ID: 1147192756

View in Genome Browser
Species Human (GRCh38)
Location 17:38747414-38747436
Sequence CCCAGCGCCCGGGCTTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 371}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147192744_1147192756 29 Left 1147192744 17:38747362-38747384 CCGCTGGCGATGGGAAATATTGC 0: 1
1: 0
2: 1
3: 3
4: 69
Right 1147192756 17:38747414-38747436 CCCAGCGCCCGGGCTTCCCCAGG 0: 1
1: 0
2: 2
3: 49
4: 371
1147192746_1147192756 -4 Left 1147192746 17:38747395-38747417 CCTCCATCCCCATTCTACCCCCA 0: 1
1: 1
2: 10
3: 111
4: 694
Right 1147192756 17:38747414-38747436 CCCAGCGCCCGGGCTTCCCCAGG 0: 1
1: 0
2: 2
3: 49
4: 371
1147192745_1147192756 -3 Left 1147192745 17:38747394-38747416 CCCTCCATCCCCATTCTACCCCC 0: 1
1: 0
2: 3
3: 69
4: 634
Right 1147192756 17:38747414-38747436 CCCAGCGCCCGGGCTTCCCCAGG 0: 1
1: 0
2: 2
3: 49
4: 371
1147192747_1147192756 -7 Left 1147192747 17:38747398-38747420 CCATCCCCATTCTACCCCCAGCG 0: 1
1: 0
2: 2
3: 31
4: 319
Right 1147192756 17:38747414-38747436 CCCAGCGCCCGGGCTTCCCCAGG 0: 1
1: 0
2: 2
3: 49
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147192756 Original CRISPR CCCAGCGCCCGGGCTTCCCC AGG Intronic
900072108 1:779121-779143 GCCAGGGCCCGGGGATCCCCGGG + Intergenic
900176791 1:1294661-1294683 CCCAGCCCCTGGGCAGCCCCGGG - Intronic
900192290 1:1356595-1356617 CCCAGCCCCCGGGGGTCCTCAGG - Intronic
900204464 1:1426184-1426206 CACAGCGCCCATGCTGCCCCGGG + Exonic
900367884 1:2318692-2318714 CGCAGCGCCTGGGCCTCGCCTGG - Intergenic
900438404 1:2642001-2642023 CCCAGGGCCCCGCCATCCCCAGG - Intronic
900810553 1:4798509-4798531 CTCAACCCCCGGCCTTCCCCAGG + Intergenic
901460547 1:9388713-9388735 CCCAGCCTCTGAGCTTCCCCAGG - Intergenic
901808301 1:11751344-11751366 CCAAGTGCCAGGGCTTTCCCAGG + Intronic
902820829 1:18942205-18942227 TCCAGCTCCAGGGCTTACCCCGG - Intronic
902957471 1:19935318-19935340 CCCAGGGCCTGGGCTTCCAGAGG - Intergenic
903070978 1:20726885-20726907 CTCGGCCCCCGTGCTTCCCCTGG - Intronic
903349720 1:22710639-22710661 TCCAGCGCCCGCGCTGCCCCCGG + Intergenic
903668588 1:25022486-25022508 CCCAGCTCCCGGCCTGCCTCCGG + Intergenic
905169200 1:36099416-36099438 CCCGAGGCCCGGGCTTCCCAGGG + Exonic
905186771 1:36202720-36202742 CACTGCGCCCGGGCATGCCCAGG + Intergenic
906147352 1:43567889-43567911 CCCAGCTCCCCGCCTTCCCCAGG + Intronic
906641798 1:47445335-47445357 TCCAATGCCCGGGCTTCCCGCGG - Intergenic
906988059 1:50708094-50708116 CACAGCGCCCGGCCCGCCCCTGG + Intronic
907259945 1:53210517-53210539 CCCCGCCCCCGAGTTTCCCCTGG + Exonic
907385793 1:54124705-54124727 CCCATCCCTCGGGATTCCCCTGG - Intergenic
907767317 1:57424026-57424048 GCGCTCGCCCGGGCTTCCCCGGG - Exonic
910251196 1:85200908-85200930 CCCGGAGCCCGGGCTCCCGCGGG + Exonic
910802821 1:91162557-91162579 CCCAGCACCCTGGCTTTTCCAGG + Intergenic
911058700 1:93729598-93729620 CCCAGCGTCAGGGCTTCCGGTGG - Intronic
914492290 1:148160104-148160126 CCCAGATCCCCGGCTTCCCCGGG + Intergenic
915526108 1:156477169-156477191 GTCAGTGCTCGGGCTTCCCCTGG - Exonic
915949284 1:160177434-160177456 CCCAGCCCCCAGCCCTCCCCTGG + Intronic
916472356 1:165136874-165136896 CCCAGAGCCTGGGCTTTCCAGGG - Intergenic
918260256 1:182789540-182789562 CGCAGCGCCCCGGCTCCCCGAGG - Intronic
918870652 1:189969447-189969469 CACCGCGCCCGGCCATCCCCAGG + Intergenic
919135275 1:193500133-193500155 CCCAGCCCACTGGCTTACCCAGG + Intergenic
919844050 1:201629723-201629745 CCCATAGCCTGGGCATCCCCTGG - Intronic
919914979 1:202133671-202133693 CCCAGCTCCCGCCCCTCCCCAGG - Exonic
920674928 1:208032047-208032069 CCCCGGGTCCGGGCTTCCCATGG + Intronic
922267044 1:223993076-223993098 GCCAGGGCCCGGGGATCCCCGGG + Intergenic
922620517 1:226985443-226985465 CCCAGAGCCCGGGCCTCCTTGGG + Intronic
923630945 1:235649428-235649450 ACCCGCGCGCGGGCTTCCCCGGG + Intronic
923686451 1:236156763-236156785 CCCAGGGCCCTGGTCTCCCCAGG - Intronic
1064552688 10:16520165-16520187 CCCAGCGCACGAGCTGTCCCCGG + Intronic
1066047043 10:31603470-31603492 CCCTCCTCCCGTGCTTCCCCGGG - Intergenic
1067101594 10:43338473-43338495 CCCAGCACCAGAGCTCCCCCAGG - Intergenic
1067748584 10:48955505-48955527 CCCAGGTCCAGGGATTCCCCAGG + Intronic
1069544565 10:69319094-69319116 TCCGGCGCCCGGCCTTCTCCGGG + Intronic
1069920141 10:71811474-71811496 CCCACTGCCCGGGCTTACCCTGG + Intronic
1070198009 10:74176721-74176743 CCCCGCGCGCGGGCGGCCCCTGG - Intronic
1070817755 10:79335959-79335981 CTCAGGGCCCGGTCTTGCCCCGG - Intergenic
1070980859 10:80645822-80645844 CTCAGCTCCATGGCTTCCCCCGG + Exonic
1071955929 10:90759365-90759387 CACCGCGCCCGGCCTTTCCCTGG - Intronic
1073206847 10:101774211-101774233 CCCAGCCGCCTGGGTTCCCCAGG + Intronic
1074829993 10:117241334-117241356 CCCTGCGCCCCGGCTGCCCCGGG - Intronic
1074871015 10:117576077-117576099 CCCAGCCCCTGGGCTTCCAGAGG - Intergenic
1074942709 10:118250544-118250566 CCCAGCACCCCGGGTGCCCCAGG - Intergenic
1075584916 10:123650686-123650708 CCCAGGGCCCTGGCTCCCCTGGG - Intergenic
1075631440 10:124003096-124003118 CCCAGGGCTCGGCCTTGCCCAGG - Intergenic
1076335978 10:129706665-129706687 CCCAGGGCCAGGGCTTCCCACGG + Intronic
1077065668 11:640041-640063 CCCCGCGCCCGGCCTTCCCCGGG + Exonic
1077065706 11:640137-640159 CCCCGCGCCCGGCCTCCCCCCGG + Exonic
1077085418 11:747627-747649 CCCGGCGCCCCGATTTCCCCGGG + Intronic
1077228277 11:1447713-1447735 CCCAGGGCCCGGGCCACACCGGG - Intronic
1077230197 11:1455278-1455300 CCCAGCGCCCAGGCATCACAGGG + Intronic
1077269140 11:1666855-1666877 CCCACCGCCCGGGAGGCCCCGGG + Intergenic
1077271407 11:1683859-1683881 CCCACCGCCCGGGAGGCCCCGGG - Intergenic
1077330957 11:1983612-1983634 CCCAGCCCCAGCCCTTCCCCAGG + Intronic
1077378197 11:2215504-2215526 CCCAGCACCCGTGCTCCCTCTGG - Intergenic
1077424253 11:2467033-2467055 CCCATCTGTCGGGCTTCCCCTGG - Intronic
1077491509 11:2862939-2862961 CCCACCGCCCGGGCCGCCCCGGG - Intergenic
1078066308 11:8081417-8081439 CTCAGCTCCCGGGCCGCCCCGGG - Intronic
1078722189 11:13895427-13895449 ACCATCGCCCCAGCTTCCCCTGG + Intergenic
1078843157 11:15097478-15097500 CCCAGCACCAGGACTTTCCCAGG + Intergenic
1079407061 11:20156629-20156651 CCCCGCCCCCGTGCGTCCCCCGG - Intronic
1080668582 11:34356980-34357002 CGCAGCGCGCGGACTTGCCCCGG + Exonic
1081662597 11:44897062-44897084 CCCACAGCCCAGGCTTCCCCAGG + Intronic
1083306415 11:61764272-61764294 CCCAGAGCCCTGGGGTCCCCGGG - Intronic
1083481214 11:62948957-62948979 CTCAGGGCCTGGGTTTCCCCAGG + Intronic
1083759328 11:64807128-64807150 CCCAGCCCCCCGGCCTCACCAGG + Intronic
1083950630 11:65953686-65953708 CCCAGGGCCCCGGCTCCCTCTGG - Exonic
1083993067 11:66258307-66258329 CTCAGTGTCCGGGTTTCCCCGGG - Intronic
1084546713 11:69818478-69818500 CCCAGCGCGCGCTCTTCTCCCGG + Intronic
1084561825 11:69909864-69909886 CCCAGGGCCCTGGCTGCTCCGGG - Intergenic
1085055115 11:73398782-73398804 CCCACAGCCCAGCCTTCCCCTGG - Intergenic
1085173521 11:74467662-74467684 CCCAGCTCCTTGGCCTCCCCCGG + Intronic
1085794079 11:79520682-79520704 CCCAGCCTCCTGGCTTCCCCTGG + Intergenic
1087345288 11:96964424-96964446 CACAGCACCAGGACTTCCCCAGG - Intergenic
1088893139 11:114059924-114059946 CCGCGCGCCGGGGCTTCCCGGGG + Intronic
1089139761 11:116276117-116276139 CCCAGGGCCCTGTCTTCCCCAGG - Intergenic
1089499859 11:118925645-118925667 CCCAGCGCCCGGCATTCCCGCGG - Intronic
1089590011 11:119534000-119534022 CCCGGCTCTCGGGCTCCCCCTGG + Intergenic
1090003606 11:122981799-122981821 TCCAGCGCCCGGGGTAGCCCAGG - Intergenic
1202813937 11_KI270721v1_random:38791-38813 CCCAGCCCCAGCCCTTCCCCAGG + Intergenic
1091449759 12:565174-565196 CCCAGCTCCAGGGACTCCCCAGG - Intronic
1091616109 12:2052652-2052674 CCGCGCGCCCCGGCCTCCCCGGG + Intronic
1091699499 12:2650698-2650720 CCAAGCCCCCAGGCTCCCCCAGG + Intronic
1091718534 12:2795886-2795908 CCCCGCGCCCGGCCTCCCCGGGG - Intronic
1092480129 12:8852131-8852153 CTCAGCCCCCAGGTTTCCCCAGG + Intronic
1098161436 12:67649958-67649980 CCCACCGCCCGGGCCGCCCGCGG - Intronic
1099996945 12:89788229-89788251 CCCAGCCCCAGAGCTTCCCATGG + Intergenic
1101530265 12:105567175-105567197 ACCAGAGCCCAGGCTTCCACAGG - Intergenic
1101904453 12:108814535-108814557 CCCAGCCCCCGGGATTCCCTGGG + Intronic
1102035615 12:109769049-109769071 GCCAGCTCCCGGGCTGCCCCCGG - Exonic
1102187788 12:110963297-110963319 CCAAGCACCAGGGCTTGCCCTGG + Intergenic
1103510091 12:121467743-121467765 CCCACGGCCCGGGCGCCCCCGGG - Intronic
1103883213 12:124182495-124182517 CCCAGGGCGAGGGCTTCCCGAGG - Intronic
1103904730 12:124321458-124321480 TCCAGGGCCCAGGCTTGCCCAGG - Intergenic
1103988108 12:124780598-124780620 CCCAGCGCCCCGGATCCCCTAGG - Intronic
1104917911 12:132275523-132275545 GCCAACGCCAGGGCTTCCTCAGG + Intronic
1104974611 12:132546726-132546748 CCCAGCTGCCCAGCTTCCCCAGG + Intronic
1108689739 13:52849902-52849924 CGCAGCGCCCGGCCAGCCCCAGG - Intergenic
1113377959 13:109782369-109782391 CCAAGCCCCCGGGCTGACCCGGG + Exonic
1113379051 13:109786460-109786482 CCGAGCGCCCGGGCGCACCCCGG - Exonic
1114556419 14:23564929-23564951 CCCAGTGCCCAGGCTGGCCCTGG - Intronic
1115664828 14:35534768-35534790 CCCAGAGCCCGCGCTTCAGCCGG + Exonic
1117573089 14:57068839-57068861 CCCAGTGTCCCGGCTTCCCCAGG - Intergenic
1118760806 14:68879357-68879379 CCCAGCCCCCCCGCTTCCCCAGG + Intronic
1118796707 14:69151766-69151788 CGCGGGGCCCGGGCCTCCCCGGG + Intronic
1119383019 14:74240504-74240526 CCCCGAGCCCGCGCGTCCCCGGG - Intronic
1119385922 14:74258136-74258158 GCGAGCGCCCCCGCTTCCCCGGG - Intronic
1119770802 14:77219653-77219675 CCCAGCGCCCGAGCTGCAGCAGG + Intronic
1121526722 14:94624336-94624358 CCCAGGGCCCAGGCTCCACCTGG + Intronic
1121529430 14:94641821-94641843 CCCAGGCCCCGAGCTTCCCCTGG - Intergenic
1122055440 14:99095067-99095089 CCAAGCGCCCGGCCCTGCCCAGG + Intergenic
1122977478 14:105176849-105176871 CCCAGGGCCTCAGCTTCCCCTGG + Intronic
1123063437 14:105604816-105604838 CCCAGCCCCCTGCCTTCTCCAGG + Intergenic
1123087499 14:105723602-105723624 CCCAGCCCCCTGCCTTCTCCAGG + Intergenic
1202897136 14_GL000194v1_random:16717-16739 CCCAGGGCCTGGTGTTCCCCTGG - Intergenic
1202857032 14_GL000225v1_random:58130-58152 CCCAGTCCCCGGGCTTCCGCGGG - Intergenic
1202868357 14_GL000225v1_random:137017-137039 CCCCGTCCCCGGGCTTCCGCGGG + Intergenic
1124554481 15:30711893-30711915 CCCATCAGCCGGGCTTCCCCAGG - Intronic
1124676768 15:31693784-31693806 CCCATCAGCCGGGCTTCCCCAGG + Intronic
1127414943 15:58749225-58749247 CCCACCGCCCTGGCGGCCCCGGG - Intronic
1128149636 15:65355163-65355185 CGCGGGGGCCGGGCTTCCCCAGG - Intronic
1129115787 15:73364664-73364686 GCCACCGCCATGGCTTCCCCAGG - Intronic
1129685882 15:77685961-77685983 CCTGGGGCCTGGGCTTCCCCAGG + Intronic
1129862395 15:78872789-78872811 CCCTGCGCCCGCGCCGCCCCAGG - Intronic
1131048831 15:89333415-89333437 CCCAGAGCCCGTGCTTCTGCAGG + Exonic
1131059311 15:89394898-89394920 CCCACCGCCCCTCCTTCCCCAGG + Intergenic
1131635714 15:94231415-94231437 CCAAGCGCCCGCGCTGCCGCCGG - Intergenic
1132702771 16:1229123-1229145 CCCAGCCCCTGGGCTCCCTCTGG - Intronic
1132705555 16:1241745-1241767 CCCAGCCCCTGGGCTCCCTCTGG + Intronic
1132765994 16:1534439-1534461 CCCAGGGCTCGGCCCTCCCCGGG - Exonic
1132828931 16:1918270-1918292 CCCTGCGCCCTGGCCGCCCCCGG + Exonic
1132925726 16:2428410-2428432 CCCAGGCCCCTGCCTTCCCCAGG + Intergenic
1133238741 16:4402589-4402611 CCCAGCGCCCAGCCCTGCCCAGG - Intronic
1133287871 16:4698855-4698877 GCCAGCTCCAGGGCATCCCCGGG + Exonic
1133405621 16:5522021-5522043 CCCAGCACCCGGGATTCGACTGG + Intergenic
1134024718 16:10944903-10944925 ACCACCACACGGGCTTCCCCGGG - Intronic
1134093978 16:11406718-11406740 CACCGTGCCCGGCCTTCCCCCGG + Intronic
1134464193 16:14458765-14458787 ACCAGTGCCCTGGCTTCCCTGGG - Intronic
1134644934 16:15858279-15858301 CGGAGCGCCCGGGCTGCCCGCGG - Intergenic
1136500004 16:30665326-30665348 CGCAGTGCCCGGGCTGCCTCCGG + Exonic
1136519378 16:30786450-30786472 CCCAGCGCCTCGGCCTCCCTCGG - Intronic
1136627800 16:31472458-31472480 CCCCGCGCCCGGGCGCCCGCGGG - Intronic
1137506238 16:49056326-49056348 CCTAGAGCCCTGGCGTCCCCAGG - Intergenic
1137555043 16:49465121-49465143 CCCCGCGCTCAGGCTGCCCCGGG - Intergenic
1137675044 16:50299955-50299977 CCCAGGGCCCCTGCTTCCCAGGG + Intronic
1139351055 16:66336072-66336094 CCCAGCTCCAGAGCTTCCCATGG + Intergenic
1139476153 16:67203475-67203497 CCCCGCTCCCTTGCTTCCCCAGG + Exonic
1139599885 16:67980178-67980200 CCCAGCGCCCTCACTACCCCAGG - Exonic
1140567034 16:76055711-76055733 CACAGCACCAGGGCTTCCTCTGG + Intergenic
1141766861 16:86064562-86064584 CCCAGAGCCGAGACTTCCCCAGG + Intergenic
1142395513 16:89829075-89829097 CCCAGTGGCCTGGCTTCCTCCGG + Intronic
1142469572 17:155864-155886 CCCAGCCTCCTGGCTACCCCCGG + Intronic
1142600178 17:1050031-1050053 CCCGGCGCCCTGGCCTCACCTGG + Exonic
1142727859 17:1829805-1829827 CCCAGCGCCCGCGCAGCTCCTGG + Exonic
1143100805 17:4503718-4503740 CCAAGTGCCCAGGCTGCCCCAGG - Intronic
1143116640 17:4585010-4585032 GCCAGCGCACGCGCTCCCCCGGG - Intronic
1143164459 17:4891032-4891054 CCCATCCCCCAGGCCTCCCCAGG + Exonic
1143482588 17:7236209-7236231 CCCACCTCCTGGGCCTCCCCAGG - Exonic
1144205013 17:12973912-12973934 CCCAGCACCCTGGCTGCTCCCGG - Intronic
1144685124 17:17221104-17221126 CCAGGTGCCTGGGCTTCCCCAGG - Intronic
1144959703 17:19038299-19038321 CCCAGCGCCTGGCCTTCCGGAGG + Intronic
1144975457 17:19136225-19136247 CCCAGCGCCTGGCCTTCCGGAGG - Intronic
1146054250 17:29573370-29573392 CCCAGCACAGGGGCTTCCCTAGG + Intergenic
1146956126 17:36937270-36937292 CCCTGCGCCCGGGCTCCTTCGGG - Intronic
1147192756 17:38747414-38747436 CCCAGCGCCCGGGCTTCCCCAGG + Intronic
1147447299 17:40482292-40482314 CCCAGCCTCCAGGCTCCCCCGGG - Intronic
1147896509 17:43755176-43755198 GCCGGCGCCCGGGATTCCTCAGG + Exonic
1148101349 17:45093751-45093773 CCCTGCCCCAGGGCTTCACCTGG + Exonic
1148149727 17:45389485-45389507 CCCAGCTCCAGGGCTTCCCATGG + Intergenic
1148215184 17:45830340-45830362 CCCTGGGCCTGGGCCTCCCCAGG - Intronic
1148651586 17:49253999-49254021 CACAGTGGCCAGGCTTCCCCTGG + Intergenic
1148778044 17:50106726-50106748 CCCAGCGCTCCCTCTTCCCCCGG - Intronic
1148792312 17:50180298-50180320 CCCAGCACCAGGGCTCCCACTGG + Intergenic
1150230128 17:63545222-63545244 TCCAGGGCCCAGGCTGCCCCAGG + Exonic
1151208969 17:72529477-72529499 CCCAGCTCCAGGGCTACCCCTGG - Intergenic
1151350975 17:73532072-73532094 CCCAGCTCCCGGGGGACCCCTGG + Intronic
1151658081 17:75504897-75504919 CCCTGCGCCCAGGCTTCTCCCGG - Exonic
1152147480 17:78577030-78577052 CTCAGCCCCCTGGCTTCTCCTGG - Intronic
1152327549 17:79650430-79650452 CCCAGTGCCTTGGCCTCCCCTGG - Intergenic
1152711064 17:81870837-81870859 CCCAGCGCCCGGGCCACGCCCGG - Intronic
1152756921 17:82090822-82090844 CCCAGGGCTCTGGCTTTCCCTGG - Intronic
1152784266 17:82239876-82239898 CCCAGCGCTTGGGCTTGTCCTGG + Exonic
1152787139 17:82254461-82254483 CTCAGCGCACTGGCTTCTCCAGG - Intronic
1154217921 18:12429056-12429078 CCCAGCGCTGAGGCTGCCCCAGG - Intronic
1154342931 18:13519346-13519368 CCCAGCTCCCCGGCTCCCTCCGG - Intronic
1154383254 18:13871173-13871195 CCCAGAGCCAGGGCAGCCCCGGG + Intergenic
1154385254 18:13887122-13887144 CACAGCACACAGGCTTCCCCGGG - Intronic
1156448496 18:37253740-37253762 CCCCGCGCCCCGGCCGCCCCCGG + Intronic
1158082962 18:53615826-53615848 ACCAACCCCAGGGCTTCCCCAGG + Intergenic
1160006606 18:75073181-75073203 CCCAGCTCCCCAGCTTCTCCTGG - Intergenic
1160313456 18:77819361-77819383 GCCAGAGCCCAGCCTTCCCCAGG - Intergenic
1160554093 18:79714931-79714953 GCCAGCGCCCCGGCTCCCTCTGG - Exonic
1160558068 18:79739018-79739040 CCCAGTGCACCGCCTTCCCCAGG - Intronic
1160736042 19:662870-662892 CGCACCGCCCGGGCTCCCCGCGG + Intronic
1161203698 19:3029371-3029393 CCCCGCGCCCGCGCCCCCCCCGG + Intronic
1161483990 19:4525027-4525049 CCCACCGCCCCGGCCTGCCCTGG - Exonic
1161520840 19:4722877-4722899 CCCACCCCCTGGTCTTCCCCAGG - Intronic
1161596214 19:5152278-5152300 CCAGACCCCCGGGCTTCCCCTGG - Exonic
1161681285 19:5681059-5681081 CCCAGCGCCGGAGCGTCGCCGGG - Exonic
1162041783 19:7975203-7975225 CCTAGTGTCCGGGCTTGCCCTGG + Intronic
1162744290 19:12790184-12790206 CCAAGCACCCGGGCCTCCGCGGG + Intronic
1163504605 19:17698119-17698141 CTGAGCTCCAGGGCTTCCCCAGG + Intergenic
1163607146 19:18281589-18281611 CGCAGCGCCCGGCCCTCCACTGG + Exonic
1163826867 19:19528908-19528930 CCCGGCGCCCGGGCTCACCTCGG + Exonic
1163862049 19:19747791-19747813 CCCAGGGGTCCGGCTTCCCCAGG + Intergenic
1164463061 19:28464755-28464777 CCAAGTGCCTGGGCTTTCCCAGG - Intergenic
1164580026 19:29429273-29429295 CCCATCTCCCGGGCTGCCCAGGG + Intergenic
1164903454 19:31947656-31947678 CCCAGCGCCCTGGCCTCCTCTGG + Intergenic
1165008894 19:32828861-32828883 CTCAGAGCCCTGGCCTCCCCTGG + Intronic
1165124370 19:33583425-33583447 TCCAGCTCCAGGGCTCCCCCAGG + Intergenic
1165157262 19:33796236-33796258 CGCGGCGCCCGGGCCTCCTCCGG - Intronic
1165435010 19:35790705-35790727 CCCTGGGCCTGGGCCTCCCCAGG + Intergenic
1165721357 19:38081944-38081966 ACCAGCACCCCGGCTTCCTCAGG + Exonic
1166949394 19:46416527-46416549 CTCAGCCCCCGGGCCTCCCGCGG + Intergenic
1167715921 19:51142923-51142945 ACCAGAGCCTGAGCTTCCCCAGG + Intronic
1167721926 19:51185364-51185386 ACCAGAGCCTGAGCTTCCCCAGG + Intergenic
1167768822 19:51501164-51501186 ACCAGAGCCTGAGCTTCCCCAGG - Intronic
1168148049 19:54430471-54430493 CCCAGTGCCCGGCCTTCCCCCGG + Intronic
1168294086 19:55370316-55370338 CACAGGGCCAGGGGTTCCCCAGG + Exonic
1168333013 19:55580560-55580582 CCCAGCTGCCGGGAATCCCCAGG + Intronic
1168701059 19:58439832-58439854 CCCAGCGGCAGGGCTAGCCCTGG - Exonic
925817461 2:7767511-7767533 CCCGGGGCCCTGGCTTTCCCTGG + Intergenic
926243340 2:11104630-11104652 GCCAGCTCCAGAGCTTCCCCAGG + Intergenic
926366026 2:12133810-12133832 CCCAGAGCCCAGGCCTGCCCCGG - Intergenic
928373560 2:30758080-30758102 CCCAGCCCCAGGGGTTCCACAGG + Exonic
929452271 2:42046127-42046149 CCCAGCTCCCCGTTTTCCCCAGG + Intergenic
930680945 2:54255983-54256005 CCCACCGCCCCGGCTTCCAGAGG - Exonic
931107148 2:59068682-59068704 CCCTGTACCAGGGCTTCCCCTGG + Intergenic
931393198 2:61862633-61862655 CACAGCATCCGGGCTTCCTCAGG + Intergenic
932288053 2:70553518-70553540 TCGAGCGCCGAGGCTTCCCCGGG - Intronic
932407815 2:71525510-71525532 CACGGCGCCCAGGCTTCCCCAGG + Intronic
932593665 2:73081307-73081329 CCCACCCCCCTGGCCTCCCCTGG - Intronic
932765227 2:74465064-74465086 CCCAGCGCCCCGACATACCCAGG + Exonic
933207057 2:79518938-79518960 CACTGCGCCTGGGCTTCCCCAGG - Intronic
935301722 2:101698329-101698351 CCCAGCGCCCGGGGGTCGCGCGG - Intronic
936038177 2:109129116-109129138 CGCCGCGCCCCGGCCTCCCCGGG + Intergenic
937048230 2:118864394-118864416 CCCAGCAAACTGGCTTCCCCGGG - Intergenic
939999113 2:148949511-148949533 CCCAGGGCCCGAGCTACCCATGG + Intronic
940639537 2:156332534-156332556 CCCGGCGCCCGGGCTCCCAGAGG - Exonic
941916554 2:170817283-170817305 CTCAGCCTCCGTGCTTCCCCGGG - Intronic
942452155 2:176115036-176115058 CCCGAGGCCCGGGCTTCCGCAGG + Intronic
945080725 2:206085108-206085130 CCTAGCGCCCGGGACCCCCCAGG - Intronic
947621646 2:231594614-231594636 CCCAGCGCCAGCACTTGCCCTGG + Intergenic
947992248 2:234497001-234497023 CCCGGAGCGCGGGCTTCCCCGGG + Exonic
948283737 2:236768625-236768647 CCAAGTGCCCCAGCTTCCCCAGG + Intergenic
948436277 2:237956276-237956298 CGCAGCGCCCAGGAATCCCCTGG + Intergenic
948634799 2:239328188-239328210 GCCAGCGCCAGGGCTCCTCCAGG - Intronic
948805484 2:240452096-240452118 CCCAGCTCCCCACCTTCCCCAGG - Intronic
948807661 2:240459931-240459953 CCCGGCGCCCTGGCTCCGCCCGG - Intronic
1168771457 20:419402-419424 CCCAAAGCCCGGGGTCCCCCAGG + Exonic
1169345331 20:4823956-4823978 TCCAGCGGCCTGGATTCCCCAGG + Intergenic
1169673782 20:8132435-8132457 CGCAGCGCCCGGCCATGCCCCGG - Intronic
1170311448 20:14996985-14997007 CACAGCACCAGGGCTTGCCCAGG - Intronic
1171173646 20:23035598-23035620 CCCGCCGCCCGCGCGTCCCCGGG - Exonic
1171175659 20:23049532-23049554 CGCAGTGCCCGCGCTTTCCCCGG - Exonic
1171196761 20:23205983-23206005 CCCAGGCCCCGGGCCACCCCGGG - Intergenic
1172061547 20:32190206-32190228 CCCGCCGCCCGGCCTTGCCCGGG - Intergenic
1172641320 20:36442071-36442093 CCCAGAGCCTGCTCTTCCCCAGG - Intronic
1172775664 20:37405281-37405303 CCCAGAGCCAGGGGTCCCCCAGG - Exonic
1173348993 20:42227297-42227319 CCCAGCTTCAGGGCCTCCCCTGG - Intronic
1174356205 20:49999553-49999575 CCCAGCGCTGGGTCTTTCCCTGG - Intergenic
1175215905 20:57391607-57391629 CCCCGAGCGCGGGCTTCCCGCGG + Exonic
1176126123 20:63475656-63475678 CCTACTGCCCGGGCTCCCCCGGG + Intergenic
1176616821 21:9032706-9032728 CCCAGGGCCTGGTGTTCCCCTGG - Intergenic
1179451872 21:41473553-41473575 CCCAGCGCCCGCCCCTCCCAAGG + Intronic
1179798772 21:43800751-43800773 CCCAGCCCCTGGGGTTCCCCTGG + Intronic
1180047709 21:45317459-45317481 CCCAGCGCCCAGGGGTGCCCAGG + Intergenic
1181737573 22:24893629-24893651 CCCAGCCCCCGCGCTCCCCGAGG - Intronic
1182427067 22:30279514-30279536 CCCAGTGCCGGGGCTTGCCTGGG + Intergenic
1182695802 22:32198699-32198721 CCCAGGGCCCGGGCTCCTCCAGG - Intronic
1182795968 22:32991952-32991974 CCCAGAGCCCTGCCTCCCCCAGG + Intronic
1184100880 22:42341308-42341330 CCGAGCGCCAGGGCTCCCCGTGG - Intronic
1184164641 22:42720379-42720401 CCCGACGCCCAGGCTTCCCCCGG + Intronic
1184787371 22:46678397-46678419 CCCAGCCCCCGCCCTGCCCCAGG + Exonic
1184857703 22:47155527-47155549 CACAGTGGCCGGGCATCCCCAGG - Intronic
1185121394 22:48973777-48973799 CCCAGCACCAGGGCCTCCCCAGG + Intergenic
1185138906 22:49089432-49089454 CCCAGGCCCCGGACTCCCCCAGG + Intergenic
1185409625 22:50674864-50674886 CCCAGGGGCCGGGCTTCCCGGGG - Intergenic
950533033 3:13564015-13564037 CCCAGCAACAGGGCTTCCCTGGG - Intronic
952525945 3:34210748-34210770 CCCAGGGCCTGGGCTGCCTCAGG + Intergenic
954653415 3:52178914-52178936 CCCAGGGTCCTGGCTTCCCCAGG - Intergenic
954685615 3:52368654-52368676 CCCGGCGGCCAGGCTTCCCTGGG + Intronic
955818687 3:62874422-62874444 CCCAGCGGCCGGGCTCGCCCAGG - Intronic
956659334 3:71583079-71583101 CCCCGCGCCCGGGCGGCCACCGG + Intronic
959003149 3:100988454-100988476 CCCAGAGCCCAGGCAACCCCAGG - Intronic
961514283 3:127423055-127423077 TCCAGCCCCGGGCCTTCCCCAGG - Intergenic
962444249 3:135450601-135450623 CTCAGAGGCAGGGCTTCCCCAGG + Intergenic
962676954 3:137764581-137764603 CCCAGCGCCCAGGCAGCCCCGGG - Exonic
966254265 3:177899503-177899525 CCCAGCTCCTGGGCTGGCCCAGG - Intergenic
966872320 3:184299121-184299143 CCGAGCGCCCCGGCTCGCCCCGG + Exonic
967300656 3:188009114-188009136 CCCAGCCCCCAGGCCTTCCCAGG + Intergenic
967387652 3:188927205-188927227 CCCAGCTCCCAGGCTACACCTGG - Intergenic
967694417 3:192514894-192514916 GCCGGCGCCCGGGCTCCCTCCGG - Intronic
967858594 3:194135425-194135447 CTTAGACCCCGGGCTTCCCCAGG - Intergenic
968008703 3:195259699-195259721 CCCAGCACCAGGGCGGCCCCCGG + Intronic
968520644 4:1033336-1033358 GCCAGCGCCAGGGCTAACCCGGG - Intergenic
968571874 4:1346521-1346543 CCCTGGGCCCGGGCTGGCCCTGG - Intergenic
968582747 4:1402577-1402599 CCCACCGGCCTGGCGTCCCCCGG - Intergenic
968957271 4:3725815-3725837 GCCAGCCCCCGGCCCTCCCCTGG + Intergenic
969441248 4:7218000-7218022 CTCTGTGGCCGGGCTTCCCCAGG + Intronic
972740333 4:41881661-41881683 TCCCGCGCCCCGGCTCCCCCAGG + Intergenic
975409977 4:74038483-74038505 CCCGGCGCCCTGGGGTCCCCGGG - Intronic
975415365 4:74098992-74099014 CCCGGCGCCCTGGGGTCCCCGGG - Intronic
983229166 4:165112590-165112612 CCCCGCGCCCAGGCCTCCCCGGG + Intronic
984919107 4:184748373-184748395 GCCAGCGCCTGGGCCTCACCCGG - Intergenic
985509310 5:303203-303225 CCCACCGCCCGTGCTCCACCAGG + Intronic
985522050 5:378539-378561 CCAAGCCTCCGGCCTTCCCCAGG + Intronic
985646415 5:1086771-1086793 CCCACTGCCCTGGCTGCCCCTGG - Intronic
985945199 5:3177050-3177072 CTGAGCCCCCGGGCTTCTCCTGG - Intergenic
990381944 5:55227421-55227443 CCTGGCAACCGGGCTTCCCCCGG + Intergenic
994107230 5:95961386-95961408 CCCAACGCCCAGGCTAGCCCGGG + Intronic
996342856 5:122457473-122457495 CCCAGCTCCCATGCTTCCCCAGG + Intronic
997349773 5:133222267-133222289 CCCAGCGCCCCTGATTCCCCCGG - Intronic
1000539388 5:162520950-162520972 CACAGCACCTGGGCTTGCCCAGG + Intergenic
1001303041 5:170551515-170551537 TCCTGGGCCAGGGCTTCCCCAGG + Intronic
1001939420 5:175729949-175729971 CCCCGTGCCTGGGCTTCCCCTGG - Intergenic
1002468690 5:179421849-179421871 CCCAGAGGCTGGGTTTCCCCAGG - Intergenic
1002694154 5:181072889-181072911 CCCAGTTCCAGGGCTCCCCCAGG - Intergenic
1002994515 6:2270225-2270247 CCCAGGGCCCAGGCCTCTCCTGG - Intergenic
1003290787 6:4776653-4776675 CCCAGCGCCCGGCCGGCCGCGGG + Exonic
1005279926 6:24262448-24262470 CGCAGCACCAGGGCTTTCCCAGG - Intronic
1005812889 6:29530079-29530101 CCCAGGGGTCTGGCTTCCCCAGG + Intergenic
1006005993 6:31002100-31002122 CCCAGACCCAGGGCTTACCCCGG + Intergenic
1007378807 6:41473498-41473520 CCCAGTGCCCACCCTTCCCCAGG - Intergenic
1007414784 6:41684942-41684964 CCCAGCATCAGGGCCTCCCCTGG + Exonic
1007631395 6:43275321-43275343 CCCGCCGCCGAGGCTTCCCCTGG + Intronic
1011343170 6:86340062-86340084 CACAGCACCAGGGCTTGCCCAGG - Intergenic
1013009578 6:106107147-106107169 CCCGGCGCCTGGGCTGCCCTTGG + Exonic
1013374786 6:109503925-109503947 CCCAGCACCAGTGTTTCCCCAGG + Intronic
1015525836 6:134175067-134175089 CCCTGCGCCAGGCCGTCCCCGGG - Intronic
1017282130 6:152636855-152636877 CCCGGCGCCCGCGCTCACCCTGG + Intronic
1018368816 6:163149269-163149291 CCCAGGCCCCGGCCCTCCCCAGG + Intronic
1018869416 6:167769929-167769951 CCCAGAGCTCGGTCTTCCCATGG + Intergenic
1019604398 7:1901347-1901369 CCAAGAGCCCGGGGTTCCTCTGG + Intronic
1019888996 7:3930311-3930333 GCCAGAGCCCTGGCTTCACCTGG + Intronic
1019909856 7:4093624-4093646 CCGGGCGCCCAGGCGTCCCCAGG + Intronic
1020006241 7:4785061-4785083 CCCAGGGCACTGGCCTCCCCAGG + Intronic
1021259193 7:18432657-18432679 CACAGCGCCCGGCCTTCCACTGG - Intronic
1021868236 7:24979736-24979758 CCCAGGGCCGGAGCCTCCCCGGG + Intronic
1024189658 7:46993185-46993207 CCCAGCCCCAGGGTTTCCACTGG - Intergenic
1024226936 7:47332523-47332545 CCCAGCCCGCGAGCTGCCCCAGG + Intronic
1026935765 7:74254441-74254463 CCCCGCCCCCTGGCTTCCGCCGG + Exonic
1026968234 7:74453714-74453736 CCCAGCGCCCCTGCGTCCCGGGG - Intergenic
1027002177 7:74661152-74661174 CACCGCGCCTGGGCGTCCCCGGG + Intronic
1029270463 7:99374403-99374425 CCCTGCGCCCGGCAGTCCCCGGG + Intronic
1029551181 7:101237879-101237901 CCCAGCCTCTGGGCTGCCCCGGG + Intronic
1031895974 7:127347989-127348011 CCCTGCGCCCGGCCGCCCCCGGG - Intronic
1032512948 7:132486574-132486596 CCCAGTGGCCTGGCTTTCCCCGG + Intronic
1032834723 7:135662384-135662406 CGCAGCGCCCAGGTTCCCCCTGG - Intergenic
1033269328 7:139916540-139916562 CCCGGCACCCTGGCTGCCCCAGG + Intronic
1033660912 7:143401406-143401428 CCCAGAGGCCCGGCTCCCCCAGG + Exonic
1033681689 7:143601422-143601444 CCCAGGGCCCTGGATTCTCCTGG - Intergenic
1033703202 7:143860391-143860413 CCCAGGGCCCTGGATTCTCCTGG + Exonic
1034522499 7:151631931-151631953 CCCGGCCCCTGGGCTTCCGCAGG + Intronic
1034901996 7:154913761-154913783 GCCAGCACCTGGGCCTCCCCCGG + Intergenic
1035257871 7:157643572-157643594 CCCACGGCCCGGGCATCCCAGGG + Intronic
1035625686 8:1068909-1068931 CCCAGCCCCCGGGGCTGCCCAGG - Intergenic
1035734930 8:1881178-1881200 CCCAGCACGCTCGCTTCCCCTGG + Intronic
1036204373 8:6794376-6794398 CCCAGGGACCGGGGTTCCCAAGG + Intergenic
1036396773 8:8377197-8377219 CCCAGCCCCCGGCCCACCCCCGG - Exonic
1036739269 8:11346928-11346950 CCAAACGCCCAGGCTGCCCCCGG - Intergenic
1037359087 8:18054211-18054233 CCCACAGCCCGGGCTTCCTCTGG - Intergenic
1037659278 8:20913036-20913058 CCCAGTGCTCCGGCTTCTCCTGG + Intergenic
1037807564 8:22066991-22067013 CGCAGCGCCCCGGGTCCCCCAGG + Intronic
1040951506 8:52941746-52941768 CCGCGCGCCCGGGCTACTCCGGG - Intergenic
1041244902 8:55880312-55880334 CCCCGCGCCCTGGCTCCCCCGGG - Intronic
1043515608 8:80992163-80992185 CGCAGGGCCGGGGCTTCCCGGGG - Intronic
1043969610 8:86514784-86514806 CCCCGAGCCCGGGCTCCTCCAGG - Intronic
1047713546 8:127575126-127575148 CCCAGCGCCCAGGCCTCCGCTGG - Intergenic
1049411333 8:142475290-142475312 CCCAGCTCCCGGGCCCCCTCTGG - Intronic
1049537356 8:143188577-143188599 CACAGCACCCGTGCTGCCCCCGG - Intergenic
1049726420 8:144148448-144148470 CCCAGTGCCCGGCCCTCCCCGGG + Intronic
1049795694 8:144496386-144496408 CCCAGGGCAGGGGCTCCCCCGGG + Intronic
1049804582 8:144533100-144533122 CCCGGCGCCCGGGGTTGCCGTGG + Intronic
1052971523 9:34379967-34379989 CCCGGAGCCCGACCTTCCCCAGG - Intronic
1055376803 9:75657468-75657490 CTCAGCACCAGGGCTTCCCATGG + Intergenic
1057361198 9:94374923-94374945 CCCCGCGCCCGCGCTCACCCAGG - Exonic
1057662165 9:97013241-97013263 CCCCGCGCCCGCGCTCACCCAGG + Exonic
1057950578 9:99366296-99366318 CCAGGTGCCCGGGCATCCCCAGG - Intergenic
1058583224 9:106481118-106481140 CCCAGAGCCTGAGCTACCCCTGG - Intergenic
1060201102 9:121652080-121652102 CCTAGAGCCTCGGCTTCCCCCGG - Intronic
1060771068 9:126332622-126332644 CCCAGACCCCGGGCTTTCACTGG + Intronic
1060825080 9:126683179-126683201 CCCAGCCTCCCGGCCTCCCCCGG - Intronic
1061671148 9:132188835-132188857 CCCAGCCCCCGGCCCTCCTCAGG - Intronic
1061711119 9:132488714-132488736 CCCAGCGCCCGGAAGCCCCCTGG - Intronic
1061823082 9:133239289-133239311 TCCAGCGCCCGCCCTTACCCCGG + Intergenic
1061885461 9:133589104-133589126 CCCAGCTCACGGGATTTCCCAGG - Intergenic
1062189917 9:135242702-135242724 CCCAGCCCCGCGGCTTGCCCTGG + Intergenic
1062289551 9:135788430-135788452 CCCAGCTCTCGGGCTCACCCTGG + Intronic
1062357096 9:136170166-136170188 CCGGGGGCCCGGGCTTGCCCAGG - Intergenic
1062403080 9:136380926-136380948 CCCAGCCTCAGGGCTGCCCCAGG - Intronic
1062504626 9:136866591-136866613 CGCAGCCCCCGTGCCTCCCCGGG + Intronic
1062537822 9:137028518-137028540 CGCAGCGCCCGAGGGTCCCCCGG - Intronic
1203736421 Un_GL000216v2:143251-143273 CCCCGTCCCCGGGCTTCCGCGGG - Intergenic
1203738770 Un_GL000216v2:161214-161236 CCCCGGCCCCGGGCTTCCACTGG - Intergenic
1186356904 X:8799823-8799845 CCCAGGGCCCGGGATTGTCCCGG - Intronic
1187805818 X:23119263-23119285 TCTAGCCCCAGGGCTTCCCCGGG + Intergenic
1188772947 X:34176532-34176554 TCCAGCTCCAGGGCTTCCCCGGG - Intergenic
1189924332 X:45936998-45937020 CCCAGTTCCAGGGCTTCCCATGG - Intergenic
1190137186 X:47807736-47807758 GACAGCGCTCGGGCTTCCACTGG - Intergenic
1192501941 X:71660313-71660335 CCCGGCGCCAGGGCTGCCACAGG - Intergenic
1192509094 X:71711671-71711693 CCCGGCGCCAGGGCTGCCACAGG - Intergenic
1192517603 X:71769882-71769904 CCCGGCGCCAGGGCTGCCACAGG + Intergenic
1195668493 X:107450400-107450422 CCCTGGGCTCGGGCTTCGCCGGG - Intergenic
1197254559 X:124249084-124249106 CCCAGTGCCAGGGCTTCCTAAGG + Intronic
1197346290 X:125327823-125327845 CCCAGCCCCTGGGCACCCCCTGG - Intergenic
1199747016 X:150778329-150778351 CCCAGAGCCCGGGGTTCTCAGGG + Intronic
1200003437 X:153073298-153073320 CCCAGTGCCGGGGATTTCCCTGG - Exonic
1200004286 X:153076711-153076733 CCCAGTGCCGGGGATTTCCCTGG + Intergenic
1200151247 X:153952474-153952496 CCGAGCGGCCCGGCTTCCCCAGG + Intronic
1201150221 Y:11091557-11091579 CCCAGGGCCTGGTGTTCCCCTGG - Intergenic
1201176863 Y:11314954-11314976 CCCAGTCCCCGGGCTTCCGCGGG - Intergenic
1201177991 Y:11321591-11321613 CCCCGTCCCCGGGCTTCCGCGGG - Intergenic