ID: 1147208752

View in Genome Browser
Species Human (GRCh38)
Location 17:38858383-38858405
Sequence AAACAAAGGCAGAACGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147208752_1147208755 -6 Left 1147208752 17:38858383-38858405 CCTTCCACGTTCTGCCTTTGTTT No data
Right 1147208755 17:38858400-38858422 TTGTTTCAAAGCTATTGCATCGG No data
1147208752_1147208756 5 Left 1147208752 17:38858383-38858405 CCTTCCACGTTCTGCCTTTGTTT No data
Right 1147208756 17:38858411-38858433 CTATTGCATCGGCCTCTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147208752 Original CRISPR AAACAAAGGCAGAACGTGGA AGG (reversed) Intergenic
No off target data available for this crispr