ID: 1147195676

View in Genome Browser
Species Human (GRCh38)
Location 17:38765117-38765139
Sequence CTACACAGCTGGAGGCGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147195667_1147195676 -6 Left 1147195667 17:38765100-38765122 CCTAGCCAGAGTTCGTTCTACAC No data
Right 1147195676 17:38765117-38765139 CTACACAGCTGGAGGCGGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147195676 Original CRISPR CTACACAGCTGGAGGCGGGG GGG Intergenic
No off target data available for this crispr