ID: 1147201361

View in Genome Browser
Species Human (GRCh38)
Location 17:38804023-38804045
Sequence CAACAGAGTGAGACCTTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 698
Summary {0: 1, 1: 4, 2: 39, 3: 133, 4: 521}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147201353_1147201361 8 Left 1147201353 17:38803992-38804014 CCATGATCGCCCCACTGCACTCC 0: 11
1: 1340
2: 45516
3: 140407
4: 169567
Right 1147201361 17:38804023-38804045 CAACAGAGTGAGACCTTGTAGGG 0: 1
1: 4
2: 39
3: 133
4: 521
1147201355_1147201361 -1 Left 1147201355 17:38804001-38804023 CCCCACTGCACTCCAACCTAGGC 0: 7
1: 106
2: 1582
3: 2829
4: 2768
Right 1147201361 17:38804023-38804045 CAACAGAGTGAGACCTTGTAGGG 0: 1
1: 4
2: 39
3: 133
4: 521
1147201356_1147201361 -2 Left 1147201356 17:38804002-38804024 CCCACTGCACTCCAACCTAGGCA 0: 3
1: 82
2: 1181
3: 2622
4: 3719
Right 1147201361 17:38804023-38804045 CAACAGAGTGAGACCTTGTAGGG 0: 1
1: 4
2: 39
3: 133
4: 521
1147201357_1147201361 -3 Left 1147201357 17:38804003-38804025 CCACTGCACTCCAACCTAGGCAA 0: 131
1: 6010
2: 83310
3: 193679
4: 233568
Right 1147201361 17:38804023-38804045 CAACAGAGTGAGACCTTGTAGGG 0: 1
1: 4
2: 39
3: 133
4: 521

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147201361 Original CRISPR CAACAGAGTGAGACCTTGTA GGG Intronic
900544514 1:3220992-3221014 CAAGAGAGGGAGACCCTGTCTGG + Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901385313 1:8904424-8904446 CAACAGAGCGAGACCCTGTGAGG - Intergenic
901502431 1:9661406-9661428 CAACAGAATGAGACCCTATAAGG - Intronic
901650635 1:10740936-10740958 CGACAGGGTGAGACCCTGTCTGG + Intronic
901693936 1:10992479-10992501 CAACAGAGTGAGACTTCGTGGGG + Intergenic
901805291 1:11735020-11735042 CGACAGGGTGAGACCTTGTCTGG - Intergenic
902523781 1:17040472-17040494 CAGCAGAGTAAGACCATGCATGG - Intronic
902910226 1:19590587-19590609 CAACAGAGTGATACTCTGTCTGG + Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903303839 1:22398475-22398497 TGACAGAGTGAGACCCTGTCTGG + Intergenic
903873639 1:26456350-26456372 CAACAGAGGGAGACCCTGTCTGG + Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904065122 1:27743743-27743765 CAACAGAGCAAGACCCTGTTTGG + Intronic
904137859 1:28327991-28328013 CAACAGAGGGAGATCCTGTCTGG - Intergenic
904641441 1:31933701-31933723 CAACAGAGTAAGACTCTGTCTGG + Intronic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905324655 1:37142392-37142414 AAGCAGAGTGAGACCATGAAGGG + Intergenic
905844153 1:41212854-41212876 CAACAAAGTGAGACTCTGTCTGG + Intronic
906123638 1:43412313-43412335 CAACACAGCGAGACCTTCTATGG - Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906439753 1:45831008-45831030 CGACAGAGTGAGACCTTGTCTGG + Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907536242 1:55161350-55161372 CAACAGAGCGAGACTCTGTCTGG + Intronic
908326141 1:63025638-63025660 CAACAGAGTGAGACCCTTGTTGG - Intergenic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909000410 1:70210693-70210715 CAACAGAGCGAGACCCTGTAGGG + Intronic
909620491 1:77661834-77661856 CAACAGAGCAAGACCTCGTCTGG - Intronic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910180625 1:84478926-84478948 CTACAGAGTAAGACATGGTATGG - Intergenic
910419319 1:87040304-87040326 CCTCAGACTGAGACCTTGAAAGG - Intronic
911080437 1:93923808-93923830 TGACAGAGTGAGACCCTGTCTGG + Intergenic
911344221 1:96676831-96676853 CATCAGAGTGAGACATGGCAAGG - Intergenic
912422762 1:109556953-109556975 CAACAGAGTGAGACTGTCTCGGG - Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
913998199 1:143668711-143668733 CATGAAAGTGAGACCTTGTGAGG - Intergenic
914760604 1:150595377-150595399 CGACAGAGTGAGACCTGGTCTGG + Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914943486 1:152043208-152043230 CAACAGAGGGAAACCCTGTCTGG + Intronic
915139633 1:153759252-153759274 CAACAGAGCAAGACCCTGTCTGG + Intronic
915150256 1:153825066-153825088 CAACAGAGTGAGACCTTGTCAGG + Intronic
915186797 1:154112834-154112856 CAACAGAATGAGACCCTGTCTGG + Intronic
915295276 1:154916867-154916889 CAACATAGTGAGACCTTGTCTGG - Intergenic
915841042 1:159213210-159213232 CGACAGAGTGAGACCTTGTCTGG + Intergenic
916228434 1:162514267-162514289 CAACAGAGTGAGACCATCTCTGG + Intronic
916710811 1:167405665-167405687 GAACAGAGCGAGACCCTGTTTGG + Intronic
917219749 1:172716344-172716366 CATCAGAGTGAGCCCCTGGAGGG + Intergenic
917910293 1:179637693-179637715 CAACAGAGTAAGGCCCTGTCTGG + Intronic
917938044 1:179888433-179888455 CAACATACTGAGACCCTGTCTGG - Intronic
918025379 1:180739758-180739780 AAACATAGTGAGACCCTGTCTGG - Intronic
919745133 1:201004118-201004140 AAACAGAGAGAGACATTCTAAGG - Intronic
920120703 1:203654865-203654887 TGACAGAGTGAGACCTCGTCTGG + Intronic
921782323 1:219180014-219180036 CAACAGAGTGAGACTCTGTCTGG - Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922571137 1:226635238-226635260 CGACAGAGTAAGACCCTGTCTGG - Intronic
922643291 1:227258153-227258175 CAACAGGGTGAAACCCTGTCCGG + Intronic
922731663 1:227951743-227951765 CAACAGAGTGAGACTCTGTCTGG + Intergenic
923072443 1:230577926-230577948 CAACAGAACAAGACCTTGTCTGG - Intergenic
923157828 1:231293969-231293991 CAACAGAGTGAGACTCTGTCTGG + Intergenic
924213202 1:241791650-241791672 CGAAAGAGTGAGACCCTGTCTGG + Intronic
924237887 1:242014431-242014453 CAACAGAGCAAGACCCTGTCTGG - Intergenic
924943591 1:248829775-248829797 CATCAGAGGGAGACCGTGCAGGG - Intergenic
1062939034 10:1408016-1408038 TAACAGTGTGAGCCCTTGGAAGG - Intronic
1062947625 10:1473400-1473422 CAACAGAGTGAGGCCCTGTCAGG - Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063108799 10:3017383-3017405 CAGCAGAGTGAGACTCTGTTTGG + Intergenic
1063132361 10:3189191-3189213 CAACAGAGAGAGGCCCTGTCAGG - Intergenic
1063158434 10:3401019-3401041 CAACAAAGTGAGACTCTGTCTGG + Intergenic
1063162737 10:3431416-3431438 TAATAGAGTTAGACCTAGTAGGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064180642 10:13111674-13111696 CGACAGAGTGAGACTCTGTCTGG + Intronic
1064706048 10:18073730-18073752 CAACAGAGCGAGACCCTGTCTGG - Intergenic
1064997167 10:21306436-21306458 TGACAGAGTGAGACCCTGTCTGG - Intergenic
1065164496 10:22960900-22960922 CAACAGAGGGAGAGCTTGCTGGG - Intronic
1065785564 10:29210535-29210557 CAAAAGAGTAAGTTCTTGTAAGG - Intergenic
1065914742 10:30344722-30344744 CAATAGAGTGAGACTCTGTCTGG - Intronic
1065925283 10:30429626-30429648 CGACAGAGTGAGACTGTGTCTGG + Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069058619 10:63870655-63870677 AGACAGAGTGAGACCCTGTCTGG - Intergenic
1069099397 10:64299589-64299611 CAACAGCGTGAGACCCTGTCTGG + Intergenic
1070348210 10:75566053-75566075 TGACAGAGTGAGATCCTGTAAGG + Intronic
1071205411 10:83270380-83270402 GAACAGAGTGAGACATTCTATGG + Intergenic
1071386176 10:85123626-85123648 CAACAAAGGGAGACCATGTTGGG + Intergenic
1071548232 10:86545015-86545037 CAACACAGTGAGACCCTGTCTGG - Intergenic
1072095214 10:92171632-92171654 CAACAGAGTGAGACTCTCTCTGG - Intronic
1072264351 10:93713193-93713215 CCTCAGAGTAAGACATTGTATGG + Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072606715 10:96990185-96990207 CGACAGAGTGAGACCCTGTCTGG - Intergenic
1073141375 10:101250551-101250573 CAACAGAGTGAGACTGTCTCAGG - Intergenic
1073337670 10:102722552-102722574 CGACAGAGTGAGACCCTGTCTGG - Intronic
1075169573 10:120101150-120101172 CAACATAGTGAGACCCTGTGTGG - Intergenic
1075320340 10:121486460-121486482 CAACAGAGCGAGACTCTGTCTGG - Intronic
1075569084 10:123526242-123526264 CAACCTTGTGGGACCTTGTAAGG + Intergenic
1075991522 10:126842639-126842661 CCACAGAGTCAGACCATATAAGG + Intergenic
1077434869 11:2534139-2534161 CAGCAAAGTGAGACCCTGTAGGG + Intronic
1077438480 11:2556285-2556307 CCTCAGAGTGTGACCTTGTTTGG - Intronic
1077592323 11:3501755-3501777 TGACAGAGTGAGACCCTGTATGG + Intergenic
1077616773 11:3681057-3681079 CAACACCGTGAGACCCTGTCTGG - Intronic
1077967727 11:7153612-7153634 GGAGAGAGTCAGACCTTGTAGGG - Intergenic
1078108272 11:8372292-8372314 TTGCAGAGTGAGACCTTGTAAGG - Intergenic
1078125451 11:8557229-8557251 CAACAGAGGGGGACCTTGTGGGG + Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078297429 11:10088041-10088063 CAACAGAGTGAGACCTTGTCTGG - Intronic
1078676158 11:13416332-13416354 CAACACAGTGAGACCCTGTCTGG + Intronic
1078791422 11:14546455-14546477 CAACAGAGCGAGACTCTGTCTGG - Intronic
1079255770 11:18828398-18828420 CAACAGAGCGAGACTCTGTCAGG - Intergenic
1079431749 11:20396616-20396638 CAACAGAGCAAGACTTTGTCGGG + Intronic
1082859222 11:57838059-57838081 TGACAGAGTGAGACCCTGTCTGG - Intergenic
1083802432 11:65054216-65054238 CAACTGAGGGAGACCTGGTCTGG + Intronic
1083840171 11:65299709-65299731 CGACAGAGTGAGACTCTGTCGGG - Intronic
1083847141 11:65342424-65342446 TAACAGAGGGAGACCCTGTCTGG + Intronic
1084248160 11:67874475-67874497 TGACAGAGTGAGACCCTGTATGG + Intergenic
1084469028 11:69344397-69344419 CCTCAGAGTGTGACCTTATATGG + Intronic
1084824665 11:71721012-71721034 TGACAGAGTGAGACCCTATATGG - Intergenic
1085030547 11:73268602-73268624 TGACAGAGTGAGACCCTGTCTGG + Intronic
1085421477 11:76365402-76365424 CGACAGAGTGAGCGCTTGTCTGG - Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085547338 11:77332292-77332314 TGACAGAGTGAGACCCTGTGGGG + Intronic
1085650502 11:78263611-78263633 CGACAGAGTGAGACTCTGTCTGG + Intronic
1086057110 11:82659505-82659527 CAACAGAGTGAGACTCTGTCAGG + Intergenic
1086371012 11:86155866-86155888 CAACATAGTGAAACCTAGTAAGG + Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088414958 11:109578475-109578497 CAACATACTGAGATCTTGCATGG + Intergenic
1088546103 11:110960733-110960755 CAACAGAGAGAGACTCTGTCTGG - Intergenic
1088707049 11:112473163-112473185 CAACAGAGCGAGACTCTGTCTGG + Intergenic
1089727562 11:120495992-120496014 CAACAGAGTGAGACTCAGTCAGG - Intergenic
1090419846 11:126567167-126567189 CCTCAGAGTGTGACCTTGTTTGG + Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1090984760 11:131756396-131756418 CAACATAGAAAGACCTTGTCTGG + Intronic
1091232224 11:133996076-133996098 TAACAGACTGAGACCCTGTCTGG + Intergenic
1092053911 12:5493256-5493278 CAACAGAATGAGAGCGTGGATGG + Intronic
1092418443 12:8309867-8309889 TGACAGAGTGAGACCCTGTATGG + Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1092851780 12:12635347-12635369 TGACAGAGTGAGACCCTGTCTGG + Intronic
1092870427 12:12801116-12801138 CAAGAGATTGAGACCTTGGGAGG + Intronic
1093400098 12:18735423-18735445 TAACATAGTGAGACCCTGTTTGG - Intronic
1093470949 12:19501615-19501637 CTACAAAGTGAGACCCTGTCTGG + Intronic
1093849533 12:24018776-24018798 CAACAGAGTAAGACTCTGTCTGG + Intergenic
1094048549 12:26194968-26194990 CAACACAGTGAGCCCCTGTTTGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094138708 12:27157843-27157865 TAACAGAAAGAGGCCTTGTAAGG - Intergenic
1096623376 12:52878389-52878411 CAACAGAACGAGACCCTGTCTGG + Intergenic
1096786622 12:54020460-54020482 CGACAGAATGCGACCTTGTTTGG + Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098849698 12:75580813-75580835 CAACAGAGTGAGACTCTGTCTGG + Intergenic
1098970322 12:76847836-76847858 TGACAGAGCGAGACCTTGTCTGG + Intronic
1099667151 12:85646075-85646097 CAAAAGAGTGAGACTTAGAAAGG - Intergenic
1100535629 12:95506075-95506097 CGACAGAGTGAGACTTCGTCTGG + Intronic
1101925567 12:108968811-108968833 CAACAGAGCGAGACTCTGTCTGG - Intronic
1102070599 12:110015969-110015991 CAACAGAGCGAGATACTGTATGG - Intronic
1102267685 12:111501909-111501931 CAACGGAGTCAGACCCTGTTTGG - Intronic
1102686014 12:114725273-114725295 CAACAAAGAGAGACCCTGTCTGG - Intergenic
1103406587 12:120680151-120680173 CAACAGAGTAAGACTCTGTATGG + Intergenic
1104012020 12:124938129-124938151 TAAAGCAGTGAGACCTTGTAAGG - Intergenic
1104013825 12:124949586-124949608 CATCAGCGTGTGACCTTATATGG + Intronic
1104839405 12:131814703-131814725 CAACATATTGAGACCCTGTCTGG + Intergenic
1104869971 12:131988012-131988034 CAACAGAGCAAGACCCTGTCTGG - Intronic
1105435039 13:20369381-20369403 CAACAGAGCGAGACCCTGTCTGG - Intergenic
1106275590 13:28202980-28203002 CAACAGAGTGAGACCCTGTCTGG - Intronic
1106418812 13:29568751-29568773 CATGAGACTGAGACCTTGTGTGG + Intronic
1107184194 13:37497849-37497871 CAACAGAGTAAGACTATGTCCGG + Intergenic
1107799377 13:44089960-44089982 CAACAGAATGTGACCTTATTTGG - Intergenic
1107917203 13:45164704-45164726 TGACAGAGTGAGACCCTGTCTGG + Intronic
1108953467 13:56119859-56119881 CAACAGAGCGAGACTCTGTCTGG + Intergenic
1109244629 13:59938587-59938609 CAACAGAGGCAGACCTTGTTTGG + Intronic
1109515775 13:63441031-63441053 TAACAGAGTATGACCTTCTAGGG + Intergenic
1109534472 13:63698449-63698471 CAACAGAGTGAAACCCTGTCAGG + Intergenic
1110198213 13:72815683-72815705 TGACAGACTGAGACCTTGTCTGG - Intronic
1110441760 13:75533987-75534009 CAACAGACTGAGATCCTGTCTGG - Intronic
1110566574 13:76963405-76963427 CAACAAAGTAAGACCCTGTCTGG + Intergenic
1111216455 13:85149138-85149160 CAACAGAGCGAGACCCTGACTGG - Intergenic
1111703970 13:91724835-91724857 CGACAGAGTGAGATCCTGTCTGG + Intronic
1111768965 13:92572013-92572035 CAACAGAATGAGCCCCTGTCTGG + Intronic
1111957587 13:94775536-94775558 CAACAGAGTGAGGCCTTGTCAGG + Intergenic
1112763856 13:102719856-102719878 CAACAGAGTAAGACCCTGTCTGG + Intergenic
1113225144 13:108151616-108151638 CAGCAGAGTGAGACCCTGTCTGG + Intergenic
1113723707 13:112581463-112581485 CGACAGAGTGAGACCTTGTCTGG - Intronic
1113765042 13:112875925-112875947 CAACAGAGAGAGTCCAGGTACGG + Exonic
1114175830 14:20318780-20318802 CGACAGAGTGAGACCCTATCTGG - Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1114446021 14:22788682-22788704 CGACAGAGTGAGACTCTGTCTGG + Intronic
1114943164 14:27641798-27641820 TGACAGAGGGAGACCTTTTAGGG + Intergenic
1115394205 14:32889169-32889191 TGACAGAGTGAGACCTTATGAGG + Intergenic
1115632569 14:35260029-35260051 CAACAGAGTGAAACCCTATCTGG - Intronic
1115635025 14:35282861-35282883 CAACAGAGTGAGACCCCACAGGG + Intronic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116919532 14:50558337-50558359 CAACAGAGGGAGACTGTGTCTGG + Intronic
1116983106 14:51191789-51191811 CAACAGAGTGAGACTGTCTCAGG + Intergenic
1118181533 14:63498575-63498597 TGACAGAGTGAGACCCTGTCTGG - Intronic
1119054716 14:71407524-71407546 CAACAAAGTGAGACCCTGGGAGG - Intronic
1119458668 14:74779659-74779681 CAACAGAGTGAGACCCTGTCTGG - Intronic
1119548407 14:75490441-75490463 CAACATAGTGAGACTCTGTCTGG - Intergenic
1119815626 14:77564210-77564232 CAACAGAGGGAGACTCTGTCTGG + Intronic
1119951723 14:78752219-78752241 CAACAGGGTGAAACCCTGTTTGG + Intronic
1120628254 14:86856469-86856491 CATCAGAATGTGACCTTGTCTGG + Intergenic
1120641578 14:87020025-87020047 CAACAGAGTGATAACTGGAAAGG - Intergenic
1120648203 14:87098584-87098606 GAACAGAGTGATACCCAGTATGG + Intergenic
1120679973 14:87469547-87469569 GTACAGAGTGAGACCCTGTGGGG - Intergenic
1120748008 14:88169016-88169038 CAACACAGTCATACCTTCTAGGG + Intergenic
1121248015 14:92477486-92477508 CAACAGAGTGAGGTCTTGTCTGG - Intronic
1122085564 14:99299562-99299584 AAAAAGAGTGAGACCCTGTCTGG + Intergenic
1122233076 14:100316918-100316940 CAACAGAGCGAGACTCTGTCTGG - Intergenic
1122494813 14:102145556-102145578 CAACACAGTGAAACCTCGTGTGG + Intronic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122581613 14:102775401-102775423 CGACAGAGTGAGACTCTGTCTGG - Intergenic
1123068943 14:105631805-105631827 CCACAGAATGTGACCTTGTTTGG - Intergenic
1123093020 14:105750533-105750555 CCACAGAATGTGACCTTGTTTGG - Intergenic
1123098493 14:105777630-105777652 CCACAGAATGTGACCTTGTTTGG - Intergenic
1123107445 14:105849226-105849248 CCACAGAATGTGACCTTGTCTGG + Intergenic
1123625591 15:22224872-22224894 TGACAGAGTGAGACCTTGACGGG - Intergenic
1123911112 15:24967786-24967808 CAACAGAATGAGACCCTGTCTGG + Intronic
1123966933 15:25468541-25468563 CGACAGAGTGAGACTCTGTCTGG + Intergenic
1124033214 15:26030003-26030025 CAACAGAGTGAGACACTCTTGGG + Intergenic
1124908087 15:33891081-33891103 CAACAGAGTGAGACTCTGTCTGG + Intronic
1125662808 15:41407630-41407652 CAACAAAGTGAGACTCTGTCTGG - Intergenic
1125707626 15:41753597-41753619 CCACAAAATGAGAGCTTGTAAGG - Intronic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1126019590 15:44387161-44387183 CAGCAGAGCAAGACCTTGTCTGG + Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126355367 15:47789615-47789637 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1128180649 15:65600600-65600622 TAACAAAGTGAGACCCTGTTTGG + Intronic
1128388658 15:67167971-67167993 CAACAGAGGGAGACTCTGTCTGG - Intronic
1128581156 15:68811040-68811062 CCACAGAGTGAGACTCTGTCTGG + Intronic
1129074354 15:72978933-72978955 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1129145001 15:73639115-73639137 CAACAGAGCGAGACTCTGTCTGG - Intergenic
1129281098 15:74485626-74485648 GAACATAGTGAGACCTTTTTTGG - Intergenic
1129339480 15:74875753-74875775 TGACAGAGTGAGACTTTGTCTGG - Intergenic
1129892050 15:79077959-79077981 CAGCAGAGTGGGACCTGGTAAGG - Intronic
1130165120 15:81448100-81448122 CAACAGAGCGAGACTCTGTCTGG - Intergenic
1131187405 15:90286466-90286488 CAACAGAGTAAGACCATGTTTGG + Intronic
1131387865 15:92022352-92022374 CTGCTGAGTGATACCTTGTAAGG + Intronic
1131817419 15:96235664-96235686 AGACAGAGTGAGACCTTGTCTGG + Intergenic
1131912177 15:97219437-97219459 CAACAGAGTGAGACTCTATAGGG - Intergenic
1132104064 15:99050251-99050273 CAACAGAGCCAGACCCTGTTTGG + Intergenic
1132181603 15:99757615-99757637 CAACAGAGTGAACCCCTGTCTGG - Intergenic
1132837267 16:1960237-1960259 CAACAGAGTGAGACTGTCTCAGG - Intronic
1133105885 16:3509227-3509249 CAACAGAACGAGACCTTGTCTGG + Intronic
1133124447 16:3636798-3636820 CAACAGAGTGAGACTCTGTCTGG + Intronic
1133329240 16:4961346-4961368 CAACAGAGTGAGACTCAGTCTGG - Intronic
1133369468 16:5237125-5237147 CAAGAGAGTGAGACCCTGTCTGG + Intergenic
1133561559 16:6955219-6955241 CAACAGAGTGAGACCTTGTCTGG + Intronic
1133819834 16:9226346-9226368 CAACAGAGCCAGACCCTGTCAGG - Intergenic
1134124045 16:11604142-11604164 CAACATAGTGAGACACTGGAGGG + Intronic
1134241625 16:12510974-12510996 CGACAGAGTGAGACTCTGTGGGG - Intronic
1134375975 16:13673619-13673641 CATCAGAGTGAGACCCTGTCAGG + Intergenic
1134448929 16:14351597-14351619 CGACAGAGTGAGACTCTGTCTGG + Intergenic
1134744501 16:16577335-16577357 TGACAGAGTGAGACCCTGTCTGG - Intergenic
1135000986 16:18776417-18776439 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1135035496 16:19073471-19073493 TGACAGAGTGAGACCCTGTCTGG + Intronic
1135706185 16:24677180-24677202 CAACAGAGCGAGACTCTGTCAGG - Intergenic
1135760791 16:25136567-25136589 CAACAGAGTGAGACTCTGACGGG - Intronic
1136039115 16:27564042-27564064 CAACAGAGCAAGACCCTGTCTGG + Intronic
1136465731 16:30442357-30442379 CAACAGAGTGAGACTTTGTCCGG + Intergenic
1136484909 16:30565449-30565471 CAACATAGTGAGACCCTGTCTGG + Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137424860 16:48369700-48369722 CAACAGAGTGAGACCCTGTCTGG + Intronic
1137794403 16:51203129-51203151 CTATAGAGTGAGACCCTGTCAGG - Intergenic
1137797659 16:51235885-51235907 CGACAGAGGGAGACCCTGTCCGG - Intergenic
1138006412 16:53341851-53341873 CGACAGTGTGAGACATTGTGGGG + Intergenic
1138687548 16:58738942-58738964 CAACAGAGTGAGACGCTGTCAGG + Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139849947 16:69945103-69945125 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139878934 16:70168011-70168033 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1140373584 16:74427482-74427504 TGACAGAGTGAGACCCTGTCTGG - Intergenic
1140460466 16:75135586-75135608 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1140692577 16:77498711-77498733 TAACAGAGCGAGACCCTGTCTGG + Intergenic
1141301987 16:82825559-82825581 CAACAGAGGGAGACTCTGTTTGG - Intronic
1141485345 16:84335082-84335104 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1142208599 16:88796265-88796287 AAACAGAGTGAGACCTTCCTGGG + Intergenic
1142570539 17:870733-870755 CAACAGAGTGAGACTCTGTCTGG + Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143092740 17:4458702-4458724 CAACACAGGGAGACCCTGTCTGG - Intronic
1143133390 17:4695300-4695322 CAACAGAGTGAGACTCCGTCTGG + Intronic
1143361679 17:6376271-6376293 CAACAGAGTGAGACTCTGTCTGG + Intergenic
1144943530 17:18958088-18958110 CAACAGAGTGAAATCCTGTCTGG - Intronic
1145758986 17:27415109-27415131 TATCAGAGTGGGACATTGTAAGG - Intergenic
1145930596 17:28682599-28682621 CAACAGAGCGAGACCGTCTCAGG + Intronic
1146068082 17:29653604-29653626 CAACAGAGTGAGACTCTGTCTGG - Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146392511 17:32435760-32435782 CAACAGAGCGAGACTCTGTCTGG + Intergenic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146862680 17:36318154-36318176 CAACAGAATGAGACCCTGTCTGG + Intronic
1147005658 17:37401577-37401599 CAACAGAGTGAGACCTCGTCTGG - Intronic
1147093008 17:38122250-38122272 CAACAGAATGAGACCCTGTCTGG + Intergenic
1147104200 17:38198238-38198260 CAACAGAATGAGACCCTGTCTGG - Intergenic
1147201361 17:38804023-38804045 CAACAGAGTGAGACCTTGTAGGG + Intronic
1147203046 17:38816702-38816724 CAACAGAGTGAAACTCTGTCTGG - Intronic
1147288931 17:39425780-39425802 CGACAGAGTGAGACTCTGTCTGG + Intronic
1147340001 17:39747605-39747627 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1147369055 17:39979189-39979211 CAATAGAGTGAGGCTTTGGAAGG - Intergenic
1147621033 17:41866834-41866856 CGACAGAGTGATACCCTGTCTGG + Intergenic
1147658819 17:42106137-42106159 TAACAGAGTGAGACTCTGTCTGG + Intronic
1147781831 17:42948658-42948680 CAACAGAGTGAGACTATATCTGG + Intergenic
1147833382 17:43312897-43312919 CAATAGAGTGAGACTGTGTTGGG + Intergenic
1148425293 17:47590175-47590197 CAACAGAATGAGACCCTGTCTGG + Intronic
1148906537 17:50915872-50915894 CAACAGGGTGAAACCTTGTGGGG - Intergenic
1148982590 17:51591589-51591611 CAACAAAGTGAGACCAAGTCTGG + Intergenic
1149748691 17:59124410-59124432 CAACAGAGTGAGACTCTGTCTGG + Intronic
1149878436 17:60262966-60262988 CAACAGAATGAGAACTTGTCTGG - Intronic
1149968836 17:61195377-61195399 CAACAGAATGAGACCTTGTCTGG - Intronic
1150767286 17:68012218-68012240 CAACAGAGCAAGACCGTGTCTGG + Intergenic
1150772853 17:68056252-68056274 TGACAGAGTGAGACCTTGTCTGG - Intergenic
1151044946 17:70908919-70908941 CAATAGAGTGAGACCCTGGGAGG - Intergenic
1151289496 17:73139251-73139273 CAACAGAGTGAGACTCCGCATGG + Intergenic
1151400773 17:73854573-73854595 CAACATAGTGAGACCAGGCATGG + Intergenic
1151735892 17:75940260-75940282 CAACAGAGCGAGACCCTGTCTGG - Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152106795 17:78334897-78334919 CAGCAGAGTGAGACGCTGTCTGG - Intergenic
1153009305 18:523373-523395 CCACAGAGTGAGACTCTGTCTGG + Intergenic
1154214282 18:12404321-12404343 CAACAGAACAAGACCTTGTCTGG + Intergenic
1155266899 18:24103080-24103102 CAACAGAGTGAGACCGTGTCTGG + Intronic
1155501613 18:26492220-26492242 CAATAGAGTGAGACCCTATCTGG + Intronic
1155955310 18:31951902-31951924 CGACAGAGTGAGACCCCGTCTGG + Intronic
1156082446 18:33354628-33354650 CGACAGAGTGAGACTCTGTCTGG - Intronic
1156968339 18:43124043-43124065 TAACAGAATGAGACCCTGTCTGG - Intergenic
1157997713 18:52578958-52578980 CAACAGAGTGAGACTCCGTCTGG + Intronic
1158575702 18:58635769-58635791 CAACAAAGTGAGACTTTGTCTGG + Intergenic
1159052305 18:63432494-63432516 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1159710469 18:71751768-71751790 CTTCACAGTGAGATCTTGTAAGG + Intronic
1160779221 19:870539-870561 CAACAGAGTGAGACCCTGTCGGG + Intronic
1161188931 19:2942392-2942414 CAACAGAGCTAGACCCTGTCTGG - Intronic
1161616754 19:5275088-5275110 CGACAGAGTGAGACACTGTCTGG - Intronic
1161758646 19:6153826-6153848 CAACAGAGTGAGACCCTGTCTGG + Intronic
1161844524 19:6704922-6704944 CAGCGTAGTGAGACTTTGTACGG - Intronic
1162214612 19:9123013-9123035 CAACAGAGTGAGACTTTGTCTGG - Intergenic
1162280825 19:9696567-9696589 CAACAGAGTGAGACCCTGTCTGG - Intronic
1162522171 19:11187900-11187922 CAACATAGTGAGACCTCATCTGG + Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1162759848 19:12882172-12882194 CAACAGAGCGAGATATTGTCCGG - Intergenic
1162966736 19:14159746-14159768 CAAGCGAGAGAGAACTTGTAAGG - Exonic
1163000215 19:14362475-14362497 CAACAAAGTGAGACCGGGGAAGG + Intergenic
1163450562 19:17374643-17374665 CGACTGAGTGAGACCCTGAATGG - Intronic
1163719263 19:18890759-18890781 CAACAGAGTAAGACCGCGTCTGG + Intronic
1163719417 19:18891595-18891617 CAACAGAGCGAGACCCTGCCTGG - Intronic
1164027782 19:21368754-21368776 CAACAGAGTAAGAATTTGTCTGG - Intronic
1164196820 19:22974877-22974899 CAACAGAGGGAGACTGTCTAGGG - Intergenic
1164921645 19:32092915-32092937 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1165323274 19:35099369-35099391 CAACAGAGCAAGACCCTGTCTGG + Intergenic
1165383682 19:35497973-35497995 CAACAGAGGGAGACCCTGTCTGG - Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166698647 19:44868890-44868912 CGACAGAGTGAGACTCTGTCTGG + Intronic
1166900190 19:46055275-46055297 CAACACAGTGAGACCCTATCTGG - Intronic
1166946328 19:46399152-46399174 CGACAGAGTGAGACTCTGTCTGG - Intergenic
1167554043 19:50181819-50181841 CAACAGAGAAAGACCCTGGAGGG - Intergenic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168596305 19:57680546-57680568 CAACAGAGTGAGACTCCGTCTGG + Intergenic
1168708538 19:58483628-58483650 CAACAGGATGAGACCCTGTCTGG + Intronic
925130835 2:1493019-1493041 CCACAGAGTCAGACCATGGACGG + Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925736592 2:6969238-6969260 CATCAGAGTGTGACCTTATTTGG + Intronic
927015002 2:18950530-18950552 TAACAGAGTGAAAACATGTATGG + Intergenic
927557484 2:24046092-24046114 TGACAGAGTGAGACCCTGTTGGG + Intronic
927632439 2:24786227-24786249 CAACAGAGTGAGACTTTGTCTGG - Intergenic
927782508 2:25951143-25951165 CAACAGAGTGAGGCCTTGCCCGG - Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928159591 2:28909851-28909873 CAACACAGTGAGACCCTGTTTGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930110462 2:47674691-47674713 TGACAGAGTGAGACCCTGTCTGG + Intergenic
930525972 2:52530108-52530130 CAACAGAATGAGACCCTGTCTGG - Intergenic
931628148 2:64275588-64275610 CCACAGTGTGAGACATTGCAAGG - Intergenic
931740048 2:65233920-65233942 CAACAGAGTGAGACCCTGTCAGG - Intronic
931748348 2:65309891-65309913 CATCAGAGTGAGGCCTGGTAAGG + Intergenic
932346313 2:70997728-70997750 TGACAGAGTGAGACCTTAAAGGG + Intergenic
932382639 2:71299198-71299220 CAACAGAGCGAGACCCTGTCTGG + Intronic
932507213 2:72246661-72246683 AAACACAGTGAGACCCTGCATGG - Intronic
932524182 2:72445617-72445639 AAAGAGAGAGAGAGCTTGTACGG + Intronic
932559278 2:72852909-72852931 TGACAGAGTGAGACCCTGTCTGG + Intergenic
932724729 2:74169646-74169668 CAACAGAGTGAGACCCAGTCGGG - Intronic
932967329 2:76492120-76492142 CAACAGAGTAAGACTCTCTAGGG - Intergenic
933592488 2:84248305-84248327 CAACAGAGTGAGACTCTGTCAGG - Intergenic
934706048 2:96481936-96481958 CAACAGAGCGAGACTCTGTCTGG + Intergenic
935243522 2:101198483-101198505 CGACAGAGCGAGAACTTGTCTGG - Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
937802082 2:126092000-126092022 CAACATAGGGAGACCTGGTCTGG - Intergenic
938096744 2:128469010-128469032 AAGCAGAGTGAGGCCTTGTGGGG + Intergenic
938399125 2:130974250-130974272 CAACAGAGTGAGATCTTGTCTGG + Intronic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
939044679 2:137236440-137236462 AATCAGAGTGAGAGCTTGTTGGG + Intronic
939531294 2:143364984-143365006 CAACAGAGCGAGACTCTGTGTGG + Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941792594 2:169569112-169569134 TAACAGAGTGAAATCTTGAAGGG - Intronic
942169705 2:173277938-173277960 TGACAGAGTGAGATCCTGTATGG - Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
943981872 2:194562492-194562514 AAACAGAGAGAGAGCTTGTGAGG - Intergenic
944565386 2:200985089-200985111 CAACAGAGTGAGACCATCTGGGG + Intronic
944847162 2:203680672-203680694 CAACAAAGGGACTCCTTGTAGGG + Intergenic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
947297178 2:228643894-228643916 CGACAGAGTGAGACTCTGTCTGG + Intergenic
947442542 2:230135919-230135941 CAACAGAGTGAGATCCTGTGTGG - Intergenic
947505174 2:230703285-230703307 CAACAGAGTGAGACTCTGTCTGG - Intergenic
947703213 2:232252913-232252935 CAACATAATGAGACCTTGTGTGG + Intronic
947723772 2:232384391-232384413 CAACAGAGCAAGACCCTGTCTGG + Intergenic
947777891 2:232728996-232729018 CAACAGAGCCAGACCCAGTAAGG - Intronic
948033179 2:234836413-234836435 CCACAGAGTGAGTCCTGGGAAGG + Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169169617 20:3454270-3454292 CAACAGAGAGAGACCCTGTCTGG - Intergenic
1169419898 20:5451471-5451493 CAACAGAGTGAGACTCTGTTGGG + Intergenic
1169454682 20:5741838-5741860 CAACAGAGTGAGACCGTATCCGG + Intergenic
1171546508 20:26006117-26006139 TGACAGAGTGAGACCCTGTCTGG - Intergenic
1172551661 20:35805216-35805238 CAACAGAATGAGACCTTGTCTGG - Intronic
1173008381 20:39158360-39158382 CAACACAGTGAGACCCTGTCTGG - Intergenic
1173681036 20:44882035-44882057 CAACAGAGTGAGACTCTCTCTGG + Intergenic
1173945247 20:46945094-46945116 TGACAGAGTGAGACCTTGTCTGG + Intronic
1174014334 20:47475613-47475635 CAACAGAGTGAGACTCTGTTGGG + Intergenic
1174585767 20:51606876-51606898 AAACAGAGTGAGACCCTGGGTGG - Intronic
1174610376 20:51793439-51793461 TGACAGAGTGAGACCCTGTCTGG + Intronic
1174810370 20:53640368-53640390 CGACAGAGTGAGACTTTGTTTGG - Intergenic
1174825178 20:53762253-53762275 CAACAGAGTGAGACCCTGTCAGG - Intergenic
1175709630 20:61208982-61209004 CGACAGAGTGAGACTCTGTCTGG - Intergenic
1175848833 20:62075897-62075919 CAACAGAGTGAAACTTTGTCTGG + Intergenic
1175884927 20:62284394-62284416 CAACAGAGGGAGACCCTGCCTGG - Intronic
1175970003 20:62680922-62680944 TGACAGAGTGAGACCCTGTCTGG - Intronic
1176969391 21:15248368-15248390 CAACAGAGTGACATCCTGTCTGG - Intergenic
1177255237 21:18652888-18652910 CAACAGAGAGAGTCCATGAAGGG - Intergenic
1177846596 21:26296048-26296070 CAACAGAATGAGACTCTGTCTGG - Intergenic
1178614168 21:34116025-34116047 TAACAGAGTGAAACCCTGTCGGG - Intronic
1179208355 21:39304592-39304614 CAACAAAGTGAGAACTTGTCTGG + Intronic
1179457543 21:41509297-41509319 CAACAGAGTGAGACCCCTTCTGG - Intronic
1179663836 21:42896001-42896023 CAACAGAGTGAGACTGTCTCAGG - Intronic
1179836852 21:44040631-44040653 TGACAGAGCGAGACCCTGTAAGG - Intronic
1180166175 21:46031104-46031126 CCACAGAGTGAGACTCTGTCGGG - Intergenic
1180968189 22:19801335-19801357 CACCAGAGTGAGACCTGGACAGG + Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181776672 22:25164926-25164948 CAACAGAGTGAGACTGTCTCGGG + Intronic
1181787080 22:25235162-25235184 CCCCAGAGTGAGAGCTTCTAGGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182655889 22:31889567-31889589 CAACAGAGCGAGACTCTGTCTGG - Intronic
1183845922 22:40539927-40539949 CAACAGAGTGAGACCCTGTCTGG - Intronic
1183879887 22:40818684-40818706 CAACAGAGCAAGACCCTGTCCGG + Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184740393 22:46425053-46425075 CAGCAGAGTGAGAAGTTGTTTGG + Intronic
949836851 3:8279263-8279285 GAAAAGAGGGAGACCGTGTAAGG + Intergenic
950001387 3:9659208-9659230 CAACAGAGGAAGACCTTGTTGGG + Intronic
950211015 3:11123357-11123379 CAACAGAGCAAGACCCTGTCTGG + Intergenic
950308718 3:11937180-11937202 CAACAGAATGAGACCCTGTCTGG - Intergenic
950383015 3:12633461-12633483 CAACAGAGGGAGACCCTGTCTGG + Intronic
950903705 3:16518573-16518595 CACCACAGTGCTACCTTGTAAGG - Intergenic
952061521 3:29516601-29516623 CAACACAGTGAGACCTTCTTAGG - Intronic
952123598 3:30274373-30274395 CAACAGAGTATGACCATTTAGGG - Intergenic
952368203 3:32693559-32693581 TGACAGAGTGAGACCCTGTCTGG - Intronic
952792951 3:37214760-37214782 TAACAGAGTGAGACCCTGTCTGG + Intergenic
953365800 3:42343875-42343897 CAACAGAGCGAGACTCTGTCTGG - Intergenic
953752694 3:45621248-45621270 CAACAGAGCAAGACCCTGTAAGG - Intronic
953800456 3:46018758-46018780 CAACCTAGAGAGAGCTTGTAAGG - Exonic
954058602 3:48049916-48049938 CAACAGAGTGAGACTTCGTCTGG + Intronic
954349357 3:50030007-50030029 CAACAGAGTGAGACTTTGGGAGG + Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
956101736 3:65775427-65775449 CAACAGAGTGAGACCTTCTCTGG + Intronic
958264655 3:91423952-91423974 CAACATAGCAAGACCTTGTCTGG - Intergenic
959332829 3:105027419-105027441 CAACAGAGTGAGACTCTATCTGG - Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961143274 3:124573519-124573541 TAATAGAGTGAGACCCTGTCTGG - Intronic
961186686 3:124921167-124921189 CAACAGAGTGAGACTCTGCCTGG - Intronic
961896121 3:130169085-130169107 TGACAGAGTGAGACCCTGTATGG + Intergenic
963893712 3:150663472-150663494 CAACAGAGCAAGACCCTGTTAGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964113216 3:153108321-153108343 CAACAGAGTGAGACTCCGTCTGG + Intergenic
964621623 3:158724843-158724865 TAACATAGTGAGACCCTGTCTGG - Intronic
964622320 3:158730443-158730465 CAACAGAGTGAGACCCTATGGGG - Intronic
965769043 3:172161627-172161649 CAACAGTGTCAGACATTGTCAGG - Intronic
965770175 3:172173798-172173820 CAACAGAGCAAGACCCTGTCTGG + Intronic
966528874 3:180951201-180951223 TGACAGAGTGAGACCCTGTCTGG + Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967058654 3:185851967-185851989 CGACAGAGAGAGACCCTGTGTGG + Intergenic
967184512 3:186933078-186933100 GACCAGAGTGAGAACTTGTTTGG + Intronic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
969112016 4:4850150-4850172 CAACAGAGTGAGACCCTGTCTGG + Intergenic
970081997 4:12298022-12298044 CAACAGAGTGAGACTGTCTCAGG - Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
971032522 4:22656172-22656194 TGACAGAGTGAGATCTTGTCCGG - Intergenic
971849191 4:31961328-31961350 CCACAGAGTGAGACTCTGTCTGG - Intergenic
972090049 4:35270016-35270038 CAATAGAGTGAGACCTTGTCTGG - Intergenic
972516177 4:39812684-39812706 CAACAGAGTGAGACCCCATATGG + Intergenic
972646606 4:40973869-40973891 CGACAGAGTGAGACTCTGTCTGG - Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
975413069 4:74077619-74077641 CATCAGAATGTGACCTTATATGG - Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
977697812 4:99986153-99986175 CAACAGAGTGAGACTCTGTCTGG + Intergenic
977938709 4:102834727-102834749 TGACAGAGTGAGACCCTGTCTGG + Intronic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979801135 4:124910460-124910482 TGACAGAGTGAGACCTTGTCTGG - Intergenic
980817149 4:137962994-137963016 CAACATAATGAGAATTTGTAGGG - Intergenic
980945200 4:139312824-139312846 TGACAGAATGAGACCTTGTCTGG + Intronic
980972391 4:139579128-139579150 CAACAGAATGAGATCCTGAAAGG - Intronic
981759516 4:148178309-148178331 CAACAGAGTGAGACTCTGTCTGG + Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982178301 4:152727260-152727282 TAACAGAGTGAGACACTGTTTGG - Intronic
982328662 4:154157199-154157221 CAACAGAGTGAGACCATCTCCGG - Intergenic
982453410 4:155578777-155578799 CTACAGAGTGAGACTCTGTCTGG + Intergenic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
983780667 4:171666402-171666424 CAACAGAGTGACACCCTGTCTGG + Intergenic
984516254 4:180744481-180744503 CAGAAGAGTGAGCCCTTGCATGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
984927918 4:184822718-184822740 CGACAGAGTGAGACCTTATCTGG + Intronic
985102223 4:186469867-186469889 CAACACAGTGAGAGCTCGTCTGG + Intronic
985226608 4:187768140-187768162 CAGCAGAGTGAGACTTCGTCTGG - Intergenic
985785664 5:1892649-1892671 CATCAGAATGAGACCTTATTTGG - Intergenic
986231194 5:5866187-5866209 CAACAGAGCAAGACCCTGTTTGG - Intergenic
986874668 5:12093730-12093752 CAACAGAGTGAAACTCTGTTGGG + Intergenic
988502761 5:31797431-31797453 CAACAGAGTGAAACCCTGTCTGG + Intronic
989042318 5:37241644-37241666 TGACAGAGTGAGACCCTGTCTGG - Intronic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991372755 5:65936633-65936655 CTACAGAGTGAGACACTTTAGGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991773445 5:70061224-70061246 TAACAAATTGAGACCTTGTCTGG - Intronic
991852739 5:70936648-70936670 TAACAAATTGAGACCTTGTCTGG - Intronic
992630531 5:78675883-78675905 GAACAGAGTGGGAGATTGTAGGG - Intronic
992739112 5:79755304-79755326 CGACAGAGTGAGACTCTGTGTGG - Intronic
992971262 5:82060830-82060852 TGACAGAGTGAGACCTTGTCTGG + Intronic
994061549 5:95484364-95484386 CAACAGAATGAGATCCTGTCTGG - Intronic
994196822 5:96931174-96931196 CAACAGAGTGAGATCCTGTCTGG - Intronic
995864710 5:116678770-116678792 CAACAGAGAGAGACTCTGTCTGG - Intergenic
996164575 5:120209385-120209407 CAACAGAGTGAGACTGTGCCTGG + Intergenic
997114505 5:131111996-131112018 TAACAGAGTAAGACCCAGTATGG - Intergenic
998076792 5:139243149-139243171 CAAAAGAGTGAGACCTTGGCTGG + Intronic
999600491 5:153257856-153257878 GAACAGAGTGAGTTCTTTTAGGG - Intergenic
1000059920 5:157645640-157645662 CAACAGAGTGAGACCCTGTCTGG + Intronic
1000287153 5:159836685-159836707 CAACAGAGTGGGAGCTGGCAAGG - Intergenic
1001731756 5:173965335-173965357 CAACAAAGTGAGACCATCTTGGG + Intergenic
1002320487 5:178372590-178372612 CAATAGAGAGAGACTTTGTCTGG - Intronic
1003246893 6:4389579-4389601 TAACAGGGTAAGGCCTTGTAAGG - Intergenic
1004072254 6:12311293-12311315 CAACAGAGGGAGTCCTTGTAAGG + Intergenic
1004476078 6:15973510-15973532 CAACAAAGTGAGACTCTGTCTGG - Intergenic
1004678136 6:17864406-17864428 CAACAGAGAGAGCTCCTGTATGG + Intronic
1005082823 6:21973990-21974012 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1005400685 6:25430447-25430469 CAACAGTGCGAGACCCTGTCTGG - Intronic
1005570862 6:27144440-27144462 CAACAGAGTGAGACTCTGTCTGG + Intergenic
1005919321 6:30385182-30385204 CAACAGAGTGAGACTTCATCTGG + Intergenic
1006363596 6:33601384-33601406 CAACAGAGTGAGACTTGGCTGGG - Intergenic
1006548425 6:34799468-34799490 TGACAGAGTGAGACCCTGTCTGG + Intronic
1006584099 6:35094418-35094440 CAAAAGAGTGAGACTTCGTCTGG + Intergenic
1006885621 6:37379931-37379953 CGACAGAGTGAGACACTGTCTGG - Intronic
1007471004 6:42090346-42090368 CAACAGAGTGAGACTTCATCTGG + Intergenic
1007542500 6:42660945-42660967 CAACGGAGCGAGACCCTGTGTGG + Intronic
1007792582 6:44320127-44320149 CAACAGAGCGAGACTCTGTCTGG + Intronic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008629717 6:53351611-53351633 CAACAATGTGAGCCCATGTAAGG + Intergenic
1008990732 6:57598699-57598721 CAACATAGCAAGACCTTGTCTGG + Intronic
1010430367 6:75771020-75771042 CAACAAAGTGAGACCATCTCAGG - Intronic
1011075508 6:83434323-83434345 CAACAGCGTGAGACTCTGTTGGG - Intergenic
1011281295 6:85680504-85680526 TCACAAAGTGAGACCTTGTCTGG - Intergenic
1011736388 6:90314541-90314563 CCTCAGTGTGAGACCCTGTAGGG - Intergenic
1012261350 6:97091187-97091209 CAATAGAGCGAGACCCTGTCTGG + Intronic
1013047896 6:106505895-106505917 CAACAAAGTGAGAGCTCTTAGGG + Intergenic
1013209023 6:107970338-107970360 CCAGAGAGTGAGACCCTGTCTGG - Intergenic
1013266247 6:108502044-108502066 CAACAGAGTGAGACTCTGTCTGG - Intronic
1013931124 6:115534392-115534414 CAACAGAGTGAGACCCCGTCTGG - Intergenic
1014528980 6:122537004-122537026 CAACAGATGGAGATCTTATATGG - Intronic
1015950417 6:138547398-138547420 CAACAGAGTGAGACCCTCTCAGG - Intronic
1016381874 6:143492386-143492408 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1016827364 6:148400729-148400751 CGACAGAGTGAGACTTTGTCTGG + Intronic
1017096560 6:150810287-150810309 TGACAGAGTGAGACCCTGTCTGG - Intronic
1017290336 6:152728142-152728164 CAACAGAGTGAGCCTCTGTCTGG + Intergenic
1017936527 6:159010345-159010367 TGACAGAGTGAGACCCTGTCAGG - Intergenic
1018693601 6:166370809-166370831 CAACAGAGCAAGACCCTGTCTGG + Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019822621 7:3256861-3256883 CAACAGAGTGAAGCCCTGTCTGG + Intergenic
1020052335 7:5090119-5090141 CAACAGAATGAGACCCTCTTTGG - Intergenic
1020115124 7:5471925-5471947 CAACACAGTAAGACCCTGTGTGG + Intronic
1021283201 7:18745909-18745931 CCACAGGGTGAGAACTTGCATGG - Intronic
1021511463 7:21437450-21437472 CCATAGTGTGAGACCTCGTAAGG - Intronic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022686930 7:32605926-32605948 TGTCAGAGTGAGACCTTGTCTGG - Intergenic
1023002788 7:35828778-35828800 CAACAGAGTGAGAAATTTCATGG - Intronic
1023387592 7:39675711-39675733 CAACAGAGTGAGACCATGTCTGG + Intronic
1023803471 7:43854641-43854663 CAACAGAGTGAGACTTAATTAGG - Intergenic
1023943082 7:44782485-44782507 CAGAAGAGAGAGACCTTTTAGGG + Intergenic
1023975983 7:45030454-45030476 AAACAGAGTGAGACCCTGTCTGG - Intronic
1024350834 7:48361074-48361096 CAACAGAGTGAGACCCTGTTTGG + Intronic
1024616781 7:51122101-51122123 CACTAGAGTGTGACATTGTATGG - Intronic
1025075891 7:55942876-55942898 TACCAGAGTGAGAACTTGAAGGG + Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026460466 7:70610453-70610475 CAACAGAATGAGACTCTGTCAGG - Intronic
1027027498 7:74864360-74864382 TGATAGAGTGAGACCTTGTCTGG + Intergenic
1027060254 7:75079735-75079757 TGATAGAGTGAGACCTTGTCTGG - Intergenic
1027198895 7:76050049-76050071 CAACAGAGTGGGACTCTGTCAGG - Intronic
1027222192 7:76221075-76221097 CAACAAAGTGAGACCTTGTCTGG - Intronic
1028545363 7:91993206-91993228 CAACAGAGCAAGACCCTGTATGG - Intronic
1028592334 7:92511157-92511179 CAGCAGAGTGAGACCCTGTTGGG - Intronic
1028716575 7:93978089-93978111 CAACAGAGTGACACCCTGTCTGG - Intronic
1029030498 7:97461530-97461552 CAACGGAGTGAGACTCTGTCTGG + Intergenic
1029551314 7:101238506-101238528 CAACACACTGAGACCTCGTTGGG + Exonic
1029625829 7:101719591-101719613 TGACAGAGTGAGACTTTGTCTGG - Intergenic
1030048806 7:105520850-105520872 CAACACAGCGAGACCCTGTGTGG + Intronic
1030652169 7:112128007-112128029 CAACAGAGCGAGACTCTGTCGGG + Intronic
1032556186 7:132837410-132837432 CAGCAGAGAGAGACCTTCCAAGG - Intronic
1032633228 7:133677072-133677094 AAACAGAATAATACCTTGTAAGG - Intronic
1033138622 7:138805373-138805395 CAACAAAGTGAGACCCTGTCTGG + Exonic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033507942 7:142024392-142024414 CGACAGAGTGAGACCCTGTCTGG + Intronic
1033541146 7:142357247-142357269 CGACAGAGTGAGACTCTGTCTGG - Intergenic
1034079714 7:148265291-148265313 TGACAGAGTGAGACCCTGTCTGG - Intronic
1034105831 7:148488984-148489006 CAACAGAGAGAGACCCTGTCTGG - Intergenic
1034229042 7:149505702-149505724 CAACAGAATGACACTTTGAAAGG + Intergenic
1034482529 7:151333595-151333617 CAACAGAGTGAGACCTTGTCCGG + Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1036369797 8:8153240-8153262 TGACAGAGTGAGACCCTGTATGG - Intergenic
1036404884 8:8445906-8445928 CGACAGAGTGAGACCCTGTCTGG + Intergenic
1036510432 8:9395025-9395047 CAATATGGTGAGACCTTGTCTGG - Intergenic
1036881094 8:12512404-12512426 TGACAGAGTGAGACCCTGTATGG + Intergenic
1037174645 8:15932598-15932620 CAACAAAGTGAGACTCTGTCTGG - Intergenic
1037847322 8:22295057-22295079 CAACAGAGCGAGACTTCGTCTGG + Intronic
1037856750 8:22376856-22376878 CAACAGAGTGAGACAATGTCTGG + Intronic
1038136288 8:24789928-24789950 CAACAGAGTGAGACTCTGACTGG - Intergenic
1038281216 8:26166806-26166828 TAACAGAGTGAGACCCTGTCTGG + Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1038795043 8:30702472-30702494 CAAGAGAGAGAAATCTTGTAAGG - Intronic
1039426618 8:37491845-37491867 TGACAGAGTGAGACCTTGGAGGG - Intergenic
1039449939 8:37664693-37664715 CAGCAGAGTGAAACCCTGTCTGG - Intergenic
1039990049 8:42479803-42479825 TGACGGAGTGAGACCTTGTCTGG + Intronic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041646940 8:60262662-60262684 CAACATAGTGAGACCCTTTCAGG + Intronic
1043413453 8:80024207-80024229 CAACAGAGCAAGACCCTGTCTGG + Intronic
1043882821 8:85564554-85564576 TGACACAGTGAGACCCTGTAAGG - Intergenic
1044241062 8:89889041-89889063 CAACAAAGTGAGACCCTGTGTGG + Intergenic
1044434921 8:92150806-92150828 CAACAGAGTAAGACTCTGTCTGG + Intergenic
1044534023 8:93339199-93339221 CTTCAGAATGAGACCTTGTTTGG - Intergenic
1044778622 8:95720840-95720862 CAACAGAGTGAGACTCTGCCAGG - Intergenic
1044973152 8:97639317-97639339 CGACAGAGTGAGACCTTGTCTGG - Intergenic
1045085003 8:98672360-98672382 CAACAGAGAGAAACCTTGTATGG + Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1047523888 8:125616163-125616185 CAACAGAGTGAGACTCTGTCTGG + Intergenic
1048485816 8:134846615-134846637 CTACATAGTTAGACCTTATATGG + Intergenic
1049824243 8:144657438-144657460 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1050573294 9:6964932-6964954 CTACAGAGTGAGACTTCGTCGGG + Intronic
1051755019 9:20389757-20389779 CAACACAGTGAGACCCCGTCCGG + Intronic
1051936529 9:22448126-22448148 CAACAGAGTGAGATCCTGTCTGG - Intronic
1053039846 9:34861154-34861176 TAACAGAATGAGACCCTGTAAGG + Intergenic
1053358609 9:37466906-37466928 CAACAGAGTGAGATTTCGTCTGG + Intergenic
1053505746 9:38641946-38641968 CGACAGAGTGAGACCTAGTCTGG - Intergenic
1054786746 9:69217520-69217542 CAACCTAGTGAGACCCTGTTGGG + Intronic
1054913916 9:70478770-70478792 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1054924397 9:70574959-70574981 TGACAGAGTGAGACCCTGTTGGG - Intronic
1055191232 9:73527409-73527431 CAACAGAGTGAGACCCTGTCTGG - Intergenic
1056637224 9:88341343-88341365 CAACAGAGTGAGACTCTGTCTGG - Intergenic
1057308510 9:93926575-93926597 CAACAGAGCAAGACCCTGTCTGG + Intergenic
1057465986 9:95315243-95315265 CAGCAGACTGAGACCGTGTCTGG - Intronic
1058007860 9:99938765-99938787 TGACAGTGTGAGACCTTGTCTGG + Intronic
1058759979 9:108121056-108121078 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1058891681 9:109366456-109366478 CAACAGAGCCAGACCCTGTCTGG - Intergenic
1059079612 9:111234183-111234205 CAACAGAGTGAGACCCTATCAGG + Intergenic
1059132987 9:111774316-111774338 TGACAGAGTGAGACCCTGTCTGG - Intronic
1060079250 9:120625936-120625958 TAACAGAGAGAGACCATGAAAGG - Intronic
1061081688 9:128374592-128374614 CAACAAAGCGTGACCTTGTTTGG + Intronic
1061660082 9:132124265-132124287 TAACAGAGTGAGATCCTGTCTGG + Intergenic
1061943997 9:133898287-133898309 CAACAGAAAGAGACTTTTTAGGG + Intronic
1062002359 9:134222846-134222868 TGACAGAGTGAGACCCTGTCAGG - Intergenic
1062719476 9:138029628-138029650 CGACAGAGCGAGACCCTGTCTGG - Intronic
1185602363 X:1349025-1349047 CAACAGAGCAAGACCGTGTCAGG - Intronic
1185767703 X:2739066-2739088 CAACATAGTGAGACCCTGTCTGG - Intronic
1186512471 X:10140258-10140280 TGACAGAGTGAGACCCTGTCTGG - Intronic
1186829384 X:13375707-13375729 CAACAGAGCGGGACCCTGTCTGG - Intergenic
1187315246 X:18186945-18186967 CAACAGAGCAAGACCCTGTCTGG + Intronic
1187390219 X:18881388-18881410 CGACAGAGTGAGACTCTGTCTGG + Intergenic
1187468493 X:19547133-19547155 CAAAAGAGTGGGACCCTGTCTGG + Intronic
1187512644 X:19935808-19935830 CACAAGAGTAAGACCTTTTAAGG - Exonic
1187717128 X:22113967-22113989 CAATAGAGTGAGACTCTGTCTGG - Intronic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188560285 X:31460765-31460787 CAACATAGTGAAACCTCGTTTGG - Intronic
1189464782 X:41270088-41270110 CGACAGAGTGAGACCCTGTCCGG - Intergenic
1189828394 X:44944330-44944352 CAACAGAGTGAAACTCTGTTAGG + Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190023767 X:46903665-46903687 CAGCAGAGTGAGACTGAGTAGGG + Intergenic
1190230794 X:48580414-48580436 AGACAGAGTGAGACCCTGTCTGG - Intergenic
1190341651 X:49301609-49301631 CAACAGAGTGAGACTCTGTCTGG - Intergenic
1190642521 X:52494667-52494689 CAACAGAGTGACACTCTGTCTGG + Intergenic
1190645152 X:52518200-52518222 CAACAGAGTGACACTCTGTCTGG - Intronic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1190846086 X:54191981-54192003 TGACAGAATGAGACCTTGTCTGG + Intergenic
1190890587 X:54563764-54563786 CAACAGAGTGAGACTGTCTCAGG + Intergenic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1193664998 X:84305379-84305401 CAAAAGAGTGAGAACATGTGAGG - Intergenic
1194687623 X:96942576-96942598 CAATAGCTTGAGACCTTCTAAGG + Intronic
1196421589 X:115527750-115527772 CAACAGAGCAAGACCATGTCTGG + Intergenic
1197731229 X:129812101-129812123 CAACAGAATGAGACTCTGTCTGG - Intronic
1198248155 X:134851514-134851536 CAACAGAGTAAGACTCTGTCTGG + Intronic
1198249699 X:134868122-134868144 CAGCAGAGTGAGACCGGGTGCGG - Intergenic
1198375174 X:136031637-136031659 CAACAGAGCGAGACTCTGTCTGG + Intronic
1201290649 Y:12419019-12419041 CAACAAAGTGAGACTCTCTAGGG + Intergenic
1201553703 Y:15246250-15246272 GAACAAAGGGAGACCATGTATGG - Intergenic