ID: 1147195598

View in Genome Browser
Species Human (GRCh38)
Location 17:38764558-38764580
Sequence ATTCTAAGCTCTGGCATCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147195598_1147195602 0 Left 1147195598 17:38764558-38764580 CCATTGATGCCAGAGCTTAGAAT No data
Right 1147195602 17:38764581-38764603 CCTTTTCACTCAAACTCTACGGG No data
1147195598_1147195605 29 Left 1147195598 17:38764558-38764580 CCATTGATGCCAGAGCTTAGAAT No data
Right 1147195605 17:38764610-38764632 CTTACATCTTTTATTGCTTCAGG No data
1147195598_1147195600 -1 Left 1147195598 17:38764558-38764580 CCATTGATGCCAGAGCTTAGAAT No data
Right 1147195600 17:38764580-38764602 TCCTTTTCACTCAAACTCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147195598 Original CRISPR ATTCTAAGCTCTGGCATCAA TGG (reversed) Intergenic
No off target data available for this crispr