ID: 1147192538

View in Genome Browser
Species Human (GRCh38)
Location 17:38746516-38746538
Sequence AGCTGAACTGCTTTTGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 1, 2: 2, 3: 13, 4: 158}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147192538_1147192540 -5 Left 1147192538 17:38746516-38746538 CCAGCAACAAAAGCAGTTCAGCT 0: 1
1: 1
2: 2
3: 13
4: 158
Right 1147192540 17:38746534-38746556 CAGCTTCCAAAGTCCGCTCTGGG 0: 1
1: 0
2: 0
3: 6
4: 113
1147192538_1147192546 11 Left 1147192538 17:38746516-38746538 CCAGCAACAAAAGCAGTTCAGCT 0: 1
1: 1
2: 2
3: 13
4: 158
Right 1147192546 17:38746550-38746572 CTCTGGGGACCAGAGGCTGGAGG 0: 1
1: 1
2: 8
3: 103
4: 1727
1147192538_1147192549 21 Left 1147192538 17:38746516-38746538 CCAGCAACAAAAGCAGTTCAGCT 0: 1
1: 1
2: 2
3: 13
4: 158
Right 1147192549 17:38746560-38746582 CAGAGGCTGGAGGGCTGCAGTGG 0: 1
1: 0
2: 7
3: 156
4: 1204
1147192538_1147192545 8 Left 1147192538 17:38746516-38746538 CCAGCAACAAAAGCAGTTCAGCT 0: 1
1: 1
2: 2
3: 13
4: 158
Right 1147192545 17:38746547-38746569 CCGCTCTGGGGACCAGAGGCTGG 0: 1
1: 0
2: 0
3: 20
4: 329
1147192538_1147192541 -4 Left 1147192538 17:38746516-38746538 CCAGCAACAAAAGCAGTTCAGCT 0: 1
1: 1
2: 2
3: 13
4: 158
Right 1147192541 17:38746535-38746557 AGCTTCCAAAGTCCGCTCTGGGG 0: 1
1: 0
2: 0
3: 13
4: 128
1147192538_1147192539 -6 Left 1147192538 17:38746516-38746538 CCAGCAACAAAAGCAGTTCAGCT 0: 1
1: 1
2: 2
3: 13
4: 158
Right 1147192539 17:38746533-38746555 TCAGCTTCCAAAGTCCGCTCTGG 0: 1
1: 0
2: 0
3: 1
4: 80
1147192538_1147192543 4 Left 1147192538 17:38746516-38746538 CCAGCAACAAAAGCAGTTCAGCT 0: 1
1: 1
2: 2
3: 13
4: 158
Right 1147192543 17:38746543-38746565 AAGTCCGCTCTGGGGACCAGAGG 0: 1
1: 0
2: 0
3: 15
4: 118
1147192538_1147192550 22 Left 1147192538 17:38746516-38746538 CCAGCAACAAAAGCAGTTCAGCT 0: 1
1: 1
2: 2
3: 13
4: 158
Right 1147192550 17:38746561-38746583 AGAGGCTGGAGGGCTGCAGTGGG 0: 1
1: 1
2: 4
3: 72
4: 620
1147192538_1147192547 12 Left 1147192538 17:38746516-38746538 CCAGCAACAAAAGCAGTTCAGCT 0: 1
1: 1
2: 2
3: 13
4: 158
Right 1147192547 17:38746551-38746573 TCTGGGGACCAGAGGCTGGAGGG 0: 1
1: 0
2: 1
3: 66
4: 561

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147192538 Original CRISPR AGCTGAACTGCTTTTGTTGC TGG (reversed) Intronic
900482613 1:2906492-2906514 CGCTGAGCTGCTTTTCCTGCCGG + Intergenic
901725324 1:11237467-11237489 AGCTCTCCTGCTTTTCTTGCTGG - Intronic
905784268 1:40740727-40740749 AGCTTATCAGCTTTTGGTGCTGG + Intronic
906923656 1:50091284-50091306 AGTGGATCTGCTTTTGATGCTGG + Intronic
909763210 1:79320478-79320500 AGCTTATGTGCTCTTGTTGCCGG + Intergenic
909840259 1:80311995-80312017 AGCTTAAAGGGTTTTGTTGCAGG - Intergenic
911241141 1:95468475-95468497 AGGTGAAGTGCATTTCTTGCAGG + Intergenic
911603757 1:99876762-99876784 AGATGAACTTCTTTTTTTGTTGG - Intronic
911615269 1:100004008-100004030 AGGTGAACTGCATTTCTTGTAGG + Intronic
914403842 1:147350018-147350040 AGCTCAACTACTTCTTTTGCTGG - Intergenic
915874996 1:159603062-159603084 AGCTTAGCTTCCTTTGTTGCTGG + Intergenic
917443772 1:175089412-175089434 AGCTGACCTGCTTCTGAGGCTGG - Intronic
921818025 1:219586207-219586229 AGCTGAACTGCCTGTGCTTCAGG + Intergenic
922996472 1:229966244-229966266 AGCTGGGCTGCATTTGTTTCTGG - Intergenic
924562347 1:245167570-245167592 AGCTCGACAGCTTTTGGTGCTGG - Intronic
1063516445 10:6700777-6700799 AGCTGAACTTCTTTGCTTCCTGG + Intergenic
1064180868 10:13113401-13113423 AGCAGAACTGCTCTGGTTGTAGG + Intronic
1064565736 10:16637073-16637095 ATCTGTAATGCTTTGGTTGCAGG - Intronic
1065928674 10:30459124-30459146 GGCTGAACTGCATTCGTTGCAGG + Intronic
1067257852 10:44661638-44661660 AGCTGCTTTGCTTTTGTTGCCGG - Intergenic
1068517835 10:58046013-58046035 ATCTGAACTTCTTTTTGTGCTGG + Intergenic
1069650164 10:70041368-70041390 AACTGAGCTTCCTTTGTTGCGGG + Intergenic
1070201724 10:74213104-74213126 GGCTGGACTCCTTTTGTTTCTGG + Intronic
1070563599 10:77586864-77586886 ACCTGATCTGTTTTTATTGCTGG + Intronic
1071689224 10:87797881-87797903 AACTGAACTGTTGTTTTTGCAGG + Intronic
1073763417 10:106655582-106655604 AGCAGAACTCCTGTTATTGCAGG - Intronic
1075350882 10:121724044-121724066 AGATGAAATTCGTTTGTTGCAGG + Intergenic
1078864057 11:15280389-15280411 AGGTGAAATGCTTTTATTCCTGG + Intergenic
1080241720 11:30134440-30134462 AATTGAACTGATTTTGTGGCTGG + Intergenic
1082836912 11:57657747-57657769 TGCGGAACTGCGTTTGTTTCCGG + Exonic
1085612214 11:77961220-77961242 TGCTGCAATGCTTTTGTTTCTGG - Intronic
1085643737 11:78209484-78209506 AGCTGGACTGCTTGAGTTTCTGG - Exonic
1087584417 11:100100201-100100223 ATCTGAAGTGCTTTTGTTTGAGG + Intronic
1092333688 12:7608801-7608823 TGCTGCACTGCTGTTGTTGCTGG + Intergenic
1095131273 12:38545809-38545831 ATCTGTTCTGCTTTTGTTGGAGG + Intergenic
1096379377 12:51142811-51142833 AGCTGAACTGTCTTGGTTGAAGG - Intronic
1098577584 12:72060699-72060721 ACCTGAAATGCTTTCGCTGCAGG + Intronic
1100272548 12:93040104-93040126 AGCTGAAGTGCTTTCTTTGTTGG + Intergenic
1102639888 12:114357598-114357620 ACATGAACAGCTCTTGTTGCAGG + Intronic
1104874234 12:132021984-132022006 ACCTCAACTCCTTTTGTTGTTGG + Intronic
1105592095 13:21801833-21801855 AGCTGCACTACTTTAGTTGAAGG + Intergenic
1105774307 13:23642809-23642831 ACCTGACCTGATTTTATTGCTGG - Intronic
1105792909 13:23820261-23820283 ATCTGACCTGCTTTTATTGTTGG - Intronic
1106343801 13:28856572-28856594 AGCACCACTGCTGTTGTTGCTGG - Intronic
1107969886 13:45631214-45631236 AGTTGAAATGCTCTTTTTGCTGG + Intergenic
1108379831 13:49845173-49845195 ATCAAAACTGCTTTTTTTGCTGG + Intergenic
1108911912 13:55564494-55564516 ATCTGGGCTGCCTTTGTTGCTGG + Intergenic
1110753303 13:79141375-79141397 TGCTAAACTGCCTCTGTTGCTGG + Intergenic
1111547789 13:89766090-89766112 AATTGAACTGTTATTGTTGCAGG - Intergenic
1114694681 14:24615455-24615477 AGCTTTAGTGCTTTTGTTTCCGG + Intergenic
1117102177 14:52361021-52361043 AGCTGAACTCCATTTGTAGAGGG + Intergenic
1121830995 14:97052475-97052497 TGCTGAGCTGTTTTTGTTCCAGG - Intergenic
1122615788 14:103016829-103016851 AGCTGAACTGCTGCTGCTTCCGG - Intronic
1124081148 15:26498809-26498831 AGGTGAATTGCATTTATTGCAGG + Intergenic
1125421006 15:39503912-39503934 AGATGATCTGCCTTTATTGCAGG - Intergenic
1126525864 15:49653401-49653423 AGCTGAACTGCATTCCTTTCTGG - Exonic
1126670500 15:51111313-51111335 AGCAGAGCCGTTTTTGTTGCTGG - Intergenic
1127893369 15:63274504-63274526 AGCAGCACTGGTTTTGTTGATGG - Intergenic
1128925729 15:71653675-71653697 AGCAGAACTGCTTTGGTTGAAGG - Intronic
1130999968 15:88932128-88932150 AGGTGAACTGCTCTTGTTGGGGG + Intergenic
1133516053 16:6510320-6510342 ATTTGAACTGCTTTTGTTCGTGG + Intronic
1136545045 16:30949856-30949878 AGCTGACCTGCCTTTGAAGCTGG - Intronic
1138078172 16:54063248-54063270 TGCTGAACTGCTGATGTTGGTGG + Intronic
1143329782 17:6125058-6125080 AGCTGAATTGCTGCTGTTGGAGG + Intergenic
1144379484 17:14680054-14680076 AGCTCATTTGCATTTGTTGCAGG - Intergenic
1146148925 17:30449679-30449701 AACTGAACTGCTTTTGGCTCTGG + Exonic
1147192538 17:38746516-38746538 AGCTGAACTGCTTTTGTTGCTGG - Intronic
1148049344 17:44761457-44761479 AGTTGAACTGCTTGGGTTGGGGG + Intronic
1151930553 17:77229164-77229186 AGCTGAACTGCTTCTAGTCCAGG + Intergenic
1154964370 18:21341923-21341945 AGCTGAACTGCTTTTGTTGGTGG + Intronic
1156005956 18:32441633-32441655 AGTCGAGCTGCTTTTGTTTCTGG - Intronic
1156919541 18:42504178-42504200 AACTCTACTGTTTTTGTTGCAGG + Intergenic
1157473650 18:48008192-48008214 AGCACAGCTGCTTTTGTTTCGGG + Intergenic
1157977657 18:52343818-52343840 ATCTGATCTGCTTTGGTTGGGGG - Intronic
1158669700 18:59463728-59463750 AGCAGTATTGCGTTTGTTGCTGG + Intronic
1160017571 18:75156408-75156430 ATCTGAAATGTTTTTGTTCCCGG + Intergenic
1164666064 19:30038033-30038055 TTCTGAACTGCTGATGTTGCAGG - Intergenic
1168516818 19:57016146-57016168 ACATAAACTGCTTCTGTTGCTGG + Intergenic
925534019 2:4896850-4896872 AGCTGAACTCTTTTTGTTGTTGG - Intergenic
927509001 2:23632625-23632647 AGCAGAAGTGCATTTGTTGCGGG - Intronic
928145846 2:28774867-28774889 AGCAGAACTGCTTTTATTATGGG - Intronic
929167771 2:38900926-38900948 AGCTGAACTGTTATTGATCCTGG - Intronic
929702443 2:44175577-44175599 AGCTGAACTCCTTATGTGGCTGG + Intronic
929945343 2:46367358-46367380 AGATAAACTGCTTCTGTTCCTGG - Intronic
930626422 2:53703290-53703312 ACAAAAACTGCTTTTGTTGCAGG + Intronic
935042288 2:99444204-99444226 AGCTGTACTTCTTTTGGTGGGGG - Intronic
937099498 2:119257834-119257856 ATCTGTAATGCTTTTGTTACCGG + Intronic
938059428 2:128240463-128240485 AGCTGATGTGCTTGTGTGGCTGG + Intronic
939106038 2:137950005-137950027 AGTTGATCTGCTCTGGTTGCAGG + Intergenic
942818891 2:180087047-180087069 TGTTTACCTGCTTTTGTTGCAGG + Intergenic
943615330 2:190085773-190085795 AAATGATCAGCTTTTGTTGCTGG + Intronic
945334405 2:208574745-208574767 AGGTGAACTGTGTTTCTTGCAGG - Intronic
946146668 2:217736170-217736192 AGCCAAACTGCTTCTGGTGCGGG + Intronic
946433173 2:219636198-219636220 GGCTGCTCTGCTTTTGTTGGGGG + Intronic
946816238 2:223581660-223581682 AGAAGAACTGCTTTCGTTACAGG - Intergenic
947491735 2:230601758-230601780 AGTTGAGCTGCTTTTTCTGCTGG + Intergenic
1169379184 20:5092139-5092161 TACTGAACTTCTTTTATTGCTGG + Intronic
1170798633 20:19571716-19571738 AGCTGAAATAGTTTTCTTGCAGG - Intronic
1170899482 20:20447165-20447187 AGCTGACCTCCTTCTGGTGCTGG - Intronic
1172935496 20:38617153-38617175 AGCTGACCTGGTTTGGCTGCTGG + Intronic
1173533956 20:43794593-43794615 ACCTTAGCTGCTTTTGTTCCTGG - Intergenic
1178001958 21:28171004-28171026 AGCTGAGATTCTTTTGTAGCAGG - Intergenic
1182107726 22:27701179-27701201 AGCTGACCTGGTCTTGCTGCTGG - Intergenic
1182252748 22:29014432-29014454 TGCTGAACTGCTCTTGGTTCAGG - Intronic
1182416845 22:30226788-30226810 AACTGAACTGATTTTGTCCCTGG - Intergenic
1183075273 22:35422871-35422893 AGCAGGACTCCTTTTGTTGCTGG - Intronic
1183957608 22:41391012-41391034 ACCTGAGCTGCTTGTCTTGCAGG + Intronic
950061816 3:10078107-10078129 CCCTGAGCTGCTTTTCTTGCTGG + Exonic
950143265 3:10629768-10629790 AGCTGAACTGCTTACTTGGCAGG - Intronic
950919021 3:16674949-16674971 AGCTGAACAGCTTGTATTTCTGG - Intergenic
956799667 3:72745765-72745787 AATAGAACTGCTTTTATTGCTGG - Intergenic
957966364 3:87326124-87326146 AGGTGAAGTGTTTTTCTTGCAGG - Intergenic
958786739 3:98604630-98604652 AGCAGAGCTGCTTTTGTTGCAGG + Intergenic
964598827 3:158471861-158471883 AGCTGTAGTGCTTCTGATGCTGG + Intronic
964696208 3:159510788-159510810 TGCTGAACAGCTAATGTTGCTGG + Intronic
964782266 3:160353315-160353337 ACCGGAACTGCTCTGGTTGCAGG + Intronic
965074539 3:163959705-163959727 AGCTGAACTGCTGTTAGTGGTGG - Intergenic
965635192 3:170773575-170773597 ACCTCAAATGCTTTTGTGGCAGG + Intronic
970639157 4:18044479-18044501 AGCTGAGCTGCCTTTCTTTCTGG - Intergenic
971322104 4:25614003-25614025 ATCAAAACTGCTTTTGCTGCAGG - Intergenic
975026978 4:69561583-69561605 AGCTGAAGTGTTTTTCTTGCAGG - Intergenic
975048514 4:69831144-69831166 AGACCAACTGCTTTTGCTGCTGG - Intronic
976219120 4:82741875-82741897 AGGTGAAGAGCTTTTGTTGGGGG + Intronic
978404423 4:108364221-108364243 AACTGAGCTGCTTTTGGTGGTGG + Intergenic
979119480 4:116878944-116878966 AAATGAACTGCTTTTGTGGATGG + Intergenic
979719504 4:123882433-123882455 AGCTGAGCTGCATTTTTTTCTGG - Intergenic
981707661 4:147678647-147678669 AGCTGACCTGCTTTTCTTCTGGG + Intronic
983437525 4:167733911-167733933 AGCTAAGCTGCTTTTTTTGTGGG - Intergenic
987507764 5:18795175-18795197 AGCGGAACTGATTTTCTTCCAGG - Intergenic
990962767 5:61412228-61412250 AGTTGAACTGCTTTTTATGCAGG + Intronic
990981794 5:61607952-61607974 TGCTGAACTGCTTCTTGTGCAGG + Intergenic
991176318 5:63690871-63690893 AGCTTAACTACTGTTGTGGCAGG - Intergenic
993716676 5:91281645-91281667 AGTTTGACTGCTTTTCTTGCAGG + Intergenic
994286990 5:97981257-97981279 AGCTGAATAACTTTTATTGCTGG + Intergenic
995991918 5:118249788-118249810 AGCTAAAATGCATTTCTTGCAGG - Intergenic
998407262 5:141881066-141881088 AGCTGAGCTGCTATTGGTCCTGG + Intergenic
1002194253 5:177493693-177493715 AGCTGCCCTGCCTGTGTTGCTGG - Intronic
1003790577 6:9542601-9542623 AGCTGAATTGCATTTCTTGGTGG + Intergenic
1004263565 6:14129679-14129701 AGCTGAGCAGGTTTTCTTGCAGG + Intronic
1004821269 6:19370677-19370699 AGCTGATCTGATTTTTTTGAAGG + Intergenic
1009058577 6:58369903-58369925 TGATTAACTGCTTTTGATGCTGG - Intergenic
1011551636 6:88535871-88535893 GGCTGAACCTCTTTTGTTGTAGG - Intergenic
1011584163 6:88906512-88906534 AGCTGAAATGTTTTGATTGCAGG - Intronic
1014827153 6:126059459-126059481 CCATGAACTGCTTTTCTTGCTGG - Intergenic
1015598229 6:134886922-134886944 AGCAGAAGTCCTTTTGTTTCAGG - Intergenic
1015821321 6:137264100-137264122 TGTTGATCTGCTTTTGTTACAGG + Intergenic
1017261780 6:152395909-152395931 AGCTGAACTGATTTCATAGCTGG + Intronic
1017602624 6:156100273-156100295 AGCTGAACTGCTTTGGGCACTGG - Intergenic
1022497676 7:30863250-30863272 AGCTGAACTGCAGTTGGTCCTGG - Intronic
1023000592 7:35803142-35803164 AGCTTAACAATTTTTGTTGCAGG + Intronic
1023079048 7:36510780-36510802 AGCTGATCTGCTTTTTCTGGGGG + Intergenic
1028970924 7:96858268-96858290 AGCTGGACTCCTTCTGTGGCAGG + Intergenic
1029677526 7:102080621-102080643 TGGTGAACTGCTTTTCTTGTAGG - Intronic
1031658063 7:124382789-124382811 AGGTGAAGTGTTTTTCTTGCAGG - Intergenic
1032418826 7:131761370-131761392 AGATGATCTGTTTTTATTGCTGG + Intergenic
1034917342 7:155051729-155051751 AACTAAAATGCTCTTGTTGCTGG + Intergenic
1047690549 8:127349307-127349329 AGCAGAACTGCTTTCGTTCTTGG + Intergenic
1049920662 9:360859-360881 AGCTGAAATGCTCTTTTTGAGGG - Intronic
1050553294 9:6767069-6767091 AACTGAAGTGTTTTTTTTGCAGG + Intronic
1051026269 9:12615456-12615478 AGTTAAACTGGTTTTGTTGCTGG + Intergenic
1051281313 9:15444049-15444071 GGCTGAACTGGTTTAGATGCAGG - Intronic
1053194824 9:36108944-36108966 AGCTGAACTACTATGGTTGAAGG - Intronic
1054841843 9:69750529-69750551 ATCTGAACTGCTCTGGTTACAGG + Intronic
1061408256 9:130404515-130404537 AGCTGCCCTGCTTTTGTTCCTGG + Intronic
1061755142 9:132807158-132807180 AACTGAACTGCTTTAGCTGTTGG + Intronic
1191607812 X:63081155-63081177 AGCTGAACTGGCTGGGTTGCAGG - Intergenic
1192304507 X:69944622-69944644 AGCTGCACTGCTTTTGGTTGAGG + Intronic
1192738114 X:73868070-73868092 AGGTGAAGTGCATTTGTTGTAGG - Intergenic
1194121622 X:89970781-89970803 TACTGATCTGCTTATGTTGCAGG - Intergenic
1195559007 X:106262039-106262061 GGCTAAACTGCTATTGTTTCTGG + Intergenic
1195890772 X:109692092-109692114 AGCTGAGGTGCTTTCTTTGCTGG - Intronic
1197347227 X:125338568-125338590 AGGTGAAGTGCTTTAGTTACAGG + Intergenic
1197580767 X:128280663-128280685 AGCAGAACTGCTTTTGTTGAAGG - Intergenic
1199196321 X:145035040-145035062 AGGTGAACTGTGTTTCTTGCAGG + Intergenic
1200474477 Y:3628232-3628254 TACTGATCTGCTTATGTTGCAGG - Intergenic