ID: 1147200634

View in Genome Browser
Species Human (GRCh38)
Location 17:38799391-38799413
Sequence CTGCACCAGCACCACGGCGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 148}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147200634_1147200640 -4 Left 1147200634 17:38799391-38799413 CCACCGCCGTGGTGCTGGTGCAG 0: 1
1: 0
2: 0
3: 17
4: 148
Right 1147200640 17:38799410-38799432 GCAGTTGGACGACATGCCCGGGG 0: 1
1: 0
2: 0
3: 6
4: 48
1147200634_1147200639 -5 Left 1147200634 17:38799391-38799413 CCACCGCCGTGGTGCTGGTGCAG 0: 1
1: 0
2: 0
3: 17
4: 148
Right 1147200639 17:38799409-38799431 TGCAGTTGGACGACATGCCCGGG 0: 1
1: 0
2: 0
3: 5
4: 77
1147200634_1147200653 27 Left 1147200634 17:38799391-38799413 CCACCGCCGTGGTGCTGGTGCAG 0: 1
1: 0
2: 0
3: 17
4: 148
Right 1147200653 17:38799441-38799463 GCGGCGGCGAAAGAGGGGGGCGG 0: 1
1: 0
2: 2
3: 25
4: 331
1147200634_1147200643 5 Left 1147200634 17:38799391-38799413 CCACCGCCGTGGTGCTGGTGCAG 0: 1
1: 0
2: 0
3: 17
4: 148
Right 1147200643 17:38799419-38799441 CGACATGCCCGGGGCGGCGGCGG 0: 1
1: 0
2: 0
3: 17
4: 133
1147200634_1147200649 21 Left 1147200634 17:38799391-38799413 CCACCGCCGTGGTGCTGGTGCAG 0: 1
1: 0
2: 0
3: 17
4: 148
Right 1147200649 17:38799435-38799457 GCGGCGGCGGCGGCGAAAGAGGG 0: 1
1: 1
2: 12
3: 149
4: 726
1147200634_1147200648 20 Left 1147200634 17:38799391-38799413 CCACCGCCGTGGTGCTGGTGCAG 0: 1
1: 0
2: 0
3: 17
4: 148
Right 1147200648 17:38799434-38799456 GGCGGCGGCGGCGGCGAAAGAGG 0: 2
1: 10
2: 205
3: 1637
4: 2723
1147200634_1147200644 8 Left 1147200634 17:38799391-38799413 CCACCGCCGTGGTGCTGGTGCAG 0: 1
1: 0
2: 0
3: 17
4: 148
Right 1147200644 17:38799422-38799444 CATGCCCGGGGCGGCGGCGGCGG 0: 1
1: 0
2: 7
3: 128
4: 696
1147200634_1147200641 -1 Left 1147200634 17:38799391-38799413 CCACCGCCGTGGTGCTGGTGCAG 0: 1
1: 0
2: 0
3: 17
4: 148
Right 1147200641 17:38799413-38799435 GTTGGACGACATGCCCGGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 46
1147200634_1147200650 22 Left 1147200634 17:38799391-38799413 CCACCGCCGTGGTGCTGGTGCAG 0: 1
1: 0
2: 0
3: 17
4: 148
Right 1147200650 17:38799436-38799458 CGGCGGCGGCGGCGAAAGAGGGG 0: 1
1: 0
2: 5
3: 89
4: 474
1147200634_1147200645 11 Left 1147200634 17:38799391-38799413 CCACCGCCGTGGTGCTGGTGCAG 0: 1
1: 0
2: 0
3: 17
4: 148
Right 1147200645 17:38799425-38799447 GCCCGGGGCGGCGGCGGCGGCGG 0: 3
1: 29
2: 258
3: 2229
4: 5089
1147200634_1147200638 -6 Left 1147200634 17:38799391-38799413 CCACCGCCGTGGTGCTGGTGCAG 0: 1
1: 0
2: 0
3: 17
4: 148
Right 1147200638 17:38799408-38799430 GTGCAGTTGGACGACATGCCCGG 0: 1
1: 0
2: 0
3: 7
4: 49
1147200634_1147200654 30 Left 1147200634 17:38799391-38799413 CCACCGCCGTGGTGCTGGTGCAG 0: 1
1: 0
2: 0
3: 17
4: 148
Right 1147200654 17:38799444-38799466 GCGGCGAAAGAGGGGGGCGGCGG 0: 1
1: 0
2: 1
3: 17
4: 309
1147200634_1147200642 2 Left 1147200634 17:38799391-38799413 CCACCGCCGTGGTGCTGGTGCAG 0: 1
1: 0
2: 0
3: 17
4: 148
Right 1147200642 17:38799416-38799438 GGACGACATGCCCGGGGCGGCGG 0: 1
1: 0
2: 1
3: 10
4: 119
1147200634_1147200651 23 Left 1147200634 17:38799391-38799413 CCACCGCCGTGGTGCTGGTGCAG 0: 1
1: 0
2: 0
3: 17
4: 148
Right 1147200651 17:38799437-38799459 GGCGGCGGCGGCGAAAGAGGGGG 0: 1
1: 1
2: 45
3: 286
4: 2222
1147200634_1147200652 24 Left 1147200634 17:38799391-38799413 CCACCGCCGTGGTGCTGGTGCAG 0: 1
1: 0
2: 0
3: 17
4: 148
Right 1147200652 17:38799438-38799460 GCGGCGGCGGCGAAAGAGGGGGG 0: 1
1: 1
2: 5
3: 57
4: 402

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147200634 Original CRISPR CTGCACCAGCACCACGGCGG TGG (reversed) Exonic
900251008 1:1669696-1669718 CTACACCAGCGCCGCTGCGGTGG - Exonic
900414715 1:2529698-2529720 CTGCACCAGGACTACAGCGAAGG - Exonic
900558688 1:3292778-3292800 CTCCACCAGCACATCGGTGGGGG + Intronic
901751611 1:11413573-11413595 CAGCACCAGGGCCACGGCAGTGG - Intergenic
903431916 1:23310802-23310824 CTCCACCACCACCAAGGGGGAGG - Exonic
903542960 1:24107187-24107209 CTCCTCCAGCTCCACGGCAGAGG + Exonic
907159298 1:52359284-52359306 CTGCACTCGCTCCACGGCTGGGG + Exonic
909974321 1:82027364-82027386 CTGCACCAGCACCAGGATGCAGG - Intergenic
911664717 1:100539556-100539578 CTGCGCCAGCAGCGCCGCGGCGG - Exonic
912354219 1:109041955-109041977 CGGCAGGAGCACGACGGCGGCGG + Exonic
917459228 1:175214804-175214826 CTCCACCAGCACCACCCCAGAGG + Intergenic
920190469 1:204190589-204190611 CTGCACCAGCACCGCGCCCTGGG + Exonic
922500389 1:226093241-226093263 CTGCACCAGGACCTCTGTGGAGG + Intergenic
1063071065 10:2664784-2664806 CAGCCCCAGCACCACAGCAGGGG + Intergenic
1065034601 10:21624941-21624963 CTTCACCACCACCAAGGGGGAGG - Intronic
1070325187 10:75384222-75384244 CTGCACCATCACCAGGAGGGAGG - Intergenic
1072263669 10:93706527-93706549 CTGCACAAGAAGCACGGCTGGGG - Intergenic
1075852887 10:125603310-125603332 CTGCACCAGAAACCTGGCGGGGG + Intronic
1076026310 10:127117326-127117348 CTCAATCAGCACCACGGCGGTGG - Intronic
1076676091 10:132148532-132148554 CTGCAGCAGGGCCACGGGGGCGG - Intronic
1076901409 10:133340224-133340246 CTGACCCAGCACAAAGGCGGAGG - Intronic
1076908881 10:133377749-133377771 CTGCCCCAGCTCCCCAGCGGAGG - Intergenic
1077061347 11:619118-619140 CTGGACCAGCACCACTTCCGAGG - Exonic
1077501545 11:2911734-2911756 CTGCTCCAGCACCATGGCCACGG - Intronic
1083901808 11:65646973-65646995 CTGGACCTGTACCACGGCCGCGG + Exonic
1084758305 11:71252543-71252565 CTGCACCTGAGCCGCGGCGGCGG - Intronic
1084791429 11:71477504-71477526 CAGCACCTGCACCACTGCGGCGG - Intronic
1089083345 11:115796129-115796151 CTCCACCAGCATCACTGTGGTGG - Intergenic
1090188099 11:124751488-124751510 CTGCACCTACAGCACGTCGGTGG - Exonic
1091612718 12:2024859-2024881 CTGCACCAGCTCCTTGGAGGAGG - Intronic
1092254603 12:6919560-6919582 CTTCACCAGCTCCAAGGCTGGGG - Exonic
1095891904 12:47242639-47242661 CTGCACCAGCCCTAAGGCAGTGG + Intergenic
1096134588 12:49188796-49188818 CTGCACCCGCACTGCGGCGGCGG + Intronic
1103870943 12:124091223-124091245 CTGCACCAGGATCTCGGTGGTGG + Intronic
1104848028 12:131856842-131856864 CTGCACTTGCACCATGGTGGGGG + Intergenic
1105415972 13:20211537-20211559 CTCCACCAACACCATGGTGGGGG - Intergenic
1115754283 14:36517687-36517709 CTGCAGCAGGACAGCGGCGGCGG - Exonic
1117388562 14:55241060-55241082 CGGCCCCAGCACGACGGCGATGG + Intergenic
1120722678 14:87905481-87905503 CTGCCCCAGCACCACAGCAGTGG - Intronic
1121273517 14:92652699-92652721 CTCCACCAGCAGCACGGAGGAGG + Exonic
1122120741 14:99552206-99552228 CTGCCCCTGCACCACTGGGGAGG + Intronic
1125155402 15:36579647-36579669 CTCCACCGGCACCTCCGCGGCGG - Exonic
1128235648 15:66065563-66065585 CTGCCCAAGGACCACGGCTGTGG - Intronic
1132080039 15:98855895-98855917 CTGCACCAGCATCACGGGGCTGG - Intronic
1132567498 16:630173-630195 CTGCCCCAGCCCCCCGTCGGCGG - Intronic
1132629243 16:908863-908885 CTGCCCCAGCCGCACGGGGGTGG - Intronic
1134509338 16:14833898-14833920 CAGCAGCAGCACCACCGCGGCGG - Exonic
1134697043 16:16232713-16232735 CAGCAGCAGCACCACCGCGGCGG - Exonic
1134974800 16:18561972-18561994 CAGCAGCAGCACCACCGCGGCGG + Exonic
1136233017 16:28898471-28898493 CTTCACCAGCTCCACGACAGTGG - Intronic
1137055871 16:35746484-35746506 CTGCACCAACACCACGGCCTGGG + Intergenic
1139696835 16:68681018-68681040 CGGCTCCACCACCACGGCAGTGG + Exonic
1140469145 16:75204994-75205016 CTGCACCATCACCACGATGTTGG + Intronic
1140472639 16:75223945-75223967 CTGCACCATCACCACGATGTTGG - Intronic
1140927565 16:79599145-79599167 CTGCACCCGCACCACGCCGCCGG - Exonic
1142472796 17:172536-172558 CTGCACCATCACCAAGGCCAAGG - Exonic
1142495708 17:305324-305346 CTGCACCTGCCACACTGCGGAGG + Intronic
1142764708 17:2058639-2058661 CTGCGCCAGCAGCTCGGCCGCGG - Exonic
1143766365 17:9140323-9140345 CTGCCACAGCACCAGGGCAGGGG - Intronic
1145234373 17:21198420-21198442 CCGGACCAGCACCACCGGGGTGG + Exonic
1146629289 17:34458459-34458481 CTGCTCCAGGACCACTGCTGGGG - Intergenic
1147200634 17:38799391-38799413 CTGCACCAGCACCACGGCGGTGG - Exonic
1148135068 17:45286837-45286859 CTGCACCACCCCCAGGACGGAGG - Exonic
1148178025 17:45584702-45584724 CAGCACCAGCGCCCCGGCCGGGG - Intergenic
1148566514 17:48636049-48636071 CGGCACCAGCACCCCGGCCATGG - Intergenic
1150407913 17:64918988-64919010 CAGCACCAGCGCCCCGGCCGGGG - Intronic
1152439277 17:80295470-80295492 CTGCCCCAGCACCACAGCTAGGG - Intronic
1153410044 18:4782876-4782898 CTGCACCAGCACCCCAGGTGAGG + Intergenic
1156502042 18:37566207-37566229 CTGTACCATCGCCACGGCGCGGG - Intergenic
1160455040 18:78993797-78993819 CTGCACCAACGCCAGGGCCGGGG + Exonic
1160455117 18:78994237-78994259 CTGCTGCAGGACCACGGCGTTGG - Exonic
1160553429 18:79710969-79710991 CTGCACAAGCACCAGGGCTCAGG - Intronic
1162823263 19:13236197-13236219 ATGCACAAACACCAGGGCGGGGG + Intronic
1164610739 19:29629918-29629940 CTGCAACAGCACCAGGCCTGAGG + Intergenic
1167271469 19:48508916-48508938 CTTCACCACCACCTGGGCGGGGG + Exonic
1167426844 19:49433994-49434016 CTGCACAAGGACCCCGGCGAGGG + Exonic
1167577143 19:50323178-50323200 CCCCACCCGCACCACGGCAGCGG - Exonic
925177758 2:1797178-1797200 CAGCACCAGCAGAACGGCCGAGG - Intronic
926357083 2:12050602-12050624 CTGCACCAGCACAGCTGTGGTGG - Intergenic
926727945 2:16013171-16013193 CAGCACCTGCACCTCGGAGGTGG - Intergenic
927559415 2:24059359-24059381 CTGGACCAGCACCTGGGGGGGGG + Intronic
932657179 2:73620210-73620232 CTCCACCACCACCAAGGCTGGGG + Intergenic
932663849 2:73680453-73680475 CTCCACCACCACCAAGGCTGGGG + Intergenic
933553339 2:83802799-83802821 CTCCACCAGCACCACAGTGTGGG + Intergenic
937871799 2:126791590-126791612 CTCCACCTGCACCACAGCTGAGG + Intergenic
938548121 2:132353253-132353275 CTGCAGCAGCTGCACGGGGGCGG + Intergenic
940010588 2:149050629-149050651 CTGTGCCAGCACCACAGAGGTGG + Intronic
942046151 2:172100577-172100599 CACCACCACCATCACGGCGGCGG - Exonic
944199535 2:197091203-197091225 CTGCAGCAGCATCCAGGCGGGGG - Intronic
1169020631 20:2328295-2328317 GTACATCAGCACCAAGGCGGTGG + Exonic
1169030589 20:2403753-2403775 ATGCATCAGCACCAAGGCGGTGG + Exonic
1170629650 20:18056499-18056521 CTGCACCTGCCCCTGGGCGGCGG - Intronic
1170905792 20:20514446-20514468 CTGCACCAGGATCTCGGCAGAGG - Intronic
1171876990 20:30586025-30586047 CTGCAGCAGCTGCACGGGGGCGG + Intergenic
1174428154 20:50448053-50448075 CTGCACCCGGACCACTGCAGTGG - Intergenic
1175741344 20:61421713-61421735 CGGCACCAGAACCCCGGCAGGGG - Intronic
1181001982 22:19992086-19992108 CTGCGCCAGCAACACGGTGCGGG + Intronic
1181167798 22:20992729-20992751 CTGCACCAGCCGCACTGTGGAGG + Intronic
1181344455 22:22208105-22208127 CTGCACCTGCACCACCGAGCAGG + Intergenic
1182321370 22:29480199-29480221 CTGCGGCAGCACCAGGGCGCCGG - Intergenic
1182549535 22:31093435-31093457 CCCCACCAGCACCATGCCGGGGG + Intronic
1183612948 22:38922894-38922916 CAGCACCAGCCCCACGTCGTTGG - Intergenic
1185269905 22:49924681-49924703 CTGCACCAGCCTCTCGCCGGTGG + Intronic
950195489 3:11006461-11006483 CTGAACCAGGACCATGGTGGGGG - Intronic
952511134 3:34057319-34057341 CTCCACCTGCACCACAGCTGAGG - Intergenic
952905452 3:38136910-38136932 GTGCACCACCACCACGTCCGCGG + Exonic
953822918 3:46223818-46223840 CTGCACCAGCACCCTGTCCGTGG - Intronic
954701284 3:52452184-52452206 CTGCATCAGCACCAAGGAGCTGG - Exonic
962241536 3:133754820-133754842 CTGCACCAGCAGCACTTGGGAGG + Intronic
968498497 4:932173-932195 CTGCAGCAGCGACATGGCGGTGG + Exonic
968509609 4:989658-989680 CAGCACCAGCAGCACCACGGTGG + Exonic
968669512 4:1841491-1841513 CTTCACCACCACCTCTGCGGGGG + Exonic
977009802 4:91623106-91623128 CTGCTCCAGCAGCAGGGCCGTGG + Intergenic
986466925 5:8035000-8035022 CAGCAGCAGCACCAGGGAGGAGG + Intergenic
991690120 5:69217688-69217710 CGGAGCCAGCCCCACGGCGGAGG + Intergenic
992690423 5:79236211-79236233 CTGCAGCAGCACCAGGGGCGGGG + Exonic
998250262 5:140547791-140547813 CTGCTACAGCACCACGCCGGGGG + Exonic
998692952 5:144607355-144607377 CTTCACCAGCATCAAGGTGGTGG + Intergenic
998799678 5:145856529-145856551 CTGCCCCAGCAGCAAGGGGGCGG + Intergenic
999697711 5:154201247-154201269 CTCCACCAGTATCACGGTGGAGG + Intronic
1007689212 6:43687833-43687855 CTGCCCCACCACTGCGGCGGCGG - Intergenic
1016574653 6:145555271-145555293 CTGGACCAGCTCCAGGGCAGAGG + Intronic
1017715271 6:157206590-157206612 CTGCACTGGCAGCTCGGCGGGGG + Exonic
1018682569 6:166275893-166275915 CTGCACCAGCAGCCCGGGCGAGG - Intergenic
1019461676 7:1162381-1162403 CCTCACCAGCTGCACGGCGGTGG + Intergenic
1021857653 7:24873220-24873242 CTGAACCAGCACCAGGGAGCAGG + Intronic
1023831416 7:44040723-44040745 CTGCTCCAGCACCTCGGCCTCGG + Intergenic
1029506480 7:100966472-100966494 CAGCACCAGCAGCGCGGCGCCGG - Exonic
1029741741 7:102495025-102495047 CTGCTCCAGCACCTCGGCCTCGG + Exonic
1029759732 7:102594194-102594216 CTGCTCCAGCACCTCGGCCTCGG + Exonic
1029777095 7:102690104-102690126 CTGCTCCAGCACCTCGGCCTCGG + Intergenic
1033063594 7:138130721-138130743 CTAGAACAGCACCACGGGGGTGG + Intergenic
1033477108 7:141701965-141701987 CTGCAGCAGCACCTCCGGGGCGG + Exonic
1034539017 7:151744297-151744319 CTGGACCAGCACCACGTTAGTGG - Intronic
1037814119 8:22102928-22102950 CTGAGCCAGCACCAGGGCGGTGG + Exonic
1037900999 8:22689712-22689734 CGGCAGCAGCACCGCGTCGGCGG + Exonic
1039791087 8:40875991-40876013 CTCCACCAGCACCACAGAAGAGG + Intronic
1040668536 8:49658926-49658948 CTGCACCCCCACCACAGCAGTGG - Intergenic
1047333748 8:123916859-123916881 CTGCAGTAGCACCACGGCTGGGG + Intronic
1047381867 8:124372054-124372076 CCGCAGCAGCACCAGGACGGCGG + Exonic
1048318754 8:133382224-133382246 CTGCATCAGCCCCATGGCGAGGG + Intergenic
1049180198 8:141218290-141218312 CTTGATCAGCACCACGGCGTTGG + Exonic
1049248444 8:141575419-141575441 CCCCACCACCACCATGGCGGTGG + Intergenic
1049422772 8:142524288-142524310 CAGTACCAGCACAACGGCAGCGG - Exonic
1049678160 8:143902707-143902729 CAGCACAAGGTCCACGGCGGCGG - Intergenic
1049791080 8:144473029-144473051 CTGCAGCAGCAGCACCGCGGTGG - Exonic
1050388159 9:5111710-5111732 CTGCACCAGCACGAGCGCGTGGG + Intronic
1052872646 9:33523675-33523697 CTGCAGCAGCTGCACGGGGGCGG + Intergenic
1053049117 9:34943901-34943923 CAGCACTAGCACCACAGTGGTGG - Intergenic
1053752314 9:41269178-41269200 CTGCAGCAGCTGCACGGGGGCGG - Intergenic
1053752764 9:41273435-41273457 CTGCAGCAGCTGCACGGGGGCGG - Intergenic
1054257841 9:62833510-62833532 CTGCAGCAGCTGCACGGGGGCGG - Intergenic
1054258289 9:62837787-62837809 CTGCAGCAGCTGCACGGGGGCGG - Intergenic
1054333481 9:63782254-63782276 CTGCAGCAGCTGCACGGGGGCGG + Intergenic
1054351589 9:64021300-64021322 CTGCAGCAGCTGCACGGGGGCGG + Intergenic
1058595699 9:106613308-106613330 CTGCACCAGCATCAAGGCAGAGG - Intergenic
1061000241 9:127898836-127898858 CGGCACAGGCACCAGGGCGGGGG + Intronic
1061668659 9:132175407-132175429 CTGGACCAGCCCCACGGCACAGG - Intronic
1062044958 9:134420710-134420732 CTGCAGCGGCACCACTGAGGGGG + Intronic
1202800484 9_KI270719v1_random:170588-170610 CTGCAGCAGCTGCACGGGGGCGG + Intergenic
1202800930 9_KI270719v1_random:174870-174892 CTGCAGCAGCTGCACGGGGGCGG + Intergenic
1203773863 EBV:62214-62236 CTCCACCAGCTCCACGGCCATGG + Intergenic
1187446604 X:19366148-19366170 CTGCCCCAGCACAACAGCAGAGG + Intronic
1191722667 X:64247774-64247796 CTGCACCAGTTCCACAGCAGTGG - Intergenic
1193605812 X:83566938-83566960 CTGCAGCAGCACCACAGAAGGGG - Intergenic
1200233797 X:154458727-154458749 CCGGACCAGCAGCACGGTGGGGG + Intronic