ID: 1147212427

View in Genome Browser
Species Human (GRCh38)
Location 17:38879686-38879708
Sequence AGCAAGGAAGGTTTGGGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 355}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147212427_1147212444 29 Left 1147212427 17:38879686-38879708 CCTTACCCCAAACCTTCCTTGCT 0: 1
1: 0
2: 1
3: 41
4: 355
Right 1147212444 17:38879738-38879760 ACCACTCTTTCATCTTTTTAGGG 0: 1
1: 0
2: 2
3: 23
4: 270
1147212427_1147212434 1 Left 1147212427 17:38879686-38879708 CCTTACCCCAAACCTTCCTTGCT 0: 1
1: 0
2: 1
3: 41
4: 355
Right 1147212434 17:38879710-38879732 CCTTACCCCCTCCCGTTCCCTGG 0: 1
1: 0
2: 0
3: 20
4: 294
1147212427_1147212446 30 Left 1147212427 17:38879686-38879708 CCTTACCCCAAACCTTCCTTGCT 0: 1
1: 0
2: 1
3: 41
4: 355
Right 1147212446 17:38879739-38879761 CCACTCTTTCATCTTTTTAGGGG 0: 1
1: 0
2: 3
3: 19
4: 273
1147212427_1147212443 28 Left 1147212427 17:38879686-38879708 CCTTACCCCAAACCTTCCTTGCT 0: 1
1: 0
2: 1
3: 41
4: 355
Right 1147212443 17:38879737-38879759 GACCACTCTTTCATCTTTTTAGG 0: 1
1: 0
2: 3
3: 24
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147212427 Original CRISPR AGCAAGGAAGGTTTGGGGTA AGG (reversed) Intronic