ID: 1147202835

View in Genome Browser
Species Human (GRCh38)
Location 17:38814972-38814994
Sequence AAGATGGAGGAGAAGGAGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2440
Summary {0: 1, 1: 0, 2: 23, 3: 330, 4: 2086}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147202835_1147202842 2 Left 1147202835 17:38814972-38814994 CCTGCCTCCTTCTCCTCCATCTT 0: 1
1: 0
2: 23
3: 330
4: 2086
Right 1147202842 17:38814997-38815019 CAAAAACATATTTGTCAATGGGG 0: 1
1: 0
2: 1
3: 20
4: 364
1147202835_1147202844 26 Left 1147202835 17:38814972-38814994 CCTGCCTCCTTCTCCTCCATCTT 0: 1
1: 0
2: 23
3: 330
4: 2086
Right 1147202844 17:38815021-38815043 GCCCCAGCAGGTACTCGTCACGG 0: 1
1: 0
2: 0
3: 4
4: 83
1147202835_1147202840 0 Left 1147202835 17:38814972-38814994 CCTGCCTCCTTCTCCTCCATCTT 0: 1
1: 0
2: 23
3: 330
4: 2086
Right 1147202840 17:38814995-38815017 CTCAAAAACATATTTGTCAATGG 0: 1
1: 0
2: 2
3: 42
4: 430
1147202835_1147202843 14 Left 1147202835 17:38814972-38814994 CCTGCCTCCTTCTCCTCCATCTT 0: 1
1: 0
2: 23
3: 330
4: 2086
Right 1147202843 17:38815009-38815031 TGTCAATGGGGCGCCCCAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 74
1147202835_1147202841 1 Left 1147202835 17:38814972-38814994 CCTGCCTCCTTCTCCTCCATCTT 0: 1
1: 0
2: 23
3: 330
4: 2086
Right 1147202841 17:38814996-38815018 TCAAAAACATATTTGTCAATGGG 0: 1
1: 0
2: 1
3: 66
4: 432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147202835 Original CRISPR AAGATGGAGGAGAAGGAGGC AGG (reversed) Exonic
Too many off-targets to display for this crispr