTTCAGCTTGGGGAATTAAGG + Intergenic
923577044 1:235168886-235168908 GGCTCCTGCGTGGGTCAAAGAGG + Intronic
923752699 1:236761001-236761023 GGCTTCACCCTGGGGCAAAGTGG - Exonic
924278296 1:242410135-242410157 GGCTACTTCTTGCTGAAAAGGGG + Intronic
1065765900 10:29029028-29029050 AGCCTGGGCTTGGGGAAAAGTGG - Intergenic
1065963485 10:30752895-30752917 GGCTTCTGCTAAGGAAAAAATGG + Intergenic
1068204777 10:53836067-53836089 GTCTACTGCTTCTGGAAAAGAGG + Intronic
1069871750 10:71537181-71537203 CTCTTCTGCTTGGGGAGTAGGGG - Intronic
1070130593 10:73653103-73653125 GGATCCTGGCTGGGGAAAAGGGG + Intronic
1071355251 10:84787132-84787154 TATTTCTGCTAGGGGAAAAGTGG + Intergenic
1071439538 10:85678197-85678219 GGGTTCTGCTGGGAGGAAAGGGG + Intronic
1071498616 10:86188241-86188263 GCCTTGTGCTAGGGGAAAAGTGG - Intronic
1072492380 10:95920588-95920610 ACCTTCTGCTTGAGGAAAGGAGG - Intronic
1075016278 10:118912106-118912128 AGCCTCTGCTTGGAGAAAAGTGG - Intergenic
1075759705 10:124846632-124846654 GAGGTGTGCTTGGGGAAAAGGGG - Intergenic
1076025224 10:127106669-127106691 GGCTTCTGCTTCTGTAATAGAGG + Intronic
1077072639 11:683181-683203 GGCTTCCGCTTGGGGAGTGGTGG - Intronic
1077422250 11:2458168-2458190 ATCTTCAGCTTGGGGAGAAGGGG - Intronic
1077603966 11:3594512-3594534 AGCTTCAGCTTGGGTCAAAGTGG + Intergenic
1078329225 11:10405750-10405772 TGCTGCTGCTTGGGGATAAAAGG + Intronic
1078355148 11:10627443-10627465 GGCTGCTGGTTGGAGACAAGGGG - Intronic
1078667186 11:13335493-13335515 GGCTTTTACTGGGGGAAGAGGGG + Intronic
1079237033 11:18698633-18698655 GGCTGCTGCTCGGAGAAAGGAGG - Intronic
1080193846 11:29583957-29583979 GGCTTTTTCTTGTGGGAAAGTGG - Intergenic
1080742674 11:35080742-35080764 GGCTGCTGCATGGAGAATAGAGG - Intergenic
1080798574 11:35588622-35588644 CCTTTCTGCTTGGGGAGAAGAGG - Intergenic
1080925967 11:36756155-36756177 GGTGTCTTCTTGGTGAAAAGCGG - Intergenic
1081646101 11:44791673-44791695 GGCATCTGCTCTGGGAAGAGGGG + Intronic
1081777387 11:45684903-45684925 CGAGTCTCCTTGGGGAAAAGCGG + Intergenic
1083741972 11:64716010-64716032 GGCTACCGCTTCTGGAAAAGAGG - Intronic
1084419358 11:69052677-69052699 GGCTCCTGCTTGGGGGCATGAGG - Intronic
1088932835 11:114369370-114369392 AGCTTCTCCTTGGGGAGCAGGGG - Intergenic
1088944465 11:114495558-114495580 TGCTTCTGCTTGAGGAAAGAAGG - Intergenic
1089328775 11:117675695-117675717 GGCCTTTGCTGGGGGGAAAGGGG - Intronic
1091664298 12:2407956-2407978 GGCCTTTGCTGGGGGAAGAGTGG - Intronic
1092130915 12:6112621-6112643 GGCTTCTTCTTGGCAAGAAGAGG + Intronic
1093166808 12:15813646-15813668 GGCTTCTTCTTAGGAAATAGAGG - Intronic
1094556635 12:31506815-31506837 GCCTTCTTCTTGTGGAAAAAGGG + Intronic
1095796990 12:46230585-46230607 GTCTTCTCCATGGGGAAAATAGG + Intronic
1096028635 12:48390796-48390818 GGCTTCTTCCTGAGGAAAGGGGG - Intergenic
1096657089 12:53098447-53098469 AGCTTCCACTTGGAGAAAAGGGG + Intronic
1096752118 12:53767133-53767155 GGCTTCAGCTGGGGAAGAAGAGG + Intergenic
1096792025 12:54051448-54051470 GGCTACTGCTTGGTTAATAGTGG - Intronic
1097930389 12:65177470-65177492 GGATCTTGTTTGGGGAAAAGTGG + Intronic
1099082409 12:78202084-78202106 GGCTTCTGCTTGGGGTAGATTGG - Intronic
1099578193 12:84406328-84406350 GGCTTCTGCTGCTGGAAAATTGG - Intergenic
1100325918 12:93539867-93539889 GTCTTATGCTTGGGCAAAGGTGG + Intergenic
1100541085 12:95558044-95558066 AGCTTCTGCCTTGGGAACAGTGG + Intergenic
1102910470 12:116709672-116709694 GGCTGGTGCTGGGGGAAATGTGG + Intergenic
1102941844 12:116949600-116949622 CGATTCTGCGTGAGGAAAAGGGG - Exonic
1103191928 12:119008880-119008902 GGCATCTGCTTGGTGAGAGGAGG + Intronic
1103696677 12:122821117-122821139 GGTGTCTGGGTGGGGAAAAGAGG - Intronic
1104534900 12:129609713-129609735 GGCATCTGACTGGGGAAGAGGGG - Intronic
1106112551 13:26789664-26789686 GGCTTTTCCTTGGGGACCAGAGG + Intergenic
1108227688 13:48305570-48305592 GGCCACTGCTTGGAAAAAAGAGG + Intronic
1109610900 13:64763285-64763307 GGTTTCTACTTTGGGAAAAAAGG + Intergenic
1110234385 13:73201224-73201246 TGGTTCTGCTTGAGTAAAAGGGG - Intergenic
1110965957 13:81697416-81697438 GGCTGGTGGGTGGGGAAAAGTGG + Intergenic
1113284634 13:108832468-108832490 TTCTTCTGCTTGTGAAAAAGAGG - Intronic
1113442029 13:110336638-110336660 GGGTTTTGCTTGGGGAATATAGG + Intronic
1114056919 14:18978252-18978274 GGCTGCTGCTTTGGGAACAATGG - Intronic
1114105627 14:19423494-19423516 GGCTGCTGCTTTGGGAACAATGG + Intronic
1114127349 14:19744557-19744579 GGGTCCTGCTTGGAGAGAAGAGG - Intronic
1114358844 14:21947100-21947122 TGCTACTGCTTGATGAAAAGGGG + Intergenic
1114549999 14:23527174-23527196 GACTTCTGGTTTGGGGAAAGAGG - Intronic
1114559968 14:23582515-23582537 CCCTTTTGCTTGGAGAAAAGGGG - Intergenic
1115661068 14:35494675-35494697 CTCTTCTGTTTGGGGAAAAGGGG + Intergenic
1115803765 14:37027528-37027550 TGCTTCAGCTCAGGGAAAAGAGG - Intronic
1116435617 14:44892547-44892569 GGCTTCACATTGGGAAAAAGTGG + Intergenic
1118105947 14:62659760-62659782 CCCTTCTGCTTTGGGAAAGGAGG + Intergenic
1118596676 14:67440982-67441004 GCCCTCTGATTGGAGAAAAGTGG - Intergenic
1119575332 14:75715964-75715986 AGCTTCTGCTTCAGAAAAAGAGG - Intronic
1122756369 14:103983663-103983685 GGCCTCAGCTTGGGGAAAGCTGG + Intronic
1123115241 14:105891480-105891502 GGCTCCTCCTTGGGGTAGAGGGG + Intergenic
1124932885 15:34139608-34139630 TGCTTCTACTTGGGACAAAGTGG - Intergenic
1124963637 15:34417041-34417063 GGGTTCTGCTTAAGGAAATGTGG + Intronic
1124980256 15:34563267-34563289 GGGTTCTGCTTAAGGAAATGTGG + Intronic
1127849909 15:62903289-62903311 GGCCTCTCCTTGGGAAAGAGGGG - Intergenic
1127995828 15:64152563-64152585 GGCTTCTGGCTGGGGCGAAGAGG + Intronic
1129141578 15:73602968-73602990 GCCTTCTGCTTTGGAAAAATAGG + Intronic
1130069463 15:80634311-80634333 AGCTTCAGCTTGGAGAAAATTGG + Intergenic
1132522943 16:399762-399784 GGCTGCTGCTGGGGGCAAGGAGG + Intronic
1133011280 16:2913223-2913245 GGCTTTGGCTTGGGCTAAAGAGG + Intronic
1133550178 16:6846989-6847011 GTGTTCTTGTTGGGGAAAAGGGG + Intronic
1133631812 16:7629158-7629180 TGCTTCTCCCTGGGAAAAAGTGG + Intronic
1134659286 16:15971609-15971631 GGCTACTTCCTGGTGAAAAGGGG + Intronic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1137245398 16:46699251-46699273 GGCTTTTGTTAGGGGAGAAGTGG - Intergenic
1137246860 16:46712768-46712790 GGCTTGTACCTGGGGAGAAGGGG + Exonic
1137624377 16:49898497-49898519 GGCTGCTGCTTGGGTAGAAGAGG - Intergenic
1138409913 16:56830785-56830807 AGTTTCTGCTTGGGGGAAAAAGG + Intronic
1139584433 16:67892972-67892994 AGTTTCTGGTTGGGGGAAAGGGG - Intergenic
1143558387 17:7676618-7676640 GGCTGCTGCAAGAGGAAAAGTGG + Exonic
1145006557 17:19341876-19341898 GGCTGATGGTTGGCGAAAAGGGG + Intronic
1145713731 17:26999315-26999337 GGCTTCTGCTTGTGGCAGAAGGG - Intergenic
1146543045 17:33714034-33714056 GGCTTCTTGGTGGGGAGAAGTGG + Intronic
1147192128 17:38744098-38744120 GGCTTCTGCTTGGGGAAAAGTGG - Intronic
1147867381 17:43562124-43562146 GGGCTCTGCTTGGGGAAGTGGGG + Intronic
1148685497 17:49498290-49498312 GGCCTCTGCGTGTGGAGAAGGGG - Intronic
1148996162 17:51711826-51711848 GGCTTCTGCTGGGGGTGAGGTGG + Intronic
1149595693 17:57863281-57863303 GGCATCTGGTAGGGGAAAAAAGG + Exonic
1149609982 17:57953146-57953168 AGCTTGTTCTTGGGGAAATGGGG - Intronic
1151415196 17:73957433-73957455 GTGTGCTGCTTGGGGAAGAGTGG + Intergenic
1152625535 17:81386525-81386547 GGGGGCTGCTTGGGGAAATGAGG - Intergenic
1152808595 17:82370885-82370907 GGGTTCTGCTGGGGGAGAGGAGG - Intergenic
1152826529 17:82469445-82469467 GTCTTCTGCTTTGGTCAAAGGGG + Intronic
1153025832 18:671569-671591 GGCTTCAGTTTAGGGAGAAGTGG + Intronic
1153350650 18:4077637-4077659 TGCTTCTGCTTGTGGCAGAGGGG - Intronic
1154424673 18:14262782-14262804 GGCTTCTGCTTGGAGACAGTGGG + Intergenic
1156214709 18:34984604-34984626 TGCTTCTGATGGGGGAAAGGAGG + Intronic
1159596288 18:70385595-70385617 GACTTATGCTTGGGGGAAATAGG - Intergenic
1159799375 18:72878673-72878695 GGCTTTTGCCTGTGGAAAACTGG + Intergenic
1159825157 18:73199214-73199236 GGCTTCTGCAAAGGGAAAAATGG - Intronic
1162145298 19:8609506-8609528 GGCCTCTGCCTGGGGAGACGCGG - Intronic
1162439689 19:10685324-10685346 GGCTTTTGCTTGGGCAGAGGTGG + Intronic
1163049432 19:14670963-14670985 GGCATCTGCCGGGGGAAAAAAGG - Intronic
1163429148 19:17256561-17256583 GGCTTCTGCACGGGGCACAGTGG + Exonic
1165432497 19:35780739-35780761 GGCATCTGCTAGGCGAAAAATGG - Exonic
1165444647 19:35850207-35850229 AGCTTCTTCATGGGGAACAGAGG - Intronic
1166096491 19:40542493-40542515 GGCTCCTGCTTGGAGAGATGGGG + Intronic
1166975568 19:46603232-46603254 AGGTTCTGCTGGGGGAAAATGGG - Intronic
1168468860 19:56625078-56625100 GGGTTCCTCTTGGGGAAACGTGG - Exonic
1168680495 19:58312040-58312062 GGCAACTGCTAGAGGAAAAGAGG + Intronic
925325629 2:3019863-3019885 AGCATCTGCTTGGGGAGAATTGG - Intergenic
927812179 2:26186282-26186304 GGCTGCAGCTTGGGGAAGCGAGG - Exonic
928377281 2:30785943-30785965 GGATGCTGCTTAGAGAAAAGTGG - Intronic
928459388 2:31456638-31456660 GGTATTTGCTTGGGGAAAAAAGG - Intergenic
930056301 2:47254688-47254710 GGCTGCTGGGAGGGGAAAAGAGG - Intergenic
930167572 2:48218316-48218338 GGCTTAAGCTTGTGGGAAAGCGG + Intergenic
931167820 2:59768619-59768641 GGCTTCAGCCTGGGAAATAGAGG - Intergenic
933688098 2:85159118-85159140 GGCTCCAGCTTCAGGAAAAGGGG + Intronic
934297356 2:91753270-91753292 TGCTTCTCATTGGGGTAAAGAGG + Intergenic
936047889 2:109200975-109200997 GGCTGCTGCTGGGGACAAAGGGG + Intronic
936977661 2:118235603-118235625 TTTTGCTGCTTGGGGAAAAGTGG - Intergenic
938465478 2:131522137-131522159 GGCTTCTGCCTGGGGAGCAAGGG + Intergenic
941320171 2:164044877-164044899 GGCTGCTGCTGGTGGAAATGTGG + Intergenic
941473094 2:165914625-165914647 CCCTTCTGTTTGGGGAGAAGAGG + Intronic
941746485 2:169092334-169092356 AGCTGGTGCTTGAGGAAAAGAGG - Intronic
944581088 2:201133452-201133474 TGCTTGTGCTGGGGGAAAACAGG + Intronic
944851364 2:203722867-203722889 GGCTTCGGTTTGAGGAAATGAGG + Intronic
945037742 2:205718446-205718468 GGCTTCAGCTTGGAGAAATGGGG + Intronic
946237445 2:218332750-218332772 GGCTGCTGAGTGGAGAAAAGGGG - Intronic
946831069 2:223728511-223728533 GGCATCTACTGGGGGAAAAAAGG + Intergenic
946996590 2:225399673-225399695 GGCTGCTGCTTGGGGAGAGAGGG - Intergenic
948342920 2:237269730-237269752 GCATTCTGCCTGGGGAGAAGAGG + Intergenic
948484951 2:238274649-238274671 GGCTCCTCCTTCCGGAAAAGGGG + Intronic
1171504320 20:25621495-25621517 GCCTTGGGCTTGGGGAGAAGAGG - Intronic
1173489701 20:43469836-43469858 GGTTTCCGCTTGGAGAAGAGAGG - Intergenic
1173897012 20:46558893-46558915 TGCTTCTGCTTGGAACAAAGAGG + Exonic
1174103206 20:48143024-48143046 GGCTACTGCTTGGGGAAGGAGGG + Intergenic
1174105455 20:48159154-48159176 ATATTCTGCTTGGGGAAAACAGG + Intergenic
1175477612 20:59288120-59288142 TGGTTCTGGTTGGGGAATAGAGG - Intergenic
1175883817 20:62276711-62276733 TGCTTCTGCTTCTGGGAAAGGGG + Intronic
1176268407 20:64222698-64222720 GGGTTCAGGTTGGGGAGAAGAGG - Intronic
1176302318 21:5104525-5104547 GGCTCCTGCTGGGGGCAGAGAGG - Intergenic
1177146310 21:17410819-17410841 TCCTTCTGCTTCGGGCAAAGGGG - Intergenic
1179563052 21:42228881-42228903 GGCTTTTGGTTGGGGAAATATGG - Intronic
1179854709 21:44157398-44157420 GGCTCCTGCTGGGGGCAGAGAGG + Intergenic
1180475406 22:15700864-15700886 GGCTGCTGCTTTGGGAACAATGG - Intronic
1181137847 22:20781488-20781510 GGCTTCTGTTCAGGGAAAGGGGG + Intronic
1181383040 22:22522121-22522143 GGATTCTGCTTCTGGAAAAGAGG - Intergenic
1183320349 22:37161606-37161628 GGCTTCTGATTGGGGGAACCTGG - Intronic
1183456445 22:37925730-37925752 GGCTGCTGCTTGGGGGAAGTGGG - Exonic
1183781090 22:39999377-39999399 GCCTTGTGCTTTGGGAACAGAGG + Intronic
1183818646 22:40325596-40325618 AGCTTTTGCATGGGGAACAGTGG - Exonic
1184090371 22:42290089-42290111 GGCTGCTGCTTGGGGAGCGGGGG + Intronic
1184823570 22:46931664-46931686 GGCGTCTGTCTGGGGAGAAGAGG - Intronic
950443957 3:13025483-13025505 GGACCCTGCTTGGGGAAATGAGG + Intronic
950503158 3:13377124-13377146 GTCCCCAGCTTGGGGAAAAGGGG + Intronic
950783377 3:15411603-15411625 GGTTTCTGTTTGGGTAGAAGAGG - Intronic
952213986 3:31257232-31257254 AGCTTCTCCTTGGCCAAAAGTGG - Intergenic
954075992 3:48180887-48180909 GGCCTCAGCTTGGGTGAAAGAGG + Intronic
955420097 3:58727260-58727282 GCCTCCTGCCTGGGGAAAGGGGG + Intronic
956044426 3:65180251-65180273 GGTTTCCTCTTAGGGAAAAGGGG + Intergenic
958477881 3:94608405-94608427 GTCTTCTGCTAGGGAAACAGTGG - Intergenic
960289559 3:115867005-115867027 GGATGCTGCTAGGGGAAGAGGGG + Intronic
961003599 3:123390209-123390231 GGCTTTTTCTTGTGGAAAAATGG + Intronic
961781811 3:129324975-129324997 GTCCCCAGCTTGGGGAAAAGGGG + Intergenic
964304193 3:155324022-155324044 GGGATCTTCTTGGGGGAAAGGGG - Intergenic
967936344 3:194730928-194730950 GGCTACTTCTTGCTGAAAAGGGG + Intergenic
968197955 3:196725252-196725274 GGCTTCTGCTTCTGGTCAAGTGG + Intronic
968211065 3:196849215-196849237 GGCTGCTTCTTGCTGAAAAGGGG - Intergenic
968450418 4:673683-673705 GGCTGCTTCTTGGTGAAAACGGG - Intronic
968709329 4:2101722-2101744 GGCTGCTGCTTGTGGAACAAGGG + Intronic
969297482 4:6278444-6278466 GGCTTCTGCATGGGCAGGAGGGG - Intronic
969375988 4:6763507-6763529 GGGTTGTGCTTGTGGAAGAGAGG - Intergenic
970441548 4:16084193-16084215 GGACTCTGCGGGGGGAAAAGAGG - Intronic
970464371 4:16308035-16308057 GTCTTCTGCTTGGGGAAGCATGG - Intergenic
970743394 4:19265463-19265485 GGGTTCTGCTGGTGGAAAAGTGG - Intergenic
971954301 4:33396050-33396072 TCCTTCTGCTTGAGGAAAGGAGG + Intergenic
972166879 4:36297496-36297518 TGCTTCGGCTTGGGGGAAAAGGG - Intronic
972866939 4:43244365-43244387 GTCTTCTGCTTCTGGACAAGTGG + Intergenic
972909270 4:43794602-43794624 TGTTTATGCTTAGGGAAAAGTGG - Intergenic
973651093 4:52997639-52997661 GGCTTAGGCCTGGGGAAAACAGG + Intronic
973808474 4:54547913-54547935 GCTTTCTGATTGGGGAAAATTGG - Intergenic
976113446 4:81701450-81701472 GGCCTATGCTTAGGGAACAGGGG + Intronic
976548619 4:86367389-86367411 GTATTCTACTTGGGGAACAGTGG + Intronic
976676268 4:87707246-87707268 GGCCACAGCTTGGGGAAAGGGGG + Intergenic
977826699 4:101541351-101541373 AGCTTCTTCTTTGGAAAAAGAGG + Intronic
978681660 4:111388462-111388484 GGCTTCTGCTAGAGGATTAGAGG - Intergenic
980859835 4:138486054-138486076 CTCTTCTGCCTGGGGAAAATTGG - Intergenic
981504797 4:145487487-145487509 GGTTTCAGATTGGGGCAAAGAGG - Intronic
982688017 4:158515172-158515194 GGCTTCTGCTTCAAGACAAGGGG - Intronic
983212844 4:164976422-164976444 GGTGTATGCTTGGGGAAAGGAGG - Intronic
983636851 4:169906287-169906309 CCCTTCTGCTTGGGCAACAGAGG + Intergenic
984009061 4:174348470-174348492 GGTTTCTGTTTGAGGATAAGTGG - Intergenic
984125635 4:175806148-175806170 GGTTTTTGCTTGGGGGAAAATGG + Intronic
986649745 5:9951209-9951231 GGATATTGCATGGGGAAAAGTGG - Intergenic
987361936 5:17115293-17115315 AGCTTCTGTTTTGGGAAAACAGG + Intronic
990153017 5:52841928-52841950 GGCTCAGGCTTGGGGAAGAGAGG + Intronic
990277120 5:54209225-54209247 GGCTTCTGCTTTGGAAATTGAGG - Intronic
993032306 5:82719011-82719033 GGCTTATGAGTGTGGAAAAGGGG + Intergenic
993749466 5:91649249-91649271 GGCTTGTGCTGTGAGAAAAGTGG + Intergenic
993912834 5:93705037-93705059 GACATCTGCTTTGGGTAAAGAGG + Intronic
994744543 5:103662527-103662549 GGCTTCCTCTTGGTGAAAGGAGG - Intergenic
996172865 5:120316369-120316391 TGCTTCTGCTTGGTTAAAAGGGG + Intergenic
999081034 5:148843904-148843926 GGCTTTTACTTGGGCCAAAGTGG - Intergenic
999204788 5:149840228-149840250 GGCCTCTGCCTGGGGAAGAAGGG + Intronic
1000694206 5:164359725-164359747 TACTACTGCTTGGTGAAAAGAGG + Intergenic
1002156837 5:177288940-177288962 GACTTCTGCTTTGGGATTAGTGG + Intronic
1004821314 6:19371107-19371129 AGCTTCTCCTTGGGAAAAAAAGG + Intergenic
1005246125 6:23887385-23887407 GGCTGCTGCTGGGGCAGAAGGGG - Intergenic
1005400146 6:25423614-25423636 GACTGCTGCCTGGGGAAGAGCGG + Intronic
1005977849 6:30813883-30813905 GGCTTTTGCTTCGGGGAAAAAGG + Intergenic
1007410323 6:41657661-41657683 GGCTACGGCCTGGGGGAAAGCGG - Intergenic
1008257443 6:49321433-49321455 GGCTTCTGCAGGGTGAAATGAGG - Intergenic
1010176437 6:73033186-73033208 GCCCCCTGCTTGGGGAAAAGAGG - Intronic
1013967474 6:115972155-115972177 AGCTTCTGCTGGAGGATAAGAGG - Intronic
1014269496 6:119320914-119320936 AGCTTCAGCTTTGTGAAAAGGGG + Intronic
1015262211 6:131251146-131251168 GGCTTCTGCTAGAAGCAAAGCGG - Intronic
1015974300 6:138773724-138773746 GGCTTCCGCTTGGGGCATGGAGG + Exonic
1017563338 6:155657167-155657189 GGAATCAGCTTGGGGATAAGTGG - Intergenic
1017618121 6:156266631-156266653 GGATTCTGCTTTGGGAAAGAAGG - Intergenic
1018029930 6:159833928-159833950 GGGTTCTGCTTGGGCAGAATGGG - Intergenic
1019310250 7:356983-357005 GGCTGCTGCTGCGGGAACAGGGG + Intergenic
1019409929 7:901934-901956 ATCTCCTGCTGGGGGAAAAGGGG - Intronic
1019597569 7:1865255-1865277 GGCTCCTCCTTGGGGAAAGAAGG + Intronic
1021079550 7:16347793-16347815 AGCTTCTCCCTGTGGAAAAGAGG + Intronic
1023078726 7:36507957-36507979 GGCCTTTGCTTAGGGTAAAGGGG - Intergenic
1023300785 7:38768843-38768865 TGCTTATGCTGAGGGAAAAGAGG - Intronic
1023873851 7:44276468-44276490 GGCTTCTGGCTGGGGAAAGGGGG + Intronic
1026527096 7:71163502-71163524 GGCTCGTGATTAGGGAAAAGGGG - Intronic
1026528653 7:71177539-71177561 CCCTTCTGCCTGGGGAGAAGGGG + Intronic
1026683694 7:72490106-72490128 GGCTTCTCCTTGGCAAATAGAGG + Intergenic
1026865013 7:73818361-73818383 GGCTTCTGCTTGGGCAGTAAAGG - Intronic
1027430017 7:78102193-78102215 GGCTGGGGGTTGGGGAAAAGGGG + Intronic
1027483485 7:78728969-78728991 GGCTTCTGCTCACTGAAAAGGGG + Intronic
1028181542 7:87730467-87730489 CTCTTCTGCTTGAGGAAAAGGGG + Intronic
1028238393 7:88388432-88388454 TGCTTCCTCTTGAGGAAAAGAGG + Intergenic
1028318069 7:89428788-89428810 GTCTTCTGCTTGGGGAAGAAAGG + Intergenic
1028697243 7:93728814-93728836 AGGTTCTGTTTGGGGATAAGGGG - Intronic
1029802904 7:102968585-102968607 GGCTTCTACTTCTGGAAATGTGG + Intronic
1030367228 7:108659089-108659111 GCCTTCCATTTGGGGAAAAGAGG - Intergenic
1033135129 7:138777678-138777700 GGCTTCTGCATCTGGAAAAAGGG + Intronic
1035626977 8:1077788-1077810 AGCATCTTCTTGTGGAAAAGGGG - Intergenic
1036261185 8:7241508-7241530 AGCTTCAGGTTGGGGCAAAGTGG + Intergenic
1036313224 8:7700052-7700074 AGCTTCAGGTTGGGGCAAAGTGG + Intergenic
1036708419 8:11061712-11061734 GGCTTCTGCTCCTGGAAGAGGGG - Intronic
1036815774 8:11902026-11902048 GGCTTCAGCATGGGAGAAAGAGG - Intergenic
1040065680 8:43141664-43141686 AGCTTCTGCTTGGAGAGGAGGGG - Intronic
1042689243 8:71479024-71479046 GGCTTTTGTTTGCAGAAAAGTGG - Intronic
1044437384 8:92180037-92180059 GGCTTCTCCTAAGGGAGAAGTGG - Intergenic
1044801288 8:95959386-95959408 AGCTTTGGCATGGGGAAAAGAGG + Intergenic
1045571776 8:103375061-103375083 TGCTTCTCCTTGGGGAAGAGGGG + Intronic
1045636741 8:104199921-104199943 GGGTCCTACTTGGGGAAAGGAGG + Intronic
1051553818 9:18360174-18360196 GGCAGCTGCTTGGGGATCAGAGG - Intergenic
1052833743 9:33235311-33235333 GGTGCCTGCTTTGGGAAAAGAGG - Intronic
1053199087 9:36140609-36140631 GGCTGATGCTTGGGGGAAGGGGG + Intronic
1053204377 9:36173804-36173826 TCCTTCTGCTTGGGGACAGGAGG + Intergenic
1053430194 9:38037138-38037160 GGATTCTTCTCCGGGAAAAGAGG - Intronic
1053479435 9:38405068-38405090 GGTTTATGCATGGAGAAAAGAGG + Intergenic
1056073034 9:83008417-83008439 GGATACGGCTTGGGGAAAGGTGG - Intronic
1056477769 9:86969360-86969382 GGATGCTGCTTGAGGCAAAGAGG - Intergenic
1059268604 9:113059094-113059116 GGCTTCTTTCTTGGGAAAAGAGG - Intergenic
1059765619 9:117381215-117381237 GGTTACAGCATGGGGAAAAGAGG + Intronic
1059839022 9:118191575-118191597 TCCTTCTGCTTGGGGAGAGGAGG + Intergenic
1060964222 9:127703635-127703657 GGTTTTTGCTTTGGGGAAAGAGG - Intronic
1061664287 9:132151489-132151511 AGCTTCTGCTTCTGGAAGAGGGG - Intergenic
1062037212 9:134387812-134387834 GGCACGGGCTTGGGGAAAAGGGG - Intronic
1062434876 9:136542510-136542532 GGCTTCTGCAGAGGGAGAAGGGG + Intronic
1062711077 9:137975531-137975553 GGCCTCTCCTTGGGGTAAATGGG + Intronic
1186508979 X:10116417-10116439 GGATTCTGCTTCAGGAAAAAAGG + Exonic
1186928584 X:14361800-14361822 GGCTCCAGCTTGGGGAAGGGGGG - Intergenic
1188286130 X:28327460-28327482 TGCTTAGGCTTGGTGAAAAGTGG + Intergenic
1188435498 X:30153793-30153815 TGCTTCAGCTTGGGGAGAAGAGG + Intergenic
1192057136 X:67784620-67784642 GTCTTATCCTTGGGGAAATGAGG - Intergenic
1192088103 X:68121766-68121788 TCCTTCTGCTTGAGGAAAAGAGG + Intronic
1193353005 X:80483731-80483753 GGCTACTTCGTGGTGAAAAGGGG - Intergenic
1194131680 X:90089261-90089283 GGCCTGTGCTTTGGGAAAATGGG - Intergenic
1194387827 X:93278554-93278576 TCCTTCTGCTTGAGGAAAAGAGG + Intergenic
1194579430 X:95653623-95653645 GGCTTGTGCTGAGGAAAAAGAGG + Intergenic
1194858069 X:98958483-98958505 TGCTTCTGCTTGCATAAAAGTGG - Intergenic
1195089597 X:101445882-101445904 GGAATCTGCATGGGGAAAGGTGG - Intronic
1196771802 X:119301794-119301816 GACTTCTGCTTTTGGGAAAGTGG - Intergenic
1197112920 X:122797717-122797739 GCCTTCTGCTTGGGAAAAGCAGG + Intergenic
1198953598 X:142101541-142101563 GGCTTCATTTTGGGGAAAGGTGG - Intergenic
1199568785 X:149246502-149246524 GCCTTCTGCCTGAGAAAAAGAGG - Intergenic
1200118760 X:153780818-153780840 GGCTGCTGCTTGGGGACCAGGGG - Intronic
1200231289 X:154445011-154445033 GGCTCCTGCCTGGGGAACTGGGG + Intronic
1200322616 X:155205689-155205711 GGCTTTTGCTCTGGGAGAAGTGG - Intronic
1201426621 Y:13858502-13858524 TAGTTCTCCTTGGGGAAAAGAGG - Intergenic