ID: 1147209879

View in Genome Browser
Species Human (GRCh38)
Location 17:38866751-38866773
Sequence CATTTTGTGGAGATGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147209879_1147209886 18 Left 1147209879 17:38866751-38866773 CCTGCCCCCATCTCCACAAAATG No data
Right 1147209886 17:38866792-38866814 AAACAAAAATTGAACCAAGCAGG No data
1147209879_1147209890 28 Left 1147209879 17:38866751-38866773 CCTGCCCCCATCTCCACAAAATG No data
Right 1147209890 17:38866802-38866824 TGAACCAAGCAGGGGTGCGGTGG No data
1147209879_1147209889 25 Left 1147209879 17:38866751-38866773 CCTGCCCCCATCTCCACAAAATG No data
Right 1147209889 17:38866799-38866821 AATTGAACCAAGCAGGGGTGCGG No data
1147209879_1147209887 19 Left 1147209879 17:38866751-38866773 CCTGCCCCCATCTCCACAAAATG No data
Right 1147209887 17:38866793-38866815 AACAAAAATTGAACCAAGCAGGG No data
1147209879_1147209888 20 Left 1147209879 17:38866751-38866773 CCTGCCCCCATCTCCACAAAATG No data
Right 1147209888 17:38866794-38866816 ACAAAAATTGAACCAAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147209879 Original CRISPR CATTTTGTGGAGATGGGGGC AGG (reversed) Intergenic
No off target data available for this crispr