ID: 1147200878

View in Genome Browser
Species Human (GRCh38)
Location 17:38800099-38800121
Sequence CCGCGGGTGGAGCGCGCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 129}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147200878_1147200888 -1 Left 1147200878 17:38800099-38800121 CCCCGGGCGCGCTCCACCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 129
Right 1147200888 17:38800121-38800143 GGGCACGCCCCTTGCCCCCAGGG 0: 1
1: 0
2: 1
3: 13
4: 170
1147200878_1147200899 29 Left 1147200878 17:38800099-38800121 CCCCGGGCGCGCTCCACCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 129
Right 1147200899 17:38800151-38800173 GAGAAGCAGGCCAGGAACACTGG No data
1147200878_1147200887 -2 Left 1147200878 17:38800099-38800121 CCCCGGGCGCGCTCCACCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 129
Right 1147200887 17:38800120-38800142 GGGGCACGCCCCTTGCCCCCAGG 0: 1
1: 0
2: 2
3: 16
4: 173
1147200878_1147200897 21 Left 1147200878 17:38800099-38800121 CCCCGGGCGCGCTCCACCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 129
Right 1147200897 17:38800143-38800165 GCCAATGAGAGAAGCAGGCCAGG No data
1147200878_1147200896 16 Left 1147200878 17:38800099-38800121 CCCCGGGCGCGCTCCACCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 129
Right 1147200896 17:38800138-38800160 CCAGGGCCAATGAGAGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147200878 Original CRISPR CCGCGGGTGGAGCGCGCCCG GGG (reversed) Intronic