ID: 1147215827

View in Genome Browser
Species Human (GRCh38)
Location 17:38898537-38898559
Sequence GAGGGCAGCAGGGATGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 417}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147215827_1147215839 19 Left 1147215827 17:38898537-38898559 CCTGCGGCATCCCTGCTGCCCTC 0: 1
1: 0
2: 0
3: 39
4: 417
Right 1147215839 17:38898579-38898601 CAGCCTGGCAGACGCAAGCCTGG 0: 1
1: 1
2: 0
3: 15
4: 200
1147215827_1147215833 4 Left 1147215827 17:38898537-38898559 CCTGCGGCATCCCTGCTGCCCTC 0: 1
1: 0
2: 0
3: 39
4: 417
Right 1147215833 17:38898564-38898586 TGGTCCCCTTCCTGCCAGCCTGG 0: 1
1: 0
2: 1
3: 32
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147215827 Original CRISPR GAGGGCAGCAGGGATGCCGC AGG (reversed) Intronic
900578050 1:3394047-3394069 GAGGGCAGCAGACTTGCCGGGGG - Intronic
900600701 1:3501593-3501615 GAGGGCAGCCTGGAAGCCCCAGG + Intronic
900622914 1:3595627-3595649 GGGGGCAGCATGGAGGCAGCAGG + Intronic
901510517 1:9716095-9716117 CAGAGCAGCCTGGATGCCGCAGG - Intronic
901871754 1:12142555-12142577 GAGGGCAGCAGGGTGGCCTCTGG + Exonic
902070446 1:13730528-13730550 GAGGGCAACATGGATGGGGCAGG + Intronic
902375331 1:16027640-16027662 GAGGGTAGAAGGGATGAGGCTGG + Intronic
902380294 1:16049437-16049459 GAGGGTAGAAGGGATGAGGCTGG + Intronic
902754918 1:18542608-18542630 GAGTGCAGCAGGGACTCCGGGGG + Intergenic
902761175 1:18581623-18581645 GAGGGCTGCAGGGCTGCGGAAGG - Intergenic
902786886 1:18738614-18738636 CAGGGCAGCAGGGGTGGAGCTGG - Intronic
903008338 1:20312994-20313016 GAGACCAGAAGGGCTGCCGCGGG + Intronic
903580664 1:24368167-24368189 GAGGGCAGAAGGGACTCCTCTGG + Intronic
903707178 1:25294897-25294919 GAGGGCTGCAGGGGTGCAGCGGG + Intronic
903720061 1:25398445-25398467 GAGGGCTGCAGGGGTGCAGCGGG - Intronic
904039918 1:27577751-27577773 GAGGGGAGCAGGGTGGCAGCTGG - Intronic
904418637 1:30377608-30377630 GAAAGCAGCAGGGCTTCCGCAGG + Intergenic
904604192 1:31689975-31689997 GTGGACAGCAGGAATGCCGCTGG + Intronic
905168366 1:36096789-36096811 GAGGGCAGCACAGAGGCCCCTGG - Exonic
905301664 1:36990019-36990041 GAGGGCAGCAGGGATCAAGTGGG + Intronic
905626293 1:39492181-39492203 GCGGGCAGCCGGGAGGCGGCGGG - Exonic
905670604 1:39788274-39788296 GCGGGCAGCCGGGAGGCGGCGGG + Exonic
906167340 1:43696598-43696620 GAGGGCACCAGGGATGGCTAGGG - Intronic
906258207 1:44366795-44366817 GAGCGCAGCAGGGCTGCGGAGGG + Intergenic
906678297 1:47708809-47708831 GAGGGCTGGAGGGACGCGGCGGG + Intergenic
910274437 1:85433279-85433301 GAGGGCAGCAGAGGAGCAGCAGG + Intronic
912558484 1:110533410-110533432 CAGGGCAGCTGAGCTGCCGCTGG + Intergenic
915010103 1:152677338-152677360 GAGGGAAGCAGGGACACAGCAGG + Intergenic
915253165 1:154605055-154605077 GCGGGCAGCAAAGATGACGCAGG - Intronic
916108501 1:161447426-161447448 GAGGGCAGGCCGGTTGCCGCCGG - Intergenic
916110089 1:161454807-161454829 GAGGGCAGGCCGGTTGCCGCCGG - Intergenic
916111674 1:161462217-161462239 GAGGGCAGGCCGGTTGCCGCCGG - Intergenic
916113261 1:161469598-161469620 GAGGGCAGGCCGGTTGCCGCCGG - Intergenic
917318944 1:173758970-173758992 GCGGGCAGCAGGCTTGCCCCAGG - Intronic
917470632 1:175323221-175323243 GAAGGAAGCAGGGATGTCGCAGG - Exonic
918309095 1:183272808-183272830 CAAGGCAGGAGGGATGCCACTGG - Intronic
920179852 1:204125906-204125928 TCGGGCAGCAGGCATGCCGCTGG + Exonic
920455380 1:206097235-206097257 GAGGGCTGCAGGGAGGCAGGAGG - Intronic
922467678 1:225855499-225855521 GATGGCAGCCAGGATGCCTCTGG - Intronic
922518215 1:226223784-226223806 GCAGGGAGCAGGGCTGCCGCAGG - Exonic
1062791216 10:307792-307814 GAGGGCAGCAGGGAGGGTTCAGG + Intronic
1062791236 10:307850-307872 GAGGGCAGCAGGGAGGGTTCAGG + Intronic
1062791258 10:307908-307930 GAGGGCAGCAGGGAGGCTTTGGG + Intronic
1062791279 10:307966-307988 GAGGGCAGCAGGGAGGCTTTGGG + Intronic
1062791299 10:308024-308046 GAGGGCAGCAGGGAGGGTTCAGG + Intronic
1062791319 10:308082-308104 GAGGGCAGCAGGGAGGCTTTGGG + Intronic
1062792377 10:316667-316689 GAGGTGAGCAGGAAAGCCGCTGG - Intronic
1062904649 10:1171681-1171703 GAGGGCATGAGGGATCCCACGGG - Intergenic
1062974572 10:1674090-1674112 GAGGGCTGCAAGGAGGCCACTGG + Intronic
1064024208 10:11833934-11833956 GAGGGCAGCAGGGAGGCAGTGGG + Intronic
1064353209 10:14595861-14595883 GAGACCAGCCGGGGTGCCGCTGG - Intronic
1064417882 10:15166766-15166788 GAAGGCAGCACAGATGCCTCTGG + Intronic
1066013584 10:31216165-31216187 GAGGGGAGCAGGAATGCCAGGGG - Intergenic
1066176466 10:32912592-32912614 CAAGGCAGCAGGGAGGCCGAGGG + Intronic
1067038110 10:42933851-42933873 GCGGGGTGCAGGGAAGCCGCAGG - Intergenic
1067104033 10:43353170-43353192 GTGCTCAGCAGGGATGCCCCAGG - Intergenic
1067774552 10:49153443-49153465 GACTGCAGCATGGATGCTGCAGG + Intergenic
1067833529 10:49623869-49623891 GAGGGCAGCAGGGAAGGAGGAGG - Intronic
1068076180 10:52257574-52257596 TAGGGCAGCAGGGTTTCCCCAGG - Intronic
1068894107 10:62180673-62180695 GCAGGCACCAGGGATGCAGCAGG + Intergenic
1069528973 10:69201186-69201208 GAGGGAAGCAGGGAGGTCACAGG - Intronic
1070328042 10:75400598-75400620 GAGGGCAGGAAAGATGCTGCTGG - Intronic
1072122949 10:92420143-92420165 GCGGGTAGAAGGGAGGCCGCAGG - Intergenic
1073189843 10:101643492-101643514 GAGGGCACCCAGGATGCCGCAGG + Intronic
1073304530 10:102492586-102492608 GAGGGAAGCAGGCATGTTGCTGG - Intronic
1073677506 10:105665178-105665200 GAAGGCAGGAGGAATGCCCCAGG + Intergenic
1075037425 10:119080836-119080858 GGCGGCAGCAGGGCCGCCGCGGG - Intergenic
1075153491 10:119955675-119955697 GAGGACAGCAGGGGTGTCACAGG + Intergenic
1075531887 10:123236696-123236718 GAGGGCAGCATGGAGGCACCTGG - Intergenic
1075842445 10:125516470-125516492 GAGGCCAGCAGGGATTTAGCCGG - Intergenic
1076133667 10:128030202-128030224 CAGGGCAGCAGCCATGCTGCGGG - Intronic
1076742997 10:132497312-132497334 GAGAGCAGCAAGGGTGCCGGCGG + Intergenic
1076743011 10:132497381-132497403 GAGAGCAGCAAGGGTGCCGGCGG + Intergenic
1077010487 11:377107-377129 GAGGACAGCGAGGAGGCCGCGGG + Exonic
1077062419 11:623739-623761 AAGGGCAACAGGGAAGCCGGTGG + Intronic
1077214901 11:1391125-1391147 GAGGGTAGCTGGGTTGCCTCTGG - Intronic
1077225764 11:1438498-1438520 CAGGGCTGCTGGGATGCAGCAGG - Intronic
1077273861 11:1694231-1694253 CAAGGCTGCAGGGATGCGGCTGG - Intergenic
1077394674 11:2315173-2315195 GAGGGGAGCAGGGAGGGGGCAGG - Intronic
1077714712 11:4569410-4569432 GAGGGCAGCAGGAGGGCGGCAGG + Intergenic
1080207974 11:29753125-29753147 GAAGCCAGCTGGGATGCTGCAGG + Intergenic
1080691106 11:34558784-34558806 GAGGGCAGCAGGTCTGCCCGTGG + Intergenic
1080831081 11:35893963-35893985 TAGGGGAGCAGGGAGGCAGCTGG - Intergenic
1083148533 11:60775801-60775823 GAGGGCAGCTGGGATGGGGCTGG - Exonic
1083272161 11:61578041-61578063 GGGGGCAGAAGGGAGGCTGCAGG + Intronic
1083293251 11:61701367-61701389 GCGGGCAGCAGGCATGCAGTAGG - Intronic
1083609288 11:63997559-63997581 GGGGGCAGCAGGGCAGCAGCGGG - Exonic
1083712064 11:64555694-64555716 GTGGGCAGCTCGGATGCCCCAGG + Exonic
1083962254 11:66021014-66021036 GCGGGGAGCAGGGATGGGGCAGG - Intronic
1084091681 11:66882927-66882949 GGGGGCAGAAGGGAGGACGCTGG + Intronic
1084396817 11:68916531-68916553 GATGGCAGCAGGGAGGGTGCTGG + Intronic
1084425104 11:69080189-69080211 GCTGGCAGCAGAGATGCCCCTGG + Intronic
1084491436 11:69480767-69480789 GAGGTCAGCAGGGACCCTGCCGG - Intergenic
1084675239 11:70630246-70630268 GCAGGCAGCAGCGATGCCCCAGG + Intronic
1084779226 11:71397678-71397700 GGGGGCTGCTGGGCTGCCGCTGG - Intergenic
1085461866 11:76698923-76698945 GACAGCAGCAGGCAGGCCGCAGG - Intergenic
1085713036 11:78847364-78847386 AAGGGCAGCAGAGATGCTGGGGG + Intronic
1085741491 11:79081491-79081513 GAGGACAGCAGGGATTACCCAGG + Intronic
1089196960 11:116699514-116699536 GAGGGCAGCAGGGAGTCCTGTGG - Intergenic
1089531466 11:119132589-119132611 GAGGGCAGGAGGGAGGCTGTGGG - Intronic
1089730647 11:120516801-120516823 GAGGGGAGTAGGGAAGCCGGAGG + Intronic
1090392530 11:126398417-126398439 CAGGGAAGCAGGGCTGCCGGAGG - Intronic
1091522222 12:1257055-1257077 GAAGGCAGAAGTGATGGCGCCGG + Intronic
1091859350 12:3765448-3765470 GAGGAAAGCAAGGATGCTGCAGG + Intergenic
1096782008 12:53997020-53997042 CACGGCAGCAGGGATCCCGCCGG + Intronic
1097712832 12:62934454-62934476 GAGGAGAGCAGGGGCGCCGCCGG + Intronic
1099202129 12:79690093-79690115 GGGGGCAGCAGCGACGCCGCTGG - Exonic
1101815611 12:108143858-108143880 GATGGCACCAGGGATGCAGGGGG + Intronic
1102259549 12:111435911-111435933 GACGGCAGCTGGCATGCAGCAGG + Intronic
1102425167 12:112838369-112838391 GAGTGCAGAAGGGATGCTGTGGG - Intronic
1102471738 12:113163297-113163319 GGGGGCAGCAGGCATGACACTGG - Intronic
1104081814 12:125435873-125435895 CAGGGCAGCAGGGAGGCCTGTGG + Intronic
1104941909 12:132399243-132399265 GAGGGCAGCTGGGATGTGGAGGG - Intergenic
1104991517 12:132626352-132626374 CAGAGCAGCAGGGAGGCCCCGGG - Intronic
1105512471 13:21061723-21061745 CAGGCCAGCAGGGAGGCCGTGGG - Intergenic
1106135019 13:26967511-26967533 GAAGGCAGCCGGGCTGGCGCTGG + Intergenic
1106619109 13:31356697-31356719 GGGTGCTGCAGGGATGCCCCTGG + Intergenic
1108418882 13:50228617-50228639 TAGGGCAGTAGGGCTGCTGCAGG - Intronic
1108825081 13:54403564-54403586 GAGGGCAGGAAGAATGCAGCAGG - Intergenic
1110209398 13:72954073-72954095 GAGGGGAGCAGAGCTGCCTCTGG + Intronic
1111712766 13:91838235-91838257 GAGGGCAGCGGGGATGGCAGGGG - Intronic
1112610806 13:100952931-100952953 GAGGGCAGCAGGAAGACTGCTGG - Intergenic
1112719962 13:102232982-102233004 GAGGGCTGCACGGATGTCTCAGG - Intronic
1113704964 13:112424205-112424227 GAGTGCAGCAGAGATGCTGGTGG - Intronic
1114648333 14:24268017-24268039 GAGGACAGCAGGAAGGCCTCAGG - Intronic
1115429163 14:33296546-33296568 GAGGGCACCTGGGGTGCAGCTGG + Intronic
1119753603 14:77098390-77098412 GAGGGGAGCAGGGATGACGGCGG + Intronic
1122394515 14:101413988-101414010 GAGGAATGCAGGGATGCCACTGG - Intergenic
1122421621 14:101581510-101581532 GGGGGCTGCAGGGATGTAGCAGG - Intergenic
1122775150 14:104113732-104113754 GAGGACAGCAAGGATGCCAGCGG - Exonic
1122865225 14:104600879-104600901 GAGGGCAGCCGGGTGGCCCCTGG + Intronic
1122987271 14:105218296-105218318 GGGGGCAGCAGGGGTGGTGCAGG - Intronic
1123124585 14:105937416-105937438 GAGGGCAGCATGGAGGCACCTGG + Intergenic
1124400461 15:29343486-29343508 TAGGGCAGCAGGGAGGCTGGAGG - Intronic
1124653445 15:31489046-31489068 GAGGGCTGCAGGGCTGGCTCAGG + Intronic
1125056220 15:35360874-35360896 GAGGTCAGCAGGCCTGCCACTGG + Intronic
1126687000 15:51257108-51257130 GAGGGCAGTATTGATGCTGCAGG - Intronic
1126705138 15:51399138-51399160 GGGGGCAGCAGGGTTGCCCATGG + Intronic
1128260015 15:66226869-66226891 GCGGGCTGCAGGGCTGCCTCTGG - Intronic
1129664622 15:77572637-77572659 GAGAGCAGCAGGGGTGTCGGGGG - Intergenic
1130436577 15:83905493-83905515 AATGGCAGCAAGGATGCAGCTGG + Intronic
1130443487 15:83977875-83977897 GAGGCCACCAGGGATGCTGTGGG - Intronic
1132409960 15:101569227-101569249 GAGGCCAGCACGGAGGCCTCAGG + Intergenic
1132634791 16:938403-938425 GGGGACAGCAGGGATGGGGCTGG + Intronic
1132855745 16:2043883-2043905 GAGGGCAGCAGGGAGGCCCAAGG + Intronic
1132865534 16:2091194-2091216 GAGGGCGGGAGGGACGCTGCCGG + Intronic
1132974719 16:2705598-2705620 AAGCGCATCAGGGATGCCGCAGG - Intronic
1133074179 16:3267141-3267163 GTGGGCACCAGGGCTGCGGCTGG + Intronic
1133304366 16:4800434-4800456 GGCGGCAGCAGGCCTGCCGCGGG - Intronic
1134037564 16:11042413-11042435 GAGGACAGGAGGGAAGCTGCTGG + Intronic
1134520620 16:14917848-14917870 GAGGGCAGAAGGGATACTGGGGG - Intronic
1134550954 16:15138126-15138148 GAGGGCAGAAGGGATACTGGGGG + Intronic
1134708292 16:16316499-16316521 GAGGGCAGAAGGGATACTGGGGG - Intergenic
1134715507 16:16356532-16356554 GAGGGCAGAAGGGATACTGGGGG - Intergenic
1134951310 16:18352146-18352168 GAGGGCAGAAGGGATACTGGGGG + Intergenic
1134959250 16:18395627-18395649 GAGGGCAGAAGGGATACTGGGGG + Intergenic
1135303354 16:21349510-21349532 GAGGGCAGCAGGGAGCCCCCAGG + Intergenic
1136300099 16:29328704-29328726 GAGGGCAGCAGGGAGCCCCCAGG + Intergenic
1136472274 16:30489127-30489149 GAGGTCAGCACTGATGCCGCTGG - Exonic
1136550404 16:30979717-30979739 GGGGGCCGCAGGGCTGGCGCAGG - Exonic
1137655225 16:50153419-50153441 GAGGGCGGGAGCGACGCCGCCGG + Intronic
1138191507 16:55017500-55017522 GAGGGCAGCATGGAAGCTCCTGG + Intergenic
1138445787 16:57062437-57062459 GATGGGGGCAGTGATGCCGCAGG - Intronic
1141477641 16:84284337-84284359 CAGGGCAGCAGGGATGAAGTGGG + Intergenic
1141592449 16:85077700-85077722 GGGGGCAGCAGGGAGGGTGCGGG + Intronic
1141941027 16:87276364-87276386 GAGGGCAGGAGGGATCTTGCTGG - Intronic
1142061833 16:88035474-88035496 GAGGGCAGCAGGGAGCCCCCAGG + Intronic
1142217711 16:88837987-88838009 GAGGGCGGCAGGCATGGCGGCGG + Intronic
1142230826 16:88899542-88899564 GAGGGCAGCCGGCATGCCTGGGG - Intronic
1142498922 17:321547-321569 GCGGGCAGCAGAGATGGCCCAGG + Intronic
1142848836 17:2694682-2694704 GAGGGCAGCCGGGAGGCTCCCGG - Intronic
1143165078 17:4893569-4893591 GAGGGGAGCAGAGATACCCCTGG + Exonic
1143265351 17:5632703-5632725 GACGGCAGCAGGGAGGGCTCAGG + Intergenic
1143660020 17:8318960-8318982 AAGGACAGCAGGGGTCCCGCTGG - Intronic
1144282962 17:13745102-13745124 GAGGGAAGAAGGGATGGGGCTGG - Intergenic
1144855465 17:18264967-18264989 GAGTGCAGCTGGGCTGCCTCAGG + Exonic
1144872061 17:18377809-18377831 GAGGGCAGGTGGGAGGCAGCGGG - Exonic
1145938050 17:28726479-28726501 GAGGGCAGCGGGGACTCCGTCGG - Intronic
1146270244 17:31480343-31480365 GAGGCAAGCAGGGAGGCAGCAGG + Intronic
1146657213 17:34641699-34641721 CAGGGCAGCAGGCATGGCTCTGG - Intergenic
1147215827 17:38898537-38898559 GAGGGCAGCAGGGATGCCGCAGG - Intronic
1147360128 17:39925119-39925141 GGGGGCAGGAGGGAGGCCACAGG - Intronic
1148048699 17:44759040-44759062 GGGGGCGGCAGGGACGGCGCCGG - Exonic
1148153294 17:45409120-45409142 GAGGGCAGGATGGAAGCAGCGGG + Intronic
1148217008 17:45838827-45838849 GAGGGCAGCAAGGAGGCCTCAGG + Intergenic
1148485355 17:47987404-47987426 GAGGGCATCAAGGCTGCTGCAGG + Intergenic
1148865350 17:50625518-50625540 GAGGGCAGCAGGGACACAGAAGG + Intronic
1149607502 17:57935570-57935592 GAGGGCAGCGGGGATGGGGCGGG - Intronic
1150233601 17:63574050-63574072 GAGTGCAGCGGAGATGCAGCTGG - Intronic
1150294055 17:63998560-63998582 GCAGGGAGCAGGGAGGCCGCGGG + Intronic
1150823976 17:68457892-68457914 GAGGGAAGAAGGAATGCGGCTGG + Intergenic
1150859115 17:68783103-68783125 GAGGGCAGCAGGCTTTCCTCTGG + Intergenic
1151538058 17:74749632-74749654 GAGGGCACCAGGGAAGGAGCAGG - Intronic
1151713899 17:75821811-75821833 GAGGGCAGCTGGGTTGGCGGTGG + Intronic
1151749226 17:76027253-76027275 GAGGGCAGGTGGGAGGCAGCGGG + Exonic
1151878391 17:76880329-76880351 GAGGTCAGAAGGGAGGCCACAGG - Intronic
1152130093 17:78471331-78471353 GTGGGCAGCAGGTGGGCCGCAGG + Intronic
1152583914 17:81180740-81180762 GAGGAGAGCAGAGATGCCTCTGG + Intergenic
1152724973 17:81940707-81940729 GCGAGCAGGAGGGAAGCCGCGGG - Exonic
1152965635 18:111845-111867 GCTGGCAGCCGGGAGGCCGCAGG + Intergenic
1153324718 18:3806794-3806816 GAGGGGAGCAGGGAAGGCCCTGG - Intronic
1153834135 18:8949257-8949279 GAAGGCAGCAGGGGTGGGGCAGG + Intergenic
1154170812 18:12048631-12048653 GAGGTGAGCAGTGGTGCCGCAGG + Intergenic
1156399509 18:36727951-36727973 GATGGCAGCAGGGATTCCCTGGG - Intronic
1158461335 18:57648644-57648666 GACGGCAGCAGGTGTTCCGCCGG - Exonic
1160006944 18:75074929-75074951 GAGGCCAGCAGAGATCCCCCAGG + Intergenic
1160815252 19:1032473-1032495 GAGCGGAGCAGGGATGGTGCTGG + Intronic
1161021551 19:2013803-2013825 GGAGGCAGCAGGGAGGACGCAGG + Intronic
1161051706 19:2167396-2167418 CAGGGCAGCAGGCATGCGGGCGG - Intronic
1161295706 19:3519226-3519248 CAGGGCAGCAGGGACTCTGCAGG - Intronic
1161315474 19:3615346-3615368 GAGAGCAGCACTGAGGCCGCCGG - Intronic
1161331868 19:3692392-3692414 AAGGGCAGCATGGGGGCCGCCGG - Intronic
1161360281 19:3844941-3844963 GGGGGCTGCAGGGTTGCCCCAGG + Intronic
1162419365 19:10557498-10557520 GGGGGCACCAGGTATGCCGAAGG - Intronic
1162495025 19:11018738-11018760 GAGGACAGAAGGGAGGCCACTGG - Intronic
1162929895 19:13952590-13952612 GCGGGCAGCAGGGCGGCGGCGGG + Exonic
1163087500 19:14992938-14992960 GGGGGCTGCGGGGATGCCTCAGG - Intronic
1163255731 19:16154693-16154715 TATGGCAGCAGGGCTGGCGCTGG - Intronic
1163302653 19:16457608-16457630 GAGGGCAGAAGGGATGGAACTGG + Intronic
1163311047 19:16514770-16514792 CAGGGCTGCAGGGATGCAGTGGG + Intronic
1164625502 19:29724892-29724914 GAGCGCAGCAGAAAGGCCGCTGG - Intergenic
1164686184 19:30168252-30168274 GAGGGCACCAGAGATGCCAGGGG - Intergenic
1165114971 19:33523177-33523199 GAGGACAGCAGGGATGGTACTGG - Intergenic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166864070 19:45825680-45825702 GAGGGCAGCAGAGCAGCAGCGGG - Intronic
1167396833 19:49235028-49235050 GGGGGCAGCAGGGATGGGGCTGG + Intergenic
1167672121 19:50859381-50859403 GAGGGCAGCAGGGATGTGGAGGG + Intronic
1167728246 19:51233832-51233854 GAGGGCAGCATGGAGGCACCCGG - Intronic
1167748665 19:51367381-51367403 GAGGGCAGCTGGGGAGCCTCTGG + Intronic
1168275772 19:55277532-55277554 GAAGGCAGCAGGGAGGCTGACGG + Intronic
925117936 2:1396201-1396223 GAGGCCAGCAGGGGTTCCCCAGG + Intronic
925580126 2:5401658-5401680 CAGGGCTGCAGGGATCCCACGGG + Intergenic
925871812 2:8278239-8278261 GAGGGCAGCTGGGGTGCGGGAGG - Intergenic
926420178 2:12688199-12688221 GATGGCAGCAGGGTTGCTGTAGG - Intergenic
927904986 2:26849225-26849247 GAGGGGAGGAGGGATGCAGGCGG + Intronic
929055138 2:37870034-37870056 GATGGCAGCAGGGATGATGCAGG + Intergenic
929604531 2:43226087-43226109 GAGGGCGGCAAGGAGGGCGCCGG - Intronic
930698235 2:54432918-54432940 AAGGGCACCAGGGAGGCCACTGG + Intergenic
931257141 2:60583585-60583607 GTGGGCAGCAGGGCTGCCTTAGG + Intergenic
931429291 2:62196383-62196405 GAGGGCAGCGGGGAGGGAGCCGG - Intronic
931471777 2:62545425-62545447 GAGGTCAGCAGGGATGGCAGTGG + Intergenic
932126162 2:69147042-69147064 GAGGGCAGCATGGAGGCCAGAGG + Intronic
934678559 2:96266426-96266448 GAGGCCAGCAGGGTCCCCGCGGG - Exonic
935078179 2:99766393-99766415 TAGGACAGCAGGGATGTCTCTGG + Intronic
936093288 2:109514527-109514549 CAGGCCAGGCGGGATGCCGCAGG + Intergenic
937122851 2:119452761-119452783 CAGGGCAGCAGCGAGGCAGCGGG - Intronic
937126071 2:119475876-119475898 GAGGGCCAAGGGGATGCCGCTGG + Intronic
937280467 2:120714059-120714081 GTGGGCAGCTGGGATCCCACGGG + Intergenic
937504097 2:122516783-122516805 CAGGGCAGCAGGTATGACGAAGG - Intergenic
938375308 2:130801430-130801452 GAGGGCCACAGGGATGCTTCTGG - Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938689690 2:133776197-133776219 GAGGGCAGCAGGGGTGGGACAGG + Intergenic
940347003 2:152638425-152638447 GAGGGGAGGAGGGATGTGGCAGG + Intronic
941025295 2:160449957-160449979 GAGGGCAGCAGGGAGTCCTGTGG - Intronic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941489642 2:166127298-166127320 GAAGGCAGCGGGGCTGCTGCTGG - Intronic
942464075 2:176189385-176189407 GAAGGCGGCAGGGAGGCCGGAGG - Exonic
944820903 2:203429832-203429854 GCGGTCAGCAGGAATGCAGCTGG + Exonic
945940278 2:215942388-215942410 GAGGGGCGCAGGGGTGCCTCAGG - Intergenic
946235485 2:218322399-218322421 GAGGGCAGCAGTGAGGGAGCTGG + Intronic
947353727 2:229271571-229271593 GGGGGCAGCGGGGATGTCGGGGG + Intergenic
947800272 2:232925266-232925288 GAAGGCAGCTGGGCTGCTGCAGG + Intronic
947872568 2:233447618-233447640 AAGGACAGCAGGGATCCCACAGG + Intronic
947877292 2:233476201-233476223 GAGGGCAGAAAGGACACCGCTGG - Exonic
948423222 2:237873120-237873142 GAGGGGAGCAGGGAGGCTTCAGG + Intronic
948604480 2:239126264-239126286 AGGGGCAGAAGGGATGCTGCTGG - Intronic
948644978 2:239398839-239398861 GCTGGCAGCAGGCATGCCCCCGG - Intronic
948673765 2:239585061-239585083 CAGGGCAGCAGGGGGGCAGCAGG - Exonic
948843707 2:240672878-240672900 GGGGGCCGCTGGGCTGCCGCTGG + Intergenic
949034842 2:241811634-241811656 GCGGGCTGCAGGGATTCCGAGGG + Intronic
1168984816 20:2039046-2039068 GAGGGATGGAGGGATGCCTCTGG - Intergenic
1170169021 20:13391042-13391064 CAGGGCAGCAGGCTTGCCTCTGG - Intronic
1172106034 20:32517788-32517810 GAGGGCACCTGGGACGCAGCGGG - Intronic
1172448331 20:35004576-35004598 GAGGGAGGCAGGGGTGCAGCAGG + Intronic
1172806642 20:37616612-37616634 GAGGCCAGCATGGCTGCTGCTGG + Intergenic
1172901362 20:38337183-38337205 GAAGGCACCAGGGGTGCCGGGGG + Exonic
1173225994 20:41162791-41162813 CAGGGCAGCAGGGCTGAGGCAGG - Intronic
1173869328 20:46331746-46331768 GAGGGTTGCAGGGAGGCCTCGGG + Intergenic
1174042211 20:47708121-47708143 GAGGGCAGAAGGGATCCTGGTGG - Intronic
1174180075 20:48669036-48669058 GAGGGCTGCAGGGAGGTGGCAGG - Intronic
1174489628 20:50883761-50883783 GAGGGCAGCAGGTCTGAGGCTGG + Intergenic
1175199284 20:57266709-57266731 GAGGGCAGGTGGGAGGCCGCCGG - Intergenic
1175256818 20:57652712-57652734 GAGGGCAGCAGGGCTGGCGGGGG + Intronic
1175278677 20:57788357-57788379 GAGGGCAGCAGGGCAGAGGCAGG - Intergenic
1175943209 20:62547353-62547375 GAGGCCAGCATGGCTGCCACTGG - Intergenic
1175949851 20:62577614-62577636 GAGGGCAGCAGGGCTGGGGCTGG + Intergenic
1175956271 20:62611019-62611041 GAAGGAAGCAGGGATGCTCCAGG + Intergenic
1176220548 20:63967512-63967534 GTGTGCTGCAGGGATGCCGGTGG - Exonic
1179525082 21:41970891-41970913 GAGGGAGCCAGGGCTGCCGCTGG - Intergenic
1179615579 21:42581073-42581095 GAGGGCAGCAGGAAGGCCAGGGG - Exonic
1179924945 21:44529209-44529231 GAGAGCAGTGGGGATGCGGCGGG + Intronic
1180589139 22:16921387-16921409 GTGAGCAGCTGGGATGCCACAGG + Intergenic
1180949266 22:19714065-19714087 GAGGTCAGCAGGGATGGTCCTGG - Intergenic
1181052129 22:20242956-20242978 GCTGGCAGCAGGGATGCCCACGG + Exonic
1181306812 22:21921676-21921698 GGAGGCAGCAGGGATGCTGCTGG - Exonic
1181862987 22:25833805-25833827 GATGGCAGGAGAGATGCCACCGG - Intronic
1182583362 22:31328493-31328515 GAGCCCTGCAGGGATGCCCCGGG - Intronic
1182771796 22:32801708-32801730 GCGGGCAGCAGGCAGGCGGCGGG + Exonic
1183102941 22:35594923-35594945 CAGGGCAGATGGGATGCCGCTGG - Intergenic
1183327603 22:37202926-37202948 GAGGGGAGCTGGGAACCCGCAGG - Intergenic
1183353111 22:37344493-37344515 GGGGGCAGCAGGGGGGCCTCTGG - Intergenic
1183360414 22:37380266-37380288 GAGGTCAGCAGGGAAGATGCAGG + Intronic
1183512620 22:38244944-38244966 CAGGGCAGCAGGGGTGAGGCTGG + Intronic
1183706727 22:39478947-39478969 GATGGCAGCAGGCAGGCCTCAGG - Intronic
1183945388 22:41322987-41323009 GAGAGCAGCATGGATACCGAGGG - Intronic
1184508266 22:44917168-44917190 GAGGGCAGCCGGGCAGCCACTGG + Intronic
949519223 3:4834516-4834538 GAGGGGAGGAGGGATGACGTGGG - Intronic
949867154 3:8555465-8555487 GTGGGGAGCAGGGATTCCTCTGG - Intronic
950013692 3:9741693-9741715 GATAGCAGCAGGGCTGACGCTGG + Intronic
950209978 3:11116027-11116049 GAGGGCATGAGGGAAGCCCCAGG - Intergenic
950282598 3:11720188-11720210 GAGGGCGGCGTGGGTGCCGCAGG - Intronic
950360398 3:12445578-12445600 GAGGGCAGGAGGGATGGAGGTGG - Intergenic
950778683 3:15372792-15372814 GAGGGCAGCAGGGGTGGCTCTGG - Intergenic
951508937 3:23480155-23480177 GAGTGCAGGAGGGAGGCCGGGGG - Intronic
951701546 3:25502208-25502230 GAGGGCAGCAGCCATGTCTCAGG - Intronic
953605718 3:44411960-44411982 CAGGACAGCAGAGATGCCTCAGG + Intergenic
953885433 3:46712249-46712271 GAGGGCAGCAAGGAGGCTGAGGG + Exonic
954080004 3:48208001-48208023 GAGGGCAGCTGGGACTCCTCAGG - Intergenic
954154493 3:48677915-48677937 GAGGGCATCAGGGAGGCAGTGGG - Intronic
954303825 3:49715154-49715176 GAGGACAGCAGGTTTGCAGCAGG + Intronic
954428518 3:50456606-50456628 GAGGGCAGCAGGGTTCCTGGTGG - Intronic
954463405 3:50640534-50640556 GAGGGCCACAGGGATGCCGAGGG - Intronic
954813101 3:53260017-53260039 GAGGGCATCAGGGAGGCCTCAGG + Intergenic
955888492 3:63625657-63625679 GGGGGCAGCAGGGGTGCAGAGGG - Intergenic
956163700 3:66380675-66380697 CAGTGCAGCAGGACTGCCGCTGG - Exonic
959905161 3:111703212-111703234 GAGGGATGCAGGGATGGTGCTGG + Intronic
960281337 3:115784321-115784343 CAGGGCAGGAGGGAGGGCGCAGG + Intergenic
961126745 3:124425524-124425546 GAGGTCAGCAGGGCTCCAGCAGG + Intronic
961306148 3:125959921-125959943 GGGGCCAGCAGGGATGGCCCAGG - Intergenic
961529088 3:127528928-127528950 CAGGGCAGCTGGGATGGGGCTGG - Intergenic
961810388 3:129518637-129518659 GAGGCCAGCAGGGGTCCTGCAGG - Intronic
962682684 3:137816015-137816037 GAGGGCAGCAGGGGTGCCAGAGG - Intergenic
963006836 3:140734444-140734466 CAGGGCATCAGGGATGCCTTCGG - Intergenic
964634354 3:158843824-158843846 GGGGGAAGCAGGGATGCCGGCGG - Intergenic
964720491 3:159764265-159764287 GCGGGCAGGAGGGAAGCCTCAGG + Intronic
964917580 3:161854989-161855011 GGAGGCAGCAGGGAGGCCACGGG - Intergenic
965956848 3:174380558-174380580 CAGGGCAGCAGAGCAGCCGCAGG + Intergenic
966620734 3:181961265-181961287 GAGGGTAGCAGAGATGACGTGGG - Intergenic
966854814 3:184186590-184186612 GGGGACAGCAAGGATGACGCGGG + Exonic
967162060 3:186747724-186747746 GATGGATGCAGGGATGCCGAAGG + Intergenic
967867684 3:194203938-194203960 GGGGTCACCAGGGATGCCCCTGG - Intergenic
967894203 3:194383684-194383706 GAGGGCAGTAGGGATGCTCACGG + Intergenic
968008642 3:195259481-195259503 AAGGGCAGCAGGGAGGCCTTCGG + Intronic
968519165 4:1027981-1028003 TTGGGCAGCAGGGAGGCCTCAGG + Intergenic
968804583 4:2763998-2764020 GCGGGCAGCGGGGGTGCAGCGGG + Intergenic
968879458 4:3291866-3291888 GAGTCCAGCAGGGTTCCCGCTGG - Intergenic
968890683 4:3366994-3367016 CAGGGCAGCAGGGATGATGGGGG - Intronic
968913356 4:3486620-3486642 CAGGGCAGCGGGGAGGGCGCTGG - Intronic
968951893 4:3699754-3699776 GAAGGCAGCAGAGCTGCTGCAGG + Intergenic
969185205 4:5469478-5469500 GAAGACAGCATGGCTGCCGCAGG + Intronic
969284729 4:6196085-6196107 AAAGGCAGGAGGGATGCCCCCGG + Intronic
969491467 4:7501495-7501517 GAAGGCACCAGGGCTGGCGCTGG + Intronic
969515712 4:7647095-7647117 GAGGGAAGTAGGGATGCTCCAGG + Intronic
969694306 4:8726001-8726023 GAGTGCAGGAGGGAGGCCGTTGG + Intergenic
969713416 4:8857439-8857461 CGGCGCAGCAGGGAAGCCGCGGG - Intronic
973981965 4:56314887-56314909 GAGAGCAGCAGGGAAGGAGCGGG + Exonic
977787254 4:101051035-101051057 GAGAGCAGCCAGGATGCTGCTGG + Intronic
978468884 4:109039522-109039544 GAGGGGATCAGGAATGCCTCTGG - Intronic
978576804 4:110197059-110197081 GAGGGCAGGCGGGAGGGCGCGGG + Intronic
980970987 4:139567095-139567117 GATGACAGCAGGGATGCTGGTGG - Intronic
985110990 4:186546344-186546366 GAGGGGAGCAGTGAGGCCGACGG - Intronic
985280661 4:188283004-188283026 GTAGGAAGCAGGGGTGCCGCCGG + Intergenic
985680377 5:1252873-1252895 AAGGGCAGCAGGGATGCTGGGGG - Intergenic
985695217 5:1336241-1336263 GCAGGCAGCTGGGATGCAGCAGG - Intronic
985852714 5:2400404-2400426 GAGAGTAGCAGGGCTGCAGCAGG - Intergenic
988470683 5:31534039-31534061 GGGGGCAGCAGGAAGGCCGCTGG + Intronic
993852217 5:93024325-93024347 GAGAGCAGTAGGGATGAGGCTGG + Intergenic
995555952 5:113328942-113328964 AAGGGAAGGAGGGATGCTGCAGG - Intronic
996749660 5:126875748-126875770 TGGGGGAGCAGGGAAGCCGCAGG + Intronic
997022309 5:130015928-130015950 GACAGCAGCATGGATGCAGCTGG + Intronic
997601517 5:135141761-135141783 GAGGGCACCTGGGATGCTGAGGG + Intronic
998621213 5:143796195-143796217 GAGGGCAGCAGGGAGGGAGGAGG - Intergenic
999062813 5:148654171-148654193 GGGGGCGGCAGGGAGGGCGCAGG - Intronic
1000827964 5:166069917-166069939 AAGGGCAACAGGCATGCCCCTGG + Intergenic
1001551350 5:172604279-172604301 GATGGCAGCACGGATGATGCTGG - Intergenic
1001570245 5:172726002-172726024 GAGGCCAGCATGGCTGCAGCGGG - Intergenic
1002490069 5:179569541-179569563 GAGGACCCCAGGGATGCAGCTGG + Intronic
1004458089 6:15810192-15810214 GAGGGAAACAGGGAGGCAGCTGG + Intergenic
1005740461 6:28786111-28786133 GAGGGAAGCAGGGACGCGGTGGG + Intergenic
1005743445 6:28814256-28814278 GAGGGAAGCAGGGACGCGGTGGG + Intergenic
1006375622 6:33670269-33670291 GATGGCAGCCGGGAGGCTGCTGG - Intronic
1006914906 6:37587914-37587936 GAGGGAAGCGGGGCTGCGGCTGG - Intergenic
1007373831 6:41443309-41443331 GGGGGCAGGCGGGAGGCCGCGGG - Intergenic
1011930193 6:92701577-92701599 GAGTGCAGGAGGGATGGCGGAGG - Intergenic
1016703023 6:147075468-147075490 GAGTGCAGCAGGGAGGGCTCTGG - Intergenic
1017884355 6:158586885-158586907 GGGGGACGCAGGGATGCCTCAGG - Intronic
1018742172 6:166738330-166738352 GAAGGCAGCAGGGAGGTGGCTGG + Intronic
1018978198 6:168581773-168581795 GGGGGCTGCAGGGAGGCAGCGGG - Intronic
1019422419 7:957249-957271 AAAGGCAGCAGGGAGGCCTCAGG + Intronic
1019552854 7:1611913-1611935 GAGAGCAGCAGGGATGAGGCTGG - Intergenic
1019565842 7:1678669-1678691 AAGGGCAGCAGGGCTGAGGCTGG - Intergenic
1019578860 7:1750330-1750352 CAGGGCAGCAGGGGAGGCGCTGG + Intergenic
1019757966 7:2787446-2787468 GAGTGCAGCAGGGAGGCTGACGG - Intronic
1025042717 7:55662218-55662240 GTGTGCAGCAGTGCTGCCGCTGG - Intergenic
1026438008 7:70416817-70416839 GAGGGGAGCAGGGGTGCAGGAGG - Intronic
1027485032 7:78750656-78750678 GAGGGCAGCAGTGTTTCCTCTGG + Intronic
1028477136 7:91264977-91264999 GAGGGCAGCGGGGACGCCGGTGG + Exonic
1029348006 7:99992760-99992782 GAGAGCAGCAGAGATACCCCAGG + Intergenic
1029690447 7:102177839-102177861 CAGCCCAGCAGGGATGCGGCAGG - Intronic
1033049137 7:137988279-137988301 GAGGGGAGCAGGGATGTGTCTGG + Intronic
1033423352 7:141221747-141221769 GAGGGCAGCAGGAAGGTGGCTGG + Intronic
1033599176 7:142876699-142876721 GAGGGGAGCTGGGATGCTGCAGG - Intronic
1033606003 7:142928982-142929004 GAGGGGAGCTGGGATGCTGTGGG - Intronic
1034969312 7:155409220-155409242 GAGGGCAGCCGGCCTGCCGAGGG + Intergenic
1035153200 7:156892612-156892634 AAGGGCAGCACCGAGGCCGCGGG + Intronic
1035239964 7:157523172-157523194 GTGGGCAGCAGGGATGGTGGGGG + Intergenic
1035247006 7:157569132-157569154 GAGGGGAGAAGGGAGGCCCCTGG + Intronic
1035635363 8:1139971-1139993 GAGGGCAGCAAGGCTGGCTCAGG - Intergenic
1039593499 8:38770177-38770199 TAGCTCAGCAGGGAAGCCGCGGG - Intronic
1039887212 8:41661749-41661771 CAAGGCAGCAGTGATGGCGCTGG + Intronic
1039888567 8:41669578-41669600 GATGGCAGCAGGGATGGGGTGGG - Intronic
1040299742 8:46181680-46181702 GGGGGTAGCAGCGAGGCCGCAGG - Intergenic
1040310897 8:46236317-46236339 GAGTGCAGCAGGGACTCAGCAGG + Intergenic
1044248984 8:89984500-89984522 AAGGGCAGAAGGGAAGCCTCGGG - Intronic
1048513698 8:135085886-135085908 GATGGCAGCTGGGATGCTGGAGG + Intergenic
1049193476 8:141302377-141302399 GAGGGCAGCGGGGATGGGGGTGG - Intronic
1049582676 8:143420026-143420048 GAGGGGAGCAGGGAAGGAGCAGG - Intronic
1049641767 8:143719182-143719204 GAGGGCAGCAGGGAGGTGGAGGG - Intronic
1056765339 9:89441587-89441609 GAGGGCAGCCTGGAAGCAGCAGG + Intronic
1057840569 9:98482807-98482829 GAGAGCAGCATGGAAGCCACCGG - Intronic
1057994832 9:99811729-99811751 GAGGAAAGCAGGGAGGCAGCAGG + Intergenic
1060785988 9:126451934-126451956 GAGGACACCTGGAATGCCGCGGG + Intronic
1060818914 9:126650590-126650612 GAGGGCAGCGGGAAAGCCCCAGG + Intronic
1061481493 9:130899556-130899578 GAGGGATGCACCGATGCCGCAGG + Intergenic
1061781549 9:132999268-132999290 GGGGGCTGCAGGGATGCTGCGGG + Intergenic
1061791302 9:133060697-133060719 GAGGGCAGAGGGGAGGCAGCAGG - Intergenic
1061794966 9:133081176-133081198 GAGGGCAGAGGGGAGGCAGCAGG - Intronic
1061886751 9:133594952-133594974 GAGGTCAGCAGAGACCCCGCAGG + Intergenic
1062130264 9:134888711-134888733 GCGGGAAGCAGGGATGGCCCTGG + Intergenic
1062323280 9:136000971-136000993 GTGGGCAGCAGTGAGGCCCCTGG + Intergenic
1062393195 9:136342219-136342241 GAGGGTACTAGGGGTGCCGCAGG - Intronic
1203768390 EBV:38328-38350 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203768440 EBV:38453-38475 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203768490 EBV:38578-38600 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203768540 EBV:38703-38725 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203768590 EBV:38828-38850 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203768640 EBV:38953-38975 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203768690 EBV:39078-39100 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203768740 EBV:39203-39225 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203768790 EBV:39328-39350 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203768840 EBV:39453-39475 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203768890 EBV:39578-39600 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203768940 EBV:39703-39725 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1189847508 X:45150648-45150670 GAGTGCAGCAGGGATGCTAACGG + Exonic
1190456412 X:50632397-50632419 GATGGCATCAGGGATGCCATGGG + Intronic
1190789646 X:53686683-53686705 GAGGGGAGCAGGGCTGGAGCAGG - Intronic
1193826404 X:86231902-86231924 GAAGGCAGCAGGGAGGCCCTGGG - Intronic
1194911979 X:99656586-99656608 GATGGCAGGAGAGATGCTGCAGG + Intergenic
1196191377 X:112798431-112798453 GAGAGCAGGAGGGATGTAGCGGG + Intronic
1199607155 X:149586281-149586303 GCTGGCAGCAGGGGTGCTGCTGG + Intronic
1199631967 X:149783087-149783109 GCTGGCAGCAGGGGTGCTGCTGG - Intronic
1200092196 X:153641260-153641282 GAGGGCAGCAGCTTTGCCTCTGG - Intergenic
1201176064 Y:11308686-11308708 GGTGGCAGCTGGGATGCTGCAGG - Intergenic
1201180039 Y:11334108-11334130 GGGGGCAGCTGGGAGGCTGCAGG - Intergenic