ID: 1147215302

View in Genome Browser
Species Human (GRCh38)
Location 17:38895858-38895880
Sequence CCTCAGATGTCAGTCAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 1, 2: 1, 3: 10, 4: 145}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147215302 Original CRISPR CCTCAGATGTCAGTCAGTCC TGG Intronic
900655682 1:3755667-3755689 CCTCAGGAGGCAGACAGTCCCGG - Intronic
902817010 1:18922288-18922310 CCTCGGATGTCTGTCCATCCTGG + Intronic
903290624 1:22311874-22311896 CCTCAGAAGTCAGAAAGTCCAGG + Intergenic
909935449 1:81545573-81545595 CATTAGAAGTCAGTCAGGCCAGG - Intronic
910656550 1:89625189-89625211 CCTTAGATTTCAGTCAGTAATGG - Intergenic
912762474 1:112381468-112381490 CCTCAGATGTCACTTCCTCCAGG - Intergenic
913592652 1:120342939-120342961 CCTCCTTTGACAGTCAGTCCAGG + Intergenic
913650700 1:120912191-120912213 CCTCCTTTGACAGTCAGTCCAGG - Intergenic
914170414 1:145216876-145216898 CCTCCTTTGACAGTCAGTCCAGG + Intergenic
914525530 1:148460842-148460864 CCTCCTTTGACAGTCAGTCCAGG + Intergenic
914598142 1:149174987-149175009 CCTCCTTTGACAGTCAGTCCAGG - Intergenic
914673571 1:149890432-149890454 CCCAAGAAGCCAGTCAGTCCTGG + Intronic
917690828 1:177466673-177466695 CCTCACATGTCTGTCACTCTTGG + Intergenic
918260487 1:182791054-182791076 CCCCAGATGGCAGACAGTCTAGG + Intronic
919199878 1:194342675-194342697 ACACAGATGTCAGTCAGAGCTGG + Intergenic
919523055 1:198613237-198613259 ACTTAGTTGTCAGACAGTCCTGG + Intergenic
920207871 1:204306268-204306290 GCTCAGATGGCAGCCAGGCCAGG + Intronic
920399164 1:205666513-205666535 CATCAGATGGCTATCAGTCCTGG + Intronic
922436062 1:225607812-225607834 CCTCAGCTGTCAGTGTCTCCAGG - Intronic
922461884 1:225819571-225819593 CCACAGATATCAGTAAGTTCTGG - Intronic
924534686 1:244924914-244924936 GCTCAGAGAGCAGTCAGTCCTGG - Intergenic
1065535416 10:26710776-26710798 CCTCAGGTGTCAGTAATCCCAGG - Intronic
1073512241 10:104050074-104050096 CCTCACAGGTCAGTCTGTCATGG - Exonic
1074856140 10:117475060-117475082 CCTAAGATGTGAGTCCTTCCAGG + Intergenic
1075345647 10:121680232-121680254 CCTGAGAAGTCAGTCAGACAAGG + Intergenic
1076056526 10:127378383-127378405 GCACAGATGTCAGTCAGCGCTGG + Intronic
1079724947 11:23869129-23869151 CCCCTAATGTCAGTCAGTCAGGG + Intergenic
1084425148 11:69080370-69080392 CCTCAGAGTTCAGTGAGCCCCGG - Intronic
1087368080 11:97247693-97247715 GCTCTGATGTTAGTGAGTCCTGG + Intergenic
1087422561 11:97948840-97948862 CCTCTGATTTTAGTTAGTCCGGG - Intergenic
1089278169 11:117353676-117353698 CCTCAAATGTGAGTTTGTCCAGG + Intronic
1091838142 12:3600479-3600501 CCTCAGATGCCTGGAAGTCCTGG - Intergenic
1096783864 12:54006174-54006196 CCTCAAATGTCAGTGCGGCCAGG - Intronic
1097019750 12:56011951-56011973 GCTCAGATTTCACTCAGTTCAGG + Intronic
1097068878 12:56340241-56340263 CATCACATGTCAGTCAGTATTGG - Exonic
1099404273 12:82241271-82241293 TCTCTGATGTCAGTTAGACCTGG - Intronic
1099706698 12:86163001-86163023 CCTCTGATATCAGTAAGTCTGGG + Intronic
1099883572 12:88499570-88499592 CTTCAGATAACAGTCAGGCCTGG - Intronic
1102677136 12:114666450-114666472 CCTCAGATTTCTGTAAATCCGGG + Intergenic
1103851690 12:123937508-123937530 CCTCAGATGCCAGCCCGTCAGGG - Exonic
1117009129 14:51452365-51452387 CCTCAGAAGCCCTTCAGTCCTGG + Intergenic
1118973614 14:70658056-70658078 CTTCAGAGATCAGCCAGTCCGGG + Intronic
1120026028 14:79585274-79585296 CCTCAGAAGTCTGGCAGGCCAGG - Intronic
1120670032 14:87352581-87352603 CCTCAGCTGTCTGTGAGTGCGGG - Intergenic
1122135812 14:99632309-99632331 CCTCAGAGGTAAGTCAGTAGAGG - Intergenic
1202939714 14_KI270725v1_random:135935-135957 ACTCAGATGGGAGTCAGACCTGG - Intergenic
1125375396 15:39023578-39023600 CCTCACATTTCTGTGAGTCCAGG - Intergenic
1129231291 15:74198571-74198593 CCTCAGATGGCAGTGAGTAGAGG - Intronic
1131173482 15:90194933-90194955 TCTCAGATGTGATTAAGTCCTGG - Intronic
1131594258 15:93781047-93781069 TCTCCGAGGTCAGTCAGACCAGG - Intergenic
1132883157 16:2171159-2171181 CCTCAGAGGACAGCCAGGCCTGG + Intronic
1134043399 16:11084562-11084584 TGTCAGATGTCTGTCAGACCAGG - Intronic
1138542979 16:57699606-57699628 CCTCAGAGGTCAGCCTGTCCAGG - Intronic
1138978686 16:62240379-62240401 CAACAGATGTCAGCCAGTTCAGG - Intergenic
1141763099 16:86041973-86041995 CCTCAGATTTAAGTCATTCAAGG - Intergenic
1142109948 16:88325955-88325977 CAACACCTGTCAGTCAGTCCAGG + Intergenic
1143139733 17:4734929-4734951 CCTCTGAGGACAGTCAGTCGGGG - Intronic
1144097335 17:11912643-11912665 CCTAGGATCTCAGTCAGTCCTGG + Intronic
1144425299 17:15135630-15135652 CCTTAGATGGCAGTGAGACCTGG - Intergenic
1145121927 17:20267838-20267860 CCTCAGACCTCAGCCAGGCCAGG + Intronic
1146365828 17:32226916-32226938 CCTCACTTGTCAATCACTCCAGG + Intronic
1147215302 17:38895858-38895880 CCTCAGATGTCAGTCAGTCCTGG + Intronic
1147358453 17:39916051-39916073 CCTCTGATCTCAGTTATTCCTGG - Intronic
1156450405 18:37263369-37263391 CCTCCGATGTAGGTTAGTCCTGG - Intronic
1156980325 18:43279175-43279197 CCTCAGATGTCAGACAGCAAAGG - Intergenic
1157680752 18:49603475-49603497 CCTCAGAATTCAAACAGTCCAGG + Intergenic
1158342208 18:56478635-56478657 CCTCAAATTTCAGTGTGTCCTGG - Intergenic
1160947172 19:1649016-1649038 CCTCAGAAGTCACACAGTTCAGG - Intronic
1165108528 19:33488134-33488156 TCCCAGATGTCAGTGAGTCGAGG - Intronic
1166328116 19:42063458-42063480 CATCAGGTGCCAGTCAATCCTGG - Intronic
1167603010 19:50465365-50465387 CATCAGATGTCTGCCAGTCAAGG + Intronic
1167945097 19:52981761-52981783 CCTGAGATGTCACTCTGCCCAGG - Intergenic
925988609 2:9235673-9235695 CCTCAGCTGTCAGCCACTCCTGG - Intronic
927864331 2:26579071-26579093 ACACAGATGTCAGACAGACCTGG - Intronic
930888889 2:56360028-56360050 CTTCTGATGTCAATCAGTCCTGG - Intronic
932429057 2:71663112-71663134 CCTCAGAGGTCAGCCAGAGCAGG - Intronic
937284988 2:120744950-120744972 CCTCAGATCTGGGACAGTCCAGG + Intronic
938804459 2:134793251-134793273 CACAAGATGTCAGTTAGTCCAGG - Intergenic
941997320 2:171612571-171612593 GCTCTGATGTTAGTTAGTCCTGG - Intergenic
942396281 2:175553033-175553055 CCTCAGCTGTCAGTCAGTCCTGG + Intergenic
945406892 2:209459641-209459663 CCTCAGATGTAAGAGAGTCCAGG - Intronic
945562299 2:211353946-211353968 CCCCTGATTTCAGTCAATCCAGG - Intergenic
948858865 2:240743314-240743336 CCTCAGCTGTCAGGCAGGACTGG - Intronic
1169796576 20:9469348-9469370 GCTCAGGTGTCAGTCCGTTCTGG + Intronic
1170357843 20:15511503-15511525 CATCACATCTCAGTAAGTCCAGG - Intronic
1170972745 20:21131427-21131449 CATCAGATGTAAGTGAGGCCAGG + Intronic
1172914855 20:38435938-38435960 CCTCAGATGCCAGTCTGGTCAGG - Intergenic
1174058404 20:47815380-47815402 CCACAGATGTCCCTGAGTCCAGG - Intergenic
1174673824 20:52333975-52333997 CCTCAGATGTCCCTCAGGCTTGG - Intergenic
1177735167 21:25080134-25080156 CCTCAGATGACAGTCTTTTCTGG - Intergenic
1182511028 22:30820546-30820568 CCTCTGAGGTCAGCCAGACCAGG + Intronic
1182846110 22:33432251-33432273 CCTCACAGGTCAGCAAGTCCTGG - Exonic
1183675632 22:39297477-39297499 CCCCAGCTCTCAGTCAGACCAGG + Intergenic
953372935 3:42405680-42405702 CCTCAGATGTGAGGGAGACCTGG + Intronic
953566747 3:44038540-44038562 CTTCAGAAGTAAGCCAGTCCAGG - Intergenic
956985643 3:74696749-74696771 CCTCAGGTTCCAGTCAGTTCAGG + Intergenic
957817671 3:85323157-85323179 CCTCACTTGTCACTCAGTCTAGG + Intronic
963349820 3:144138617-144138639 CCTCAGATGTCAGTGTATGCAGG + Intergenic
963453818 3:145517949-145517971 CTTCAGCTGTCAGTGAGGCCAGG + Intergenic
966555337 3:181252774-181252796 TATCAGATATCAGTCAGTTCTGG - Intergenic
966760266 3:183411721-183411743 CCTCTGATGTCAGGGAGTCTGGG - Intronic
970454937 4:16214197-16214219 CCTTCCATGTCTGTCAGTCCAGG - Intronic
970961912 4:21881874-21881896 CCTCAGATTTCTGTGAGTACTGG - Intronic
979285988 4:118925267-118925289 CTTCACATGTCAGTCAGTCCAGG - Intronic
980096546 4:128497224-128497246 CTTCAGATGTCAGTCACTAGTGG + Intergenic
982862245 4:160467222-160467244 CCTCAGATATCAGTTTATCCAGG + Intergenic
983196038 4:164807593-164807615 CCTCAGATCCAAGTTAGTCCTGG - Intergenic
987303172 5:16615673-16615695 CCTCAGATCTCTGCTAGTCCTGG - Intronic
988629687 5:32915424-32915446 TCTCATATGACAGTCAGTCCTGG + Intergenic
990902819 5:60771537-60771559 ACTCTGATGTCAGACAGACCTGG + Intronic
995527058 5:113058638-113058660 TCTCTGATGTCAGTCAAACCTGG + Intronic
997830503 5:137145765-137145787 CCATAGATGTCAGTCTGTCCAGG - Intronic
997882217 5:137601382-137601404 GCTCAGAAGTCAGACAGACCTGG - Intergenic
998362057 5:141596813-141596835 CCTCAGATGTCTGATAATCCTGG - Intronic
998903917 5:146883115-146883137 CTTTAGGTGTCAGACAGTCCTGG + Intronic
999499507 5:152132569-152132591 GCACAGACCTCAGTCAGTCCTGG + Intergenic
999798647 5:155011700-155011722 CCTTAGAAGTCATTTAGTCCAGG + Intergenic
1001482112 5:172095677-172095699 CCTCAAATTTAATTCAGTCCTGG - Intronic
1004287369 6:14334157-14334179 CCTATGATGTCAGACATTCCTGG + Intergenic
1006602254 6:35233777-35233799 CCCCATCTGTCAGTCAGTTCAGG - Intronic
1007430759 6:41775419-41775441 CCGCCGATGTCAGACAGGCCAGG - Exonic
1011641000 6:89415800-89415822 CTTCAGATCTCAGGCAGTCTTGG - Intergenic
1013013236 6:106138432-106138454 CCTCAGCAATCAGCCAGTCCAGG - Intergenic
1013141384 6:107339188-107339210 CCTCAGATGTCACATATTCCAGG - Intronic
1013753497 6:113434409-113434431 CCTCAGATGTCAGTCACTGTTGG + Intergenic
1014446314 6:121532275-121532297 CCTCAGAAGCAAGTCACTCCAGG - Intergenic
1014870691 6:126592562-126592584 CCTCAGATGACAGTCAGTGATGG + Intergenic
1015639442 6:135315273-135315295 TCTCAGATGTCAGGCAGCTCAGG - Intronic
1022320436 7:29283120-29283142 CCACTGGAGTCAGTCAGTCCTGG + Intronic
1022805938 7:33822798-33822820 CCTCAGAAATAAGGCAGTCCTGG - Intergenic
1023025996 7:36049930-36049952 TCTCAGAATTCACTCAGTCCAGG - Intergenic
1023779150 7:43640015-43640037 GCTCAGAGGTCAGTGAGCCCAGG + Intronic
1024550082 7:50555320-50555342 GCTAAGATGTCAGCCTGTCCTGG - Intronic
1028053692 7:86217406-86217428 CCTCTTATTTCAGTCATTCCAGG + Intergenic
1033409702 7:141106041-141106063 GCTGAGATCTCAGTCAGTCTGGG + Intronic
1034459054 7:151187873-151187895 GCCCAGCTGTCAGTCAGGCCGGG + Intergenic
1037777514 8:21845380-21845402 ATTCAGATGTCCATCAGTCCAGG + Intergenic
1047204978 8:122795803-122795825 GATCAGATGTCACTCAGACCTGG - Intronic
1048078861 8:131102962-131102984 CCTCAGATGAGATGCAGTCCTGG - Intergenic
1048995366 8:139790703-139790725 CCCCAAATGTCCGTCTGTCCAGG + Intronic
1049023467 8:139973191-139973213 CCTCAGAGGCCAGTCTGTGCTGG - Intronic
1049715233 8:144086672-144086694 CCTCAGAGTTGAGTCAGCCCAGG + Intergenic
1050556920 9:6797378-6797400 CTTCAGATGACAGTCTGTCTTGG + Intronic
1052135183 9:24900363-24900385 CTTCACCTGTCAGACAGTCCTGG - Intergenic
1053119895 9:35538719-35538741 CCACAGAGGGCAGTCAGTGCTGG - Exonic
1053276203 9:36785475-36785497 CCTCAGAGGTCATCTAGTCCAGG - Intergenic
1053346700 9:37383453-37383475 GCTCAGATGTGATTCTGTCCTGG + Intergenic
1056927474 9:90847196-90847218 CATGAGATGTCAGTCTGTACAGG - Intronic
1057210566 9:93198930-93198952 CCTCGGGTGTGAGTCAGGCCTGG + Intronic
1057443649 9:95099129-95099151 CCACAGATGTCACGGAGTCCAGG + Exonic
1057834136 9:98430533-98430555 CCTCAGAGCTCAGGCAGGCCTGG - Intronic
1059627269 9:116080691-116080713 CCTCAGAAGGCCTTCAGTCCCGG + Intergenic
1061119352 9:128633755-128633777 CCTCTGCTGCCAGGCAGTCCAGG + Exonic
1190632515 X:52401412-52401434 TCTCAGAAGGCAGTCAGTTCAGG + Intergenic
1192019890 X:67377049-67377071 CCCCAGGTCTCACTCAGTCCTGG + Intergenic
1195402849 X:104480177-104480199 ATTCAGATGTCAGACAGTCATGG + Intergenic
1197371254 X:125628458-125628480 CCTCAGCAGTCAGGCAGTCTTGG + Intergenic
1199886268 X:152024778-152024800 CCTCAGATTCCAGCCAGTCAAGG - Intergenic